RESUMO
SUMMARY: Recent technical advancements in single-cell chromatin accessibility sequencing (scCAS) have brought new insights to the characterization of epigenetic heterogeneity. As single-cell genomics experiments scale up to hundreds of thousands of cells, the demand for computational resources for downstream analysis grows intractably large and exceeds the capabilities of most researchers. Here, we propose EpiCarousel, a tailored Python package based on lazy loading, parallel processing, and community detection for memory- and time-efficient identification of metacells, i.e. the emergence of homogenous cells, in large-scale scCAS data. Through comprehensive experiments on five datasets of various protocols, sample sizes, dimensions, number of cell types, and degrees of cell-type imbalance, EpiCarousel outperformed baseline methods in systematic evaluation of memory usage, computational time, and multiple downstream analyses including cell type identification. Moreover, EpiCarousel executes preprocessing and downstream cell clustering on the atlas-level dataset with 707 043 cells and 1 154 611 peaks within 2 h consuming <75 GB of RAM and provides superior performance for characterizing cell heterogeneity than state-of-the-art methods. AVAILABILITY AND IMPLEMENTATION: The EpiCarousel software is well-documented and freely available at https://github.com/biox-nku/epicarousel. It can be seamlessly interoperated with extensive scCAS analysis toolkits.
Assuntos
Cromatina , Análise de Célula Única , Software , Cromatina/metabolismo , Análise de Célula Única/métodos , Humanos , Genômica/métodos , Biologia Computacional/métodosRESUMO
Aqueous Zn-metal batteries have attracted increasing interest for large-scale energy storage owing to their outstanding merits in terms of safety, cost and production. However, they constantly suffer from inadequate energy density and poor cycling stability due to the presence of zinc ions in the fully hydrated solvation state. Thus, designing the dehydrated solvation structure of zinc ions can effectively address the current drawbacks of aqueous Zn-metal batteries. In this case, considering the lack of studies focused on strategies for the dehydration of zinc ions, herein, we present a systematic and comprehensive review to deepen the understanding of zinc-ion solvation regulation. Two fundamental design principles of component regulation and pre-desolvation are summarized in terms of solvation environment formation and interfacial desolvation behavior. Subsequently, specific strategy based distinct principles are carefully discussed, including preparation methods, working mechanisms, analysis approaches and performance improvements. Finally, we present a general summary of the issues addressed using zinc-ion dehydration strategies, and four critical aspects to promote zinc-ion solvation regulation are presented as an outlook, involving updating (de)solvation theories, revealing interfacial evolution, enhancing analysis techniques and developing functional materials. We believe that this review will not only stimulate more creativity in optimizing aqueous electrolytes but also provide valuable insights into designing other battery systems.
RESUMO
Patients with symptomatic intracranial arterial stenosis (sICAS) suffer embarrassed hemodynamic status and acute ischemic stroke (AIS) recurrence. We aimed to assess the efficacy of remote ischemic conditioning (RIC) on improving this status by evaluating cerebral blood flow (CBF) and cerebral glucose metabolism (CGM) via PET/CT. Adult patients with unilateral sICAS in middle cerebral artery and/or intracranial segment of internal carotid artery-related AIS or transient ischemic attack within 6 months prior to randomization were enrolled. Individuals who received intravenous thrombolysis or endovascular treatment, or sICAS caused by cardiac embolism, small vessel occlusion, or other determined causes were excluded. Twenty-three eligible patients were randomly assigned to standard medical treatment (SMT) (n = 10) or RIC group (n = 13). The RIC protocol consisted of 5 cycles, each for 5-min bilateral upper limb ischemia and 5-min reperfusion period, twice a day, with a total duration of 3 months. Ten healthy volunteers were enrolled as healthy control group. We tested CBF and CGM at the rest stage and the methazolamide-induced stress stage. All patients received PET/CT at baseline and three-month followup. Both CBF and CGM in ipsilateral hemisphere of sICAS patients were significantly decreased at the rest stage and the stress stage (p < .05), which were improved by three-month RIC (p < .05). The lesions decreased notably in RIC group compared to SMT group (p < .05). RIC ameliorated the hemodynamic status and glucose metabolism in regions at high risk of infarction, which might improve the resistance capacity towards ischemic load in sICAS patients.
