First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Alterations of voxel-wise spontaneous activity and corresponding brain functional networks in multiple system atrophy patients with mild cognitive impairment.

Emerging evidence has indicated that cognitive impairment is an underrecognized feature of multiple system atrophy (MSA). Mild cognitive impairment (MCI) is related to a high risk of dementia. However, the mechanism underlying MCI in MSA remains controversial. In this study, we conducted the amplitude of low-frequency fluctuation (ALFF) and seed-based functional connectivity (FC) analyses to detect the characteristics of local neural activity and corresponding network alterations in MSA patients with MCI (MSA-MCI). We enrolled 80 probable MSA patients classified as cognitively normal (MSA-NC, n = 36) and MSA-MCI (n = 44) and 40 healthy controls. Compared with MSA-NC, MSA-MCI exhibited decreased ALFF in the right dorsal lateral prefrontal cortex (RDLPFC) and increased ALFF in the right cerebellar lobule IX and lobule IV-V. In the secondary FC analyses, decreased FC in the left inferior parietal lobe (IPL) was observed when we set the RDLPFC as the seed region. Decreased FC in the bilateral cuneus, left precuneus, and left IPL and increased FC in the right middle