Barley yellow dwarf virus-GAV 17K protein disrupts thiamine biosynthesis to facilitate viral infection in plants.

Thiamine functions as a crucial activator modulating plant health and broad-spectrum stress tolerances. However, the role of thiamine in regulating plant virus infection is largely unknown. Here, we report that the multifunctional 17K protein encoded by barley yellow dwarf virus-GAV (BYDV-GAV) interacted with barley pyrimidine synthase (HvTHIC), a key enzyme in thiamine biosynthesis. HvTHIC was found to be localized in chloroplast via an N-terminal 74-amino acid domain. However, the 17K-HvTHIC interaction restricted HvTHIC targeting to chloroplasts and triggered autophagy-mediated HvTHIC degradation. Upon BYDV-GAV infection, the expression of the HvTHIC gene was significantly induced, and this was accompanied by accumulation of thiamine and salicylic acid. Silencing of HvTHIC expression promoted BYDV-GAV accumulation. Transcriptomic analysis of HvTHIC silenced and non-silenced barley plants showed that the differentially expressed genes were mainly involved in plant-pathogen interaction, plant hormone signal induction, phenylpropanoid biosynthesis, starch and sucrose metabolism, photosynthesis-antenna protein, and MAPK signaling pathway. Thiamine treatment enhanced barley resistance to BYDV-GAV. Taken together, our findings reveal a molecular mechanism underlying how BYDV impedes thiamine biosynthesis to uphold viral infection in plants.

Inhibitors of dermatan sulfate epimerase 1 decreased accumulation of glycosaminoglycans in mucopolysaccharidosis type I fibroblasts.

Genetic deficiency of alpha-L-iduronidase causes mucopolysaccharidosis type I (MPS-I) disease, due to accumulation of glycosaminoglycans (GAGs) including chondroitin/dermatan sulfate (CS/DS) and heparan sulfate (HS) in cells. Currently, patients are treated by infusion of recombinant iduronidase or by hematopoietic stem cell transplantation. An alternative approach is to reduce the L-iduronidase substrate, through limiting the biosynthesis of iduronic acid. Our earlier study demonstrated that ebselen attenuated GAGs accumulation in MPS-I cells, through inhibiting iduronic acid producing enzymes. However, ebselen has multiple pharmacological effects, which prevents its application for MPS-I. Thus, we continued the study by looking for novel inhibitors of dermatan sulfate epimerase 1 (DS-epi1), the main responsible enzyme for production of iduronic acid in CS/DS chains. Based on virtual screening of chemicals towards chondroitinase AC, we constructed a library with 1,064 compounds that were tested for DS-epi1 inhibition. Seventeen compounds were identified to be able to inhibit 27%-86% of DS-epi1 activity at 10 µM. Two compounds were selected for further investigation based on the structure properties. The results show that both inhibitors had a comparable level in inhibition of DS-epi1while they had negligible effect on HS epimerase. The two inhibitors were able to reduce iduronic acid biosynthesis in CS/DS and GAG accumulation in WT and MPS-I fibroblasts. Docking of the inhibitors into DS-epi1 structure shows high affinity binding of both compounds to the active site. The collected data indicate that these hit compounds may be further elaborated to a potential lead drug used for attenuation of GAGs accumulation in MPS-I patients.

A viral protein competitively bound to rice CIPK23 inhibits potassium absorption and facilitates virus systemic infection in rice.