Assuntos
Arteriosclerose Intracraniana , AVC Isquêmico , Adulto , Humanos , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Arteriosclerose Intracraniana/diagnóstico por imagem , Arteriosclerose Intracraniana/terapia , Isquemia , Hemodinâmica , GlucoseRESUMO
BACKGROUND: Acute ischemic stroke (AIS) complicating an acute myocardial infarction (AMI) is not uncommon, but can severely worsen the clinical prognosis. This study aimed to investigate whether remote ischemic conditioning (RIC) could provide clinical benefits to patients with AIS complicating AMI. METHODS: Subjects with AIS complicating AMI were recruited in this double-blind, randomized, controlled trial; assigned to the RIC and sham groups; and respectively underwent twice daily RIC and sham RIC for 2 weeks. All subjects received standard medical therapy. The primary endpoint was the rate of major adverse cardiac and cerebrovascular events (MACCEs) within 3 months after enrollment. MACCEs comprise of death from all causes, unstable anginas, AMI, acute ischemic strokes, and transient ischemic attacks. RESULTS: Eighty subjects were randomly assigned; 37 patients in the RIC group and 40 patients in the sham-RIC group completed the 3-month follow-up and were included in the final analysis. Both RIC and sham RIC procedures were well tolerated. At 3-month follow-up, 11 subjects (29.7%) in the RIC group experienced MACCEs compared to 21 (52.5%) in the sham group (hazard ratio [HR], 0.396; 95% confidence interval, 0.187-0.838; adjusted p < 0.05). Six subjects (16.2%) in the RIC group had died at the 3-month follow up, significantly lower than the 15 (37.5%) deaths in the sham group (adjusted HR 0.333; 95% CI 0.126-0.881; p = 0.027). Seventeen subjects (45.9%) in the RIC group and 6 subjects (15.0%) in the sham group achieved functional independence (mRS score ≤ 2) at 3-month follow-up (adjusted OR 12.75; 95% CI 2.104-77.21; p = 0.006). CONCLUSIONS: Among patients with acute ischemic stroke complicating acute myocardial infarction, treatment with remote ischemic conditioning decreased the major adverse cardiac and cerebrovascular events and improved functional outcomes at 90 days. TRIAL REGISTRATION: URL: www. CLINICALTRIALS: gov . Unique identifier: NCT03868007. Registered 8 March 2019.
Assuntos
AVC Isquêmico , Infarto do Miocárdio , Acidente Vascular Cerebral , Humanos , Infarto do Miocárdio/complicações , Infarto do Miocárdio/terapia , Método Duplo-Cego , Resultado do Tratamento , Acidente Vascular Cerebral/complicações , Acidente Vascular Cerebral/terapiaRESUMO
Background: Abdominal aortic occlusion (AAO) occurs frequently and causes ischemia/reperfusion (I/R) injury to distant organs. In this study, we aimed to investigate whether AAO induced I/R injury and subsequent damage in cardiac and neurologic tissue. We also aimed to investigate the how length of ischemic time in AAO influences reactive oxygen species (ROS) production and inflammatory marker levels in the heart, brain, and serum. Methods: Sixty male C57BL/6 mice were used in this study. The mice were randomly divided into either sham group or AAO group. The AAO group was further subdivided into 1-4 hr groups of aortic occlusion times. The infrarenal abdominal aorta was clamped for 1-4 hr depending on the AAO group and was then reperfused for 24 hr after clamp removal. Serum, hippocampus, and left ventricle tissue samples were then subjected to biochemical and histopathological analyses. Results: AAO-induced I/R injury had no effect on cell necrosis, cell apoptosis, or ROS production. However, serum and hippocampus levels of malondialdehyde (MDA) and lactate dehydrogenase (LDH) increased in AAO groups when compared to sham group. Superoxide dismutase and total antioxidant capacity decreased in the serum, hippocampus, and left ventricle. In the serum, AAO increased the level of inducible nitric oxide synthase (iNOS) and decreased the levels of anti-inflammatory factors (such as arginase-1), transforming growth factor- ß1 (TGF-ß1), interleukin 4 (IL-4), and interleukin 10 (IL-10). In the hippocampus, AAO increased the levels of tumor necrosis factor (TNF-α), interleukin 1ß (IL-1ß), interleukin 6 (IL-6), IL-4, and IL-6, and decreased the level of TGF-ß1. In the left ventricle, AAO increased the level of iNOS and decreased the levels of TGF-ß1, IL-4, and IL-10. Conclusions: AAO did not induce cell necrosis or apoptosis in cardiac or neurologic tissue, but it can cause inflammation in the serum, brain, and heart.