Potassium (K+) plays a crucial role as a macronutrient in the growth and development of plants. Studies have definitely determined the vital roles of K+ in response to pathogen invasion. Our previous investigations revealed that rice plants infected with rice grassy stunt virus (RGSV) displayed a reduction in K+ content, but the mechanism by which RGSV infection subverts K+ uptake remains unknown. In this study, we found that overexpression of RGSV P1, a specific viral protein encoded by viral RNA1, results in enhanced sensitivity to low K+ stress and exhibits a significantly lower rate of K+ influx compared to wild-type rice plants. Further investigation revealed that RGSV P1 interacts with OsCIPK23, an upstream regulator of Shaker K+ channel OsAKT1. Moreover, we found that the P1 protein recruits the OsCIPK23 to the Cajal bodies (CBs). In vivo assays demonstrated that the P1 protein competitively binds to OsCIPK23 with both OsCBL1 and OsAKT1. In the nucleus, the P1 protein enhances the binding of OsCIPK23 to OsCoilin, a homologue of the signature protein of CBs in Arabidopsis, and facilitates their trafficking through these CB structures. Genetic analysis indicates that mutant in oscipk23 suppresses RGSV systemic infection. Conversely, osakt1 mutants exhibited increased sensitivity to RGSV infection. These findings suggest that RGSV P1 hinders the absorption of K+ in rice plants by recruiting the OsCIPK23 to the CB structures. This process potentially promotes virus systemic infection but comes at the expense of inhibiting OsAKT1 activity.

Tilletia horrida glycoside hydrolase family 128 protein, designated ThGhd_7, modulates plant immunity by blocking reactive oxygen species production.

Tilletia horrida is an important soilborne fungal pathogen that causes rice kernel smut worldwide. We found a glycoside hydrolase family 128 protein, designated ThGhd_7, caused cell death in Nicotiana benthamiana leaves. The predicted signal peptide (SP) of ThGhd_7 targets it for secretion. However, loss of the SP did not affect its ability to induce cell death. The 23-201 amino acid sequence of ThGhd_7 was sufficient to trigger cell death in N. benthamiana. ThGhd_7 expression was induced and upregulated during T. horrida infection. ThGhd_7 localised to both the cytoplasm and nucleus of plant cells, and nuclear localisation was required to induce cell death. The ability of ThGhd_7 to trigger cell death in N. benthamiana depends on RAR1 (required for Mla12 resistance), SGT1 (suppressor of G2 allele of Skp1), and BAK1/SERK3 (somatic embryogenesis receptor-like kinase 3). Heterologous overexpression of ThGhd_7 in rice reduced reactive oxygen species (ROS) production and enhanced susceptibility to T. horrida. Further research revealed that ThGhd_7 interacted with and destabilised OsSGT1, which is required for ROS production and is a positive regulator of rice resistance to T. horrida. Taken together, these findings suggest that T. horrida employs ThGhd_7 to disrupt ROS production and thereby promote infection.

High-Quality Nuclear Genome and Mitogenome of Bipolaris sorokiniana LK93, a Devastating Pathogen Causing Wheat Root Rot.

Bipolaris sorokiniana, one of the most devastating hemibiotrophic fungal pathogens, causes root rot, crown rot, leaf blotching, and black embryos of gramineous crops worldwide, posing a serious threat to global food security. However, the host-pathogen interaction mechanism between B. sorokiniana and wheat remains poorly understood. To facilitate related studies, we sequenced and assembled the genome of B. sorokiniana LK93. Nanopore long reads and next generation sequencing short reads were applied in the genome assembly, and the final 36.4-Mb genome assembly contains 16 contigs with the contig N50 of 2.3 Mb. Subsequently, we annotated 11,811 protein-coding genes. Of these, 10,620 were functional genes, 258 of which were identified as secretory proteins, including 211 predicted effectors. Additionally, the 111,581-bp mitogenome of LK93 was assembled and annotated. The LK93 genomes presented in this study will facilitate research in the B. sorokiniana-wheat pathosystem for better control of crop diseases. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Pratylenchus zeae a causative agent of Corn Root Rot in Jiangsu Province of China.

Corn (Zea mays L.) plays an important role in China's cash crops, not only as food, but a vital raw material for animal husbandry and industry (Li et al. 2022). Pratylenchus zeae is one of the most damaging root-lesion nematodes (RLN) that can result in decreased yield and quality of crops (Liu et al. 2017). In September 2020, five root/soil samples were collected from the rhizosphere of corn (cv. Zhengdan 958), which had weak growth and root brown lesions in Chenzhou Village, Taolin Town, Donghai County, Lianyungang City, Jiangsu Province of China. Nematodes were extracted from the collected samples using the modified Baermann funnel method (Hooper et al. 2005). RLN were found in all samples, an average of 46 RLN per gram of root and 138 RLN per 100 cm3 of soil. The obtained RLN females were sterilized with 0.3% streptomycin sulfate and then inoculated on each carrot disks individually to obtain the purified population. RLN were examined by morphological and molecular characteristics to confirm the species indentification. The main morphological measurements of adult (n = 15) included body length = 524.7 µm (mean) ± 15.1 (standard deviation) (range = 490.7 to 543.6 µm), stylet = 15.2 µm ± 0.8 (14.2 to 16.8 µm), tail length = 30.3 µm ± 2.5 (26.3 to 35.3 µm), a = 25.6 ± 1.3 (24.4 to 29.3), b = 5.3 ± 0.3 (4.7 to 5.8), c = 17.4 ± 1.4 (14.9 to 19.3), two annules on the lip region. No males were found in the specimens. The morphological characters of this population are consistent with the description of P. zeae (Castillo and Vovlas, 2007). Furthermore, DNA was extracted from individual nematodes. The primers of TW81/AB28 and D2A/D3B (Subbotin et al. 2006) were used to amplified the rDNA-ITS region and rDNA 28S D2-D3 region, respectively. The purified PCR products were ligated into One step ZTOPO-Blunt/TA vector and transformed to Escherichia coli strain DH5α, and then sequenced by Sunya Biotechnology Co., Ltd (Henan, China). The obtained seqences were submitted to NCBI. The rDNA-ITS sequences (669 bp, GenBank Accession No: OP456372 and OP466367) exhibited 95.0% to 97.1% of identity with P. zeae sequences (KU198980 and KU198975). The obtained D2-D3 region of the 28S rDNA sequences (782 bp, OP441397 and OP448675) exhibited 99.7% to 100% identity with P. zeae sequences (EU130893 and KY424269). Consequently, both morphological and molecular data confirmed the identity of P. zeae. To further confirm reproduction on corn, single corn seeds (cv. Zhengdan 958) were sown in eight 2-liter pots filled with 1.8-liter of sterilized soil in greenhouse at 28°C. About 15 days after sowing, each pot with one corn plant with the same growth status was selected to inoculate with 1,000 mixed stage nematodes of P. zeae , Eight pots of uninoculated corn plants were used as controls. After 60 days, the inoculated plants were harvested and brown lesions were observed on roots. No symptoms and nematodes was detected in the control. An average number of RLN per pot was 3,752 in soil and 1,183 in roots were extracted, the reproduction factor (final population/initial population) was 4.94, indicating that P. zeae infects and reproduces well on this corn cultivar. P. zeae has only been reported on corn in Guangxi Province, southern in China(Fang et al. 1994). To our knowledge, this is the fist report of P. zeae infecting corn in Jiangsu Province, eastern in China. As P. zeae can cause great damage to corn, necessary measures should be taken to prevent the spread of P. zeae to other areas.

The Great Game between Plants and Viruses: A Focus on Protein Homeostasis.

Plant viruses are tiny pathogenic obligate parasites that cause significant damage to global crop production. They exploit and manipulate the cellular components of host plants to ensure their own survival. In response, plants activate multiple defense signaling pathways, such as gene silencing and plant hormone signaling, to hinder virus propagation. Growing evidence suggests that the regulation of protein homeostasis plays a vital role in the ongoing battle between plants and viruses. The ubiquitin-proteasome-degradation system (UPS) and autophagy, as two major protein-degradation pathways, are widely utilized by plants and viruses in their arms race. One the one hand, these pathways act as essential components of plant's antiviral defense system by facilitating the degradation of viral proteins; on the other hand, viruses exploit the UPS and autophagy to create a favorable intracellular environment for viral infection. This review aims to provide a comprehensive summary of the events involved in protein homeostasis regulation during viral infection in plants. Gaining knowledge in this area will enhance our understanding of the complex interplay between plants and viruses.

A Putative Zn(II)2Cys6-Type Transcription Factor FpUme18 Is Required for Development, Conidiation, Cell Wall Integrity, Endocytosis and Full Virulence in Fusarium pseudograminearum.

Fusarium pseudograminearum is one of the major fungal pathogens that cause Fusarium crown rot (FCR) worldwide and can lead to a substantially reduced grain yield and quality. Transcription factors play an important role in regulating growth and pathogenicity in plant pathogens. In this study, we identified a putative Zn(II)2Cys6 fungal-type domain-containing transcription factor and named it FpUme18. The expression of FpUME18 was induced during the infection of wheat by F. pseudograminearum. The ΔFpume18 deletion mutant showed defects in growth, conidial production, and conidial germination. In the responses to the cell wall, salt and oxidative stresses, the ΔFpume18 mutant inhibited the rate of mycelial growth at a higher rate compared with the wild type. The staining of conidia and mycelia with lipophilic dye FM4-64 revealed a delay in endocytosis when FpUME18 was deleted. FpUME18 also positively regulated the expression of phospholipid-related synthesis genes. The deletion of FpUME18 attenuated the pathogenicity of wheat coleoptiles. FpUME18 also participated in the production of the DON toxin by regulating the expression of TRI genes. Collectively, FpUme18 is required for vegetative growth, conidiation, stress response, endocytosis, and full virulence in F. pseudograminearum.

Identification and characterization of a new geminivirus from soybean plants and determination of V2 as a pathogenicity factor and silencing suppressor.

BACKGROUND: Soybean is one of the four major crops in China. The occurrence of viruses in soybean causes significant economic losses. RESULTS: In this study, the soybean leaves from stay-green plants showing crinkle were collected for metatranscriptomic sequencing. A novel geminivirus, tentatively named soybean geminivirus A (SGVA), was identified in soybean stay-green plants. Sequence analysis of the full-length SGVA genome revealed a genome of 2762 nucleotides that contain six open reading frames. Phylogenetic analyses revealed that SGVA was located adjacent to the clade of begomoviruses in both the full genome-based and C1-based phylogenetic tree, while in the CP-based phylogenetic tree, SGVA was located adjacent to the clade of becurtoviruses. SGVA was proposed as a new recombinant geminivirus. Agroinfectious clone of SGVA was constructed. Typical systemic symptoms of curly leaves were observed at 11 dpi in Nicotiana benthamiana plants and severe dwarfism was observed after 3 weeks post inoculation. Expression of the SGVA encoded V2 and C1 proteins through a potato virus X (PVX) vector caused severe symptoms in N. benthamiana. The V2 protein inhibited local RNA silencing in co-infiltration assays in GFP transgenic 16C N. benthamiana plants. Further study revealed mild symptoms in N. benthamiana plants inoculated with SGVA-ZZ V2-STOP and SGVA-ZZ V2-3738AA mutants. Both the relative viral DNA and CP protein accumulation levels significantly decreased when compared with SGVA-inoculated plants. CONCLUSIONS: This work identified a new geminivirus in soybean stay-green plants and determined V2 as a pathogenicity factor and silencing suppressor.

Identification and analysis of the predictive urinary exosomal miR-195-5p in lupus nephritis based on renal miRNA-mRNA co-expression network.

OBJECTIVE: Lupus nephritis (LN) is the main complication of systemic lupus erythematosus (SLE), causing huge financial burden and poor quality of life. Due to the low compliance of renal biopsy, we aim to find a non-invasive biomarker of LN to optimize its predictive, preventive, and personalized medical service or management. METHOD: Herein, we provided a bioinformatic screen combined clinical validation strategy for rapidly mining exosomal miRNAs for LN diagnosis and management. We screened out differentially expressed miRNAs (DEMs) and differentially expressed mRNAs (DEGs) in LN database and performed a miRNA-mRNA integrated analysis to select out reliable changed miRNAs in LN tissues by using R and Cytoscape. Urinary exosomes were collected by ultracentrifugation and analyzed by nano-tracking analysis and western blotting. Detection of aquaporin-2 showed the tubular source of urinary exosomes. Urinary exosomal miRNAs were detected by RT-qPCR and the target of miR-195-5p was verified by using bioinformatic, dual-luciferase, and western blotting. RESULT: 15 miRNAs and their 60 target mRNAs were contained in miRNA-mRNA integrated map. Bioinformatic analysis showed these miRNAs were involved in various cellular biological process. Exosomal miR-195-5p, miR-25-3p, miR-429, and miR-218-5p were verified in a small clinical group (n = 47). Urinary exosomal miR-195-5p, miR-25-3p, and miR-429 were downregulated in patients and miR-195-5p could recognize LN patients from SLE with good sensitivity and specificity, showing good potential in LN disease monitoring and diagnosis. CONCLUSION: We analyzed and obtained a series of differential miRNAs in LN kidney tissues and suggested that urinary exosomal miR-195-5p could serve as a novel biomarker in LN. Further, miR-195-5p-CXCL10 axis could be a therapeutic target of LN.

Tau acetylates and stabilizes ß-catenin thereby promoting cell survival.

Overexpressing Tau counteracts apoptosis and increases dephosphorylated ß-catenin levels, but the underlying mechanisms are elusive. Here, we show that Tau can directly and robustly acetylate ß-catenin at K49 in a concentration-, time-, and pH-dependent manner. ß-catenin K49 acetylation inhibits its phosphorylation and its ubiquitination-associated proteolysis, thus increasing ß-catenin protein levels. K49 acetylation further promotes nuclear translocation and the transcriptional activity of ß-catenin, and increases the expression of survival-promoting genes (bcl2 and survivin), counteracting apoptosis. Mutation of Tau's acetyltransferase domain or co-expressing non-acetylatable ß-catenin-K49R prevents increased ß-catenin signaling and abolishes the anti-apoptotic function of Tau. Our data reveal that Tau preserves ß-catenin by acetylating K49, and upregulated ß-catenin/survival signaling in turn mediates the anti-apoptotic effect of Tau.

Transcriptome Analysis and Functional Validation Identify a Putative bZIP Transcription Factor, Fpkapc, that Regulates Development, Stress Responses, and Virulence in Fusarium pseudograminearum.

Fusarium pseudograminearum is a soilborne, hemibiotrophic phytopathogenic fungus that causes Fusarium crown rot and Fusarium head blight in wheat. The basic leucine zipper proteins (bZIPs) are evolutionarily conserved transcription factors that play crucial roles in a range of growth and developmental processes and the responses to biotic and abiotic stresses. However, the roles of bZIP transcription factors remains unknown in F. pseudograminearum. In this study, a bZIP transcription factor Fpkapc was identified to localize to the nucleus in F. pseudograminearum. A mutant strain (Δfpkapc) was constructed to determine the role of Fpkapc in growth and pathogenicity of F. pseudograminearum. Transcriptomic analyses revealed that many genes involved in basic metabolism and oxidation-reduction processes were downregulated, whereas many genes involved in metal iron binding were upregulated in the Δfpkapc strain, compared with the wild type (WT). Correspondingly, the mutant had severe growth defects and displayed abnormal hyphal tips. Conidiation in the Fpkapc mutant was reduced, with more conidia in smaller size and fewer septa than in the WT. Also, relative to WT, the Δfpkapc strain showed greater tolerance to ion stress, but decreased tolerance to H2O2. The mutant caused smaller disease lesions on wheat and barley plants, but significantly increased TRI gene expression, compared with the WT. In summary, Fpkapc plays multiple roles in governing growth, development, stress responses, and virulence in F. pseudograminearum.

A Megabirnavirus Alleviates the Pathogenicity of Fusarium pseudograminearum to Wheat.

Fusarium pseudograminearum is a phytopathogen that causes wheat crown rot disease worldwide. Fusarium pseudograminearum megabirnavirus 1 (FpgMBV1) was isolated from the hypovirulent strain FC136-2A of F. pseudograminearum as a novel double-stranded RNA mycovirus belonging to the family Megabirnaviridae. Here we examined the effects of FpgMBV1 on colony morphology and pathogenicity of F. pseudograminearum. Through hyphal tip culture, we obtained virus-free progeny of strain FC136-2A, referred to as FC136-2A-V-. FpgMBV1 was transferred horizontally to another virus-free strain, WZ-8A-HygR-V-. The progeny obtained through horizontal transfer was referred to as WZ-8A-HygR-V+. Colony morphology was similar between the FpgMBV1-positive and -negative strains. The ability to penetrate cellophane in vitro was lost, and pathogenicity on wheat plants was reduced significantly in the FpgMBV1-positive strains relative to the FpgMBV1-negative strains. Microscopic observations showed a 6-h delay in the formation of appressoria-like structures in FC136-2A relative to FC136-2A-V-. Mycelium extension was significantly longer in wheat coleoptiles infected by WZ-8A-HygR-V- than in that infected by WZ-8A-HygR-V+ at 12 and 20 h after inoculation (hai). In addition, expression of five genes that encode cell wall-degrading enzymes differed significantly between FpgMBV1-positive and -negative strains at 12 and 20 hai during early infection of wheat cells by conidia. This study provides evidence for the hypovirulence effect of FpgMBV1 on F. pseudograminearum and suggests that the underlying mechanism involves unsuccessful early infection and perhaps cell wall degradation.

Identification and Characterization of the Homeobox Gene Family in Fusarium pseudograminearum Reveal Their Roles in Pathogenicity.

Homeobox transcription factors have been implicated in filamentous growth, conidia formation and virulence in fungal pathogens. However, the presence of the homeobox gene family and their potential influence on pathogenesis in Fusarium pseudograminearum have not been investigated. F. pseudograminearum is an important plant pathogen that causes wheat and barley crown rot. In this study, we performed a genome-wide survey for F. pseudograminearum homeobox genes, and 11 FpHtfs were identified and characterized. Domain analyses revealed that all of these proteins contain a complete homeobox domain that contains three helices. Expression profiles of FpHtf genes at different pathogen stages showed that six FpHtf genes were induced during infection. Further, we generated and characterized FpHtf3 deletion mutants in F. pseudograminearum, showing it was essential for virulence. These results indicated that members of the homeobox gene family are likely involved in F. pseudograminearum pathogenicity. Our work also provides a useful foundation for further studies on the complexity and function of the homeobox gene family in F. pseudograminearum.

Occurrence of Root-Lesion Nematode Pratylenchus coffeae on Corn in Xinjiang Uygur Autonomous Region, China.

Pratylenchus coffeae Filipjev & Schuurmans Stekhoven, 1941, is one of the most important root-lesion nematodes (RLN) parasitizing many agronomic and industrial crops (Wang et al. 2021). Corn (Zea mays L.) is one economically important crop in China, with 35 million hectares cultivated annually (Li et al. 2019). In July 2019, a survey of RLN was carried out in corn field planting with cultivar Heyu 187 in Chuanba village in Qitai County, Xinjiang Uygur Autonomous Region, China. Five root/soil samples were collected from poor growing plants with distinct brown lesions. Nematodes were extracted from the collected root/soil samples with the modified Baermann funnel method (Hooper et al. 2005). The average of 157 RLN per 100 cm3 of soil and 43 RLN per gram of fresh root were extracted. The obtained RLN were sterilized with 0.3% streptomycin sulfate and cultured on carrot disks at 25°C. Twenty petri dishes with carrot disks, each inoculated with one female. The morphological and molecular characteristics of RLN cultured on carrot disks were examined for species identification. Morphological measurements of adult females (n=15) included body length (range = 529.0 to 658.0 µm, mean = 571.0 µm), head with two lip annuli, stylet (15.5 to 17.0 µm, 16.0 µm), tail length (27.5 to 32.5 µm, 30.5 µm), a (23.8 to 32.9, 28.5), b (5.8 to 7.1, 6.5), c (16.5 to 23.4, 18.9), and V (76.6 to 83.1%, 80.8%). Morphological measurements of adult males (n=15) were body length (range = 479.5 to 568.0 µm, mean = 516.0 µm), head with two lip annuli, stylet (14.5 to 15.5 µm, 15.0 µm), tail length (24.0 to 29.0 µm, 26.0 µm), spicule length (16.4 to 19.0 µm, 17.5 µm), gubernaculum length (4.4 to 5.3 µm, 4.9 µm), a (29.2 to 32.5, 31.0), b (5.7 to 6.9, 6.2), and c (18.2 to 22.6, 19.8). The morphological characters of this population are consistent with the description of P. coffeae (Castillo and Vovlas, 2007). Nematode DNA was extracted from an individual female. The primers of D2A/D3B (5'-ACAAGTACCGTGAGGGAAAGTTG-3'/5'-TCGGAAGGAACCAGCTACTA-3') (Subbotin et al. 2006) and 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3' / 5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) were used to amplify the D2/D3 expansion region of the 28S rRNA gene and the rDNA internal transcribed spacer (ITS) region, respectively. The PCR products were purified and transformed to E. coli strain DH5α, and then sequenced by Sangon Biotech Co. Ltd. (Shanghai, China). The obtained sequences of the D2/D3 region (793 bp) and the ITS region (1,242 bp) were submitted to GenBank, and the accession numbers for D2/D3 region were OK103614 and OK103619 which had 98.6% and 100% identity with the reported P. coffeae sequences (KC490925); the two obtained ITS sequences accession numbers OK103603 and OK103613) had more than 99% identity with published P. coffeae sequences from GenBank (e.g., LC030410, LC030395, MH134508 and LC030380). Hence, both morphological and molecular data demonstrated the presence of P. coffeae. To further confirm reproduction on corn, the obtained RLN population was used to inoculate corn plants in 2-liter pots containing 1.8-liter sterilized and mixed soil with 2 pastoral soil: 1 substrate in greenhouse at 27°C. About 15 days after sowing, each pot with one corn plant (cv. Heyu 187) with the same growth status was selected to inoculate P. coffeae. Five small holes near the roots were made using a glass rod. Approximately 1,000 mixed stage nematodes of P. coffeae were then pipetted into the holes of each plant. Eight replications were performed. Eight additional pots of uninoculated corn plants were used as control. After 2 months, corn roots were washed and brown lesions were observed on roots. The average number of RLN/pot was approximately 5,030 in soil and 2,870 in roots, and each pot had an average of 7.9 reproduction factors (final population/initial population), indicating that this nematode population infects and reproduces well on this corn cultivar. No nematodes and symptoms was detected in the control pot. The nematode of P. coffeae has only been reported on corn in Guangdong, Liaoning, Shangdong and Henan Provinces in China (Liu et al. 1996; Liu et al. 2001; Xia et al. 2021). To our knowledge, this is the first report of P. coffeae infecting corn in Xinjiang Uygur Autonomous Region of China. Since RLN can cause considerable damage to corn, one of the most important food crops produced in China, strategic measures should be taken to prevent the spread of P. coffeae to other regions.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Implications of Heparanase on Heparin Synthesis and Metabolism in Mast Cells.

Heparin is a polysaccharide expressed in animal connective tissue-type mast cells. Owing to the special pentasaccharide sequence, heparin specifically binds to antithrombin (AT) and increases the inhibitory activity of AT towards coagulation enzymes. Heparin isolated from porcine intestinal mucosa has an average molecular weight of 15 kDa, while heparins recovered from rat skin and the peritoneal cavity were 60-100 kDa and can be fragmented by the endo-glucuronidase heparanase in vitro. In this study, we have examined heparin isolated from in vitro matured fetal skin mast cells (FSMC) and peritoneal cavity mast cells (PCMC) collected from wildtype (WT), heparanase knockout (Hpa-KO), and heparanase overexpressing (Hpa-tg) mice. The metabolically 35S-labeled heparin products from the mast cells of WT, Hpa-KO, and Hpa-tg mice were compared and analyzed for molecular size and AT-binding activity. The results show that PCMC produced heparins with a size similar to heparin from porcine intestinal mast cells, whilst FSMC produced much longer chains. As expected, heparanase overexpression resulted in the generation of smaller fragments in both cell types, while heparins recovered from heparanase knockout cells were slightly longer than heparin from WT cells. Unexpectedly, we found that heparanase expression affected the production of total glycosaminoglycans (GAGs) and the proportion between heparin and other GAGs but essentially had no effect on heparin catabolism.

HIF-1α Causes LCMT1/PP2A Deficiency and Mediates Tau Hyperphosphorylation and Cognitive Dysfunction during Chronic Hypoxia.

Chronic hypoxia is a risk factor for Alzheimer's disease (AD), and the neurofibrillary tangle (NFT) formed by hyperphosphorylated tau is one of the two major pathological changes in AD. However, the effect of chronic hypoxia on tau phosphorylation and its mechanism remains unclear. In this study, we investigated the role of HIF-1α (the functional subunit of hypoxia-inducible factor 1) in tau pathology. It was found that in Sprague-Dawley (SD) rats, global hypoxia (10% O2, 6 h per day) for one month induced cognitive impairments. Meanwhile it induced HIF-1α increase, tau hyperphosphorylation, and protein phosphatase 2A (PP2A) deficiency with leucine carboxyl methyltransferase 1(LCMT1, increasing PP2A activity) decrease in the rats' hippocampus. The results were replicated by hypoxic treatment in primary hippocampal neurons and C6/tau cells (rat C6 glioma cells stably expressing human full-length tau441). Conversely, HIF-1α silencing impeded the changes induced by hypoxia, both in primary neurons and SD rats. The result of dual luciferase assay proved that HIF-1α acted as a transcription factor of LCMT1. Unexpectedly, HIF-1α decreased the protein level of LCMT1. Further study uncovered that both overexpression of HIF-1α and hypoxia treatment resulted in a sizable degradation of LCMT1 via the autophagy--lysosomal pathway. Together, our data strongly indicated that chronic hypoxia upregulates HIF-1α, which obviously accelerated LCMT1 degradation, thus counteracting its transcriptional expression. The increase in HIF-1α decreases PP2A activity, finally resulting in tau hyperphosphorylation and cognitive dysfunction. Lowering HIF-1α in chronic hypoxia conditions may be useful in AD prevention.

A rapid, simple, and highly efficient method for VIGS and in vitro-inoculation of plant virus by INABS applied to crops that develop axillary buds and can survive from cuttings.

BACKGROUND: Virus-induced gene silencing (VIGS) is one of the most convenient and powerful methods of reverse genetics. In vitro-inoculation of plant virus is an important method for studying the interactions between viruses and plants. Agrobacterium-based infiltration has been widely adopted as a tool for VIGS and in vitro-inoculation of plant virus. Most agrobacterium-based infiltration methods applied to VIGS and virus inoculation have the characteristics of low transformation efficiencies, long plant growth time, large amounts of plant tissue, large test spaces, and complex preparation procedures. Therefore, a rapid, simple, economical, and highly efficient VIGS and virus inoculation method is in need. Previous studies have shown that the selection of suitable plant tissues and inoculation sites is the key to successful infection. RESULTS: In this study, Tobacco rattle virus (TRV) mediated VIGS and Tomato yellow leaf curl virus (TYLCV) for virus inoculation were developed in tomato plants based on the agrobacterium tumefaciens-based infiltration by injection of the no-apical-bud stem section (INABS). The no-apical-bud stem section had a "Y- type" asymmetric structure and contained an axillary bud that was about 1-3 cm in length. This protocol provides high transformation (56.7%) and inoculation efficiency (68.3%), which generates VIGS transformants or diseased plants in a very short period (8 dpi). Moreover, it greatly reduces the required experimental space. This method will facilitate functional genomic studies and large-scale disease resistance screening. CONCLUSIONS: Overall, a rapid, simple, and highly efficient method for VIGS and virus inoculation by INABS was developed in tomato. It was reasonable to believe that it can be used as a reference for the other virus inoculation methods and for the application of VIGS to other crops (such as sweet potato, potato, cassava and tobacco) that develop axillary buds and can survive from cuttings.