Assuntos
Interleucina-10 , Traumatismo por Reperfusão , Camundongos , Masculino , Animais , Interleucina-4 , Interleucina-6/metabolismo , Espécies Reativas de Oxigênio , Fator de Crescimento Transformador beta1 , Camundongos Endogâmicos C57BL , Traumatismo por Reperfusão/patologia , Interleucina-1beta , Fator de Necrose Tumoral alfa , Encéfalo/metabolismo , NecroseRESUMO
In order to improve the energy conversion efficiency and power density of the tritium-powered betavoltaic battery, titanium was deposited on the inner surface of the deep porous three-dimensional structure semiconductor as a tritium absorption material. Therefore, magnetron sputtering technology was used to explore the parameters of titanium coating on the inner surface of a deep porous semiconductor. First, the effects of argon pressure and sputtering power on the properties of titanium films were studied. The properties of the titanium films were characterized by a scanning electron microscope and an atomic force microscope. The optimized sputtering parameters were obtained as follows: argon pressure of 0.5 Pa and sputtering power of 80 W. Based on this parameter, the background vacuum and coating angle were changed, and the titanium film was coated in the deep porous structure. Energy dispersive spectrometry line scan and surface scan were used to analyze the coating results, which showed that these two parameters directly affected the content of titanium in the channel, and the area of titanium in the channel structure accounted for more than 50% under each test condition.
RESUMO
As one of the most abundant natural polysaccharides that possess good biological activity, chitosan is extracted from chitin. Its application in the food field is being increasingly valued. However, chitosan extraction is difficult, and its poor solubility limits its application. At present, the extraction methods include the acid-base method, new chemical methods, and biological methods. The extraction rates of chitin/chitosan are 4-55%, 13-14%, and 15-28%, respectively. Different chemical modifications have different effects on chitosan, making it applicable in different fields. This article reviews and compares the extraction and chemical modification methods of chitosan, emphasizing the importance of green extraction methods. Finally, the application prospects of chitosan in the food industry are discussed. This will promote the understanding of the advantages and disadvantages of different extraction methods for chitosan as well as the relationship between modification and application, providing valuable insights for the future development of chitosan.
RESUMO
Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have reexamined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'AGACCATGTGGACCTGTCACTG3', and reverse, 5'GTTTGGAGTGGTAGAAATCTGTC3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'GAGGCAAAAGTCCTGTGTTCCAACT3', and reverse, 5'AAGAAATCCCTGTGGTTGCAGCAGCT3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of antiGAPDH antibodies was incorrectly stated as AbMart Biotech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 10331042, 2019; DOI: 10.3892/ijo.2019.4679].
RESUMO
The development of nanotechnology has brought about groundbreaking advancements in diseases' diagnostics and therapeutics. Among them, multifunctional nanomaterials with enzyme-like activities (i.e., nanozymes) featured with high stability, large surface area for bioconjugation, and easy storage, offer unprecedented opportunities for disease diagnostics and treatment. Recent years have witnessed the great progress of nanozyme-based theranostics. To highlight these achievements, this review first introduces the recent advancements on nanozymes in biosensing and diagnostics. Then, it summarizes the applications of nanozymes in therapeutics including anti-tumor and antibacterial treatment, anti-inflammatory treatment, and other diseases treatment. In addition, several targeted strategies to improve the therapeutic efficacy of nanozyme are discussed. Finally, the opportunities and challenges in the field of diagnosis and therapy are summarized.
RESUMO
Single-cell chromatin accessibility sequencing (scCAS) has emerged as a valuable tool for interrogating and elucidating epigenomic heterogeneity and gene regulation. However, scCAS data inherently suffers from limitations such as high sparsity and dimensionality, which pose significant challenges for downstream analyses. Although several methods are proposed to enhance scCAS data, there are still challenges and limitations that hinder the effectiveness of these methods. Here, we propose scCASE, a scCAS data enhancement method based on non-negative matrix factorization which incorporates an iteratively updating cell-to-cell similarity matrix. Through comprehensive experiments on multiple datasets, we demonstrate the advantages of scCASE over existing methods for scCAS data enhancement. The interpretable cell type-specific peaks identified by scCASE can provide valuable biological insights into cell subpopulations. Moreover, to leverage the large compendia of available omics data as a reference, we further expand scCASE to scCASER, which enables the incorporation of external reference data to improve enhancement performance.
Assuntos
Algoritmos , Cromatina , Cromatina/genética , Epigenômica/métodos , Regulação da Expressão Gênica , Análise de Célula ÚnicaRESUMO
In the field of stroke thrombectomy, ineffective clinical and angiographic reperfusion after successful recanalization has drawn attention. Partial or complete microcirculatory reperfusion failure after the achievement of full patency of a former obstructed large vessel, known as the "no-reflow phenomenon" or "microvascular obstruction," was first reported in the 1960s and was later detected in both experimental models and patients with stroke. The no-reflow phenomenon (NRP) was reported to result from intraluminal occlusions formed by blood components and extraluminal constriction exerted by the surrounding structures of the vessel wall. More recently, an emerging number of clinical studies have estimated the prevalence of the NRP in stroke patients following reperfusion therapy, ranging from 3.3% to 63% depending on its evaluation methods or study population. Studies also demonstrated its detrimental effects on infarction progress and neurological outcomes. In this review, we discuss the research advances, underlying pathogenesis, diagnostic techniques, and management approaches concerning the no-reflow phenomenon in the stroke population to provide a comprehensive understanding of this phenomenon and offer references for future investigations.
Assuntos
Fenômeno de não Refluxo , Acidente Vascular Cerebral , Humanos , Fenômeno de não Refluxo/diagnóstico por imagem , Fenômeno de não Refluxo/etiologia , Fenômeno de não Refluxo/terapia , Microcirculação , Acidente Vascular Cerebral/terapia , Acidente Vascular Cerebral/tratamento farmacológico , Trombectomia , Reperfusão , Resultado do TratamentoRESUMO
Perioperative neurocognitive disorders (PND) are cognitive dysfunctions that usually occur in elderly patients after anesthesia and surgery. Microglial overactivation is a key underlying mechanism. Interleukin-33 (IL-33) is a member of the IL-1 family that orchestrates microglial function. In the present study, we explored how IL-33, which regulates microglia, contributes to cognitive improvement in a male mouse model of PND. An exploratory laparotomy was performed to establish a PND model. The expression levels of IL-33 and its receptor ST2 were evaluated using Western blot. IL-33/ST2 secretion, microglial density, morphology, phagocytosis of synapse, and proliferation, and dystrophic microglia were assessed using immunofluorescence. Synaptic plasticity was measured using Golgi staining and long-term potentiation. The Morris water maze and open field test were used to evaluate cognitive function and anxiety. Hippocampal expression of IL-33 and ST2 were elevated on postoperative day 3. We confirmed that IL-33 was secreted by astrocytes and neurons, whereas ST2 mainly colocalized with microglia. IL-33 treatment induced microgliosis after anesthesia and surgery. These microglia had larger soma sizes and shorter and fragmented branches. Compared to the Surgery group, IL-33 treatment reduced the synaptic phagocytosis of microglia and increased microglial proliferation and dystrophic microglia. IL-33 treatment also reversed the impaired synaptic plasticity and cognitive function caused by anesthesia and surgery. In conclusion, these results indicate that IL-33 plays a key role in regulating microglial state and synaptic phagocytosis in a PND mouse model. IL-33 treatment has a therapeutic potential for improving cognitive dysfunction in PND.
Assuntos
Interleucina-33 , Camundongos Endogâmicos C57BL , Microglia , Animais , Microglia/efeitos dos fármacos , Microglia/metabolismo , Interleucina-33/metabolismo , Masculino , Camundongos , Plasticidade Neuronal/efeitos dos fármacos , Hipocampo/metabolismo , Hipocampo/efeitos dos fármacos , Hipocampo/patologia , Proteína 1 Semelhante a Receptor de Interleucina-1/metabolismo , Aprendizagem em Labirinto/efeitos dos fármacos , Aprendizagem em Labirinto/fisiologia , Complicações Cognitivas Pós-Operatórias/metabolismo , Fagocitose/efeitos dos fármacos , Astrócitos/metabolismo , Astrócitos/efeitos dos fármacos , Transtornos Neurocognitivos/metabolismo , Transtornos Neurocognitivos/tratamento farmacológico , Modelos Animais de Doenças , Neurônios/efeitos dos fármacos , Neurônios/metabolismoRESUMO
Recent advancements for simultaneously profiling multi-omics modalities within individual cells have enabled the interrogation of cellular heterogeneity and molecular hierarchy. However, technical limitations lead to highly noisy multi-modal data and substantial costs. Although computational methods have been proposed to translate single-cell data across modalities, broad applications of the methods still remain impeded by formidable challenges. Here, we propose scButterfly, a versatile single-cell cross-modality translation method based on dual-aligned variational autoencoders and data augmentation schemes. With comprehensive experiments on multiple datasets, we provide compelling evidence of scButterfly's superiority over baseline methods in preserving cellular heterogeneity while translating datasets of various contexts and in revealing cell type-specific biological insights. Besides, we demonstrate the extensive applications of scButterfly for integrative multi-omics analysis of single-modality data, data enhancement of poor-quality single-cell multi-omics, and automatic cell type annotation of scATAC-seq data. Moreover, scButterfly can be generalized to unpaired data training, perturbation-response analysis, and consecutive translation.
RESUMO
Stroke can lead to cardiac complications such as arrhythmia, myocardial injury, and cardiac dysfunction, collectively termed stroke-heart syndrome (SHS). These cardiac alterations typically peak within 72 h of stroke onset and can have long-term effects on cardiac function. Post-stroke cardiac complications seriously affect prognosis and are the second most frequent cause of death in patients with stroke. Although traditional vascular risk factors contribute to SHS, other potential mechanisms indirectly induced by stroke have also been recognized. Accumulating clinical and experimental evidence has emphasized the role of central autonomic network disorders and inflammation as key pathophysiological mechanisms of SHS. Therefore, an assessment of post-stroke cardiac dysautonomia is necessary. Currently, the development of treatment strategies for SHS is a vital but challenging task. Identifying potential key mediators and signaling pathways of SHS is essential for developing therapeutic targets. Therapies targeting pathophysiological mechanisms may be promising. Remote ischemic conditioning exerts protective effects through humoral, nerve, and immune-inflammatory regulatory mechanisms, potentially preventing the development of SHS. In the future, well-designed trials are required to verify its clinical efficacy. This comprehensive review provides valuable insights for future research.
Assuntos
Acidente Vascular Cerebral , Humanos , Acidente Vascular Cerebral/terapia , Acidente Vascular Cerebral/complicações , Acidente Vascular Cerebral/fisiopatologia , Cardiopatias/etiologia , Cardiopatias/fisiopatologia , Cardiopatias/terapia , SíndromeRESUMO
INTRODUCTION: Antithrombotic therapy prevents adverse ischemic events following acute ischemic stroke (AIS). Intravenous tirofiban provides desirable antiplatelet effects, especially in patients who are vulnerable to neurological deterioration (ND). AIM: The aim of the study was to test the hypothesis that intravenous administration of tirofiban, initiated within 24 h of ictus and continued for consecutive 72 h, would be more effective than aspirin in reducing the risk of ND within 72 h of enrollment among patients with potentially atherothrombotic ischemic stroke. METHODS: The Safety and Efficacy of Tirofiban in Preventing Neurological Deterioration in Acute Ischemic Stroke (TREND) trial is an investigator-initiated, multicenter, prospective, randomized, open-label, masked endpoint study. Its eligibility criteria included AIS secondary to potential atherosclerosis, a National Institutes of Health Stroke Scale (NIHSS) score ranging from 4 to 20 points, ineligibility for recanalization therapy, and administration within 24 h postsymptom onset. Randomization was performed at a 1:1 ratio to allocate 420 patients into two groups to receive an intravenous tirofiban bridge to oral antiplatelet drugs or direct oral antiplatelet drugs. OUTCOMES: The primary outcome is the proportion of patients with a ≥4-point increase in NIHSS score within 72 h of intervention compared to the score at enrollment. The key secondary outcomes include changes in NIHSS score, modified Rankin scale (mRS) score at 90 days, and dichotomized mRS scores (0-2 vs. 3-6 and 0-1 vs. 2-6) at 90 days. The safety variables are symptomatic intracerebral hemorrhage, any intracerebral hemorrhage, and systemic hemorrhage within 72 h after randomization and 90-day mortality. CONCLUSIONS: The TREND trial may identify the suitability of intravenous tirofiban as a routine clinical strategy to prevent ND in patients with AIS within 24 h of the onset of symptoms. TRIAL REGISTRATION: http://www.clinicaltrials.gov (identifier: NCT04491695).
RESUMO
Background: Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent malignant cancer worldwide. The cysteine X cysteine (CXC) chemokine family contains 17 members, which are reportedly crucial for the growth, invasion, metastasis, and microenvironment of tumor cells. Although the precise functions of CXC ligands (CXCLs) in HNSCC are unclear, these proteins may play important roles in controlling tumor growth and forming the tumor immune environment. Methods: We downloaded the RNA sequencing and matched clinicopathological data of 379 patients with HNSCC as the training set from The Cancer Genome Atlas and two datasets from the Gene Expression Omnibus for use as validation sets. Results: Through consensus clustering, we identified two subtypes of HNSCC associated with the CXCL family, named cluster1 and cluster2. Patients with the cluster1 subtype showed favourable clinical outcomes, significant immune cell infiltration, and improved immune response signalling pathway modulation. We also developed a nomogram of CXCL family scores for therapeutic use and for predicting the overall survival (OS) of patients with HNSCC. Patients with lower scores showed longer OS and higher immune cell infiltration in their tissues. Conclusions: We developed a new classification method for HNSCC using the CXCL gene family, which can be used clinically to evaluate the prognosis and response to immunotherapy in patients with HNSCC.
RESUMO
Our study aimed to construct a predictive model for identifying instances of futile recanalization in patients with anterior circulation occlusion acute ischemic stroke (AIS) who achieved complete reperfusion following endovascular therapy. We included 173 AIS patients who attained complete reperfusion, as indicated by a Modified Thrombolysis in Cerebral Infarction (mTICI) scale score of 3. Our approach involved a thorough analysis of clinical factors, imaging biomarkers, and potential no-reflow biomarkers through both univariate and multivariate analyses to identify predictors of futile recanalization. The comprehensive model includes clinical factors such as age, presence of diabetes, admission NIHSS score, and the number of stent retriever passes; imaging biomarkers like poor collaterals; and potential no-reflow biomarkers, notably disrupted blood-brain barrier (OR 4.321, 95% CI 1.794-10.405; p = 0.001), neutrophil-to-lymphocyte ratio (NLR; OR 1.095, 95% CI 1.009-1.188; p = 0.030), and D-dimer (OR 1.134, 95% CI 1.017-1.266; p = 0.024). The model demonstrated high predictive accuracy, with a C-index of 0.901 (95% CI 0.855-0.947) and 0.911 (95% CI 0.863-0.954) in the original and bootstrapping validation samples, respectively. Notably, the comprehensive model showed significantly improved predictive performance over models that did not include no-reflow biomarkers, evidenced by an integrated discrimination improvement of 8.86% (95% CI 4.34%-13.39%; p < 0.001) and a categorized reclassification improvement of 18.38% (95% CI 3.53%-33.23%; p = 0.015). This model, which leverages the potential of no-reflow biomarkers, could be especially beneficial in healthcare settings with limited resources. It provides a valuable tool for predicting futile recanalization, thereby informing clinical decision-making. Future research could explore further refinements to this model and its application in diverse clinical settings.
RESUMO
Caries is a destructive condition caused by bacterial infection that affects the hard tissues of the teeth, significantly reducing the quality of life for individuals. Photothermal therapy (PTT) offers a noninvasive and painless treatment for caries, but the use of unsafe laser irradiance limits its application. To address this challenge, we prepared nanoparticles of silver ion-doped Prussian blue (AgPB), which was encased within cationic guar gum (CG) to form the antibacterial PTT hydrogel CG-AgPB with a photothermal conversion efficiency of 34.4%. When exposed to an 808 nm laser at a power density of 0.4 W/cm2, the hydrogel readily reached a temperature of over 50 °C in just 3 min, synchronized by the discharge of Ag+ ions from the interstitial sites of AgPB crystals, resulting in broad-spectrum and synergistic antibacterial activities (>99%) against individual oral pathogens (Streptococcus sanguinis, Streptococcus mutans, and Streptococcus sobrinus) and pathogen-induced biofilms. In vivo, CG-AgPB-mediated PTT demonstrated a capability to profoundly reduce the terminal number of cariogenic bacteria to below 1% in a rat model of caries. Given the outstanding biocompatibility, injectability, and flushability, this CG-AgPB hydrogel may hold promise as a next-generation oral hygiene adjunct for caries management in a clinical setting.
Assuntos
Antibacterianos , Cárie Dentária , Ferrocianetos , Hidrogéis , Prata , Prata/química , Prata/farmacologia , Antibacterianos/química , Antibacterianos/farmacologia , Hidrogéis/química , Hidrogéis/farmacologia , Cárie Dentária/terapia , Cárie Dentária/tratamento farmacológico , Cárie Dentária/microbiologia , Animais , Ratos , Ferrocianetos/química , Ferrocianetos/farmacologia , Terapia Fototérmica , Biofilmes/efeitos dos fármacos , Streptococcus mutans/efeitos dos fármacos , Testes de Sensibilidade Microbiana , Humanos , Ratos Sprague-DawleyRESUMO
Breast cancer, due to resistance to standard therapies such as endocrine therapy, anti-HER2 therapy and chemotherapy, continues to pose a major health challenge. A growing body of research emphasizes the heterogeneity and plasticity of metabolism in breast cancer. Because differences in subtypes exhibit a bias toward metabolic pathways, targeting mitochondrial inhibitors shows great potential as stand-alone or adjuvant cancer therapies. Multiple therapeutic candidates are currently in various stages of preclinical studies and clinical openings. However, specific inhibitors have been shown to face multiple challenges (e.g., single metabolic therapies, mitochondrial structure and enzymes, etc.), and combining with standard therapies or targeting multiple metabolic pathways may be necessary. In this paper, we review the critical role of mitochondrial metabolic functions, including oxidative phosphorylation (OXPHOS), the tricarboxylic acid cycle, and fatty acid and amino acid metabolism, in metabolic reprogramming of breast cancer cells. In addition, we outline the impact of mitochondrial dysfunction on metabolic pathways in different subtypes of breast cancer and mitochondrial inhibitors targeting different metabolic pathways, aiming to provide additional ideas for the development of mitochondrial inhibitors and to improve the efficacy of existing therapies for breast cancer.
RESUMO
The accumulation of amyloid-ß (Aß) peptides is a major hallmark of Alzheimer's disease (AD) and plays a crucial role in its pathogenesis. Particularly, the structured oligomeric species rich in ß-sheet formations were implicated in neuronal organelle damage. Addressing this formidable challenge requires identifying candidates capable of inhibiting peptide aggregation or disaggregating preformed oligomers for effective antiaggregation-based AD therapy. Here, we present a dual-functional nanoinhibitor meticulously designed to target the aggregation driving force and amyloid fibril spatial structure. Leveraging the exceptional structural stability and facile tailoring capability of endohedral metallofullerene Gd@C82, we introduce desired hydrogen-binding sites and charged groups, which are abundant on its surface for specific designs. Impressively, these designs endow the resultant functionalized-Gd@C82 nanoparticles (f-Gd@C82 NPs) with high capability of redirecting peptide self-assembly toward disordered, off-pathway species, obstructing the early growth of protofibrils, and disaggregating the preformed well-ordered protofibrils or even mature Aß fibrils. This results in considerable alleviation of Aß peptide-induced neuronal cytotoxicity, rescuing neuronal death and synaptic loss in primary neuron models. Notably, these modifications significantly improved the dispersibility of f-Gd@C82 NPs, thus substantially enhancing its bioavailability. Moreover, f-Gd@C82 NPs demonstrate excellent cytocompatibility with various cell lines and possess the ability to penetrate the blood-brain barrier in mice. Large-scale molecular dynamics simulations illuminate the inhibition and disaggregation mechanisms. Our design successfully overcomes the limitations of other nanocandidates, which often overly rely on hydrophobic interactions or photothermal conversion properties, and offers a viable direction for developing anti-AD agents through the inhibition and even reversal of Aß aggregation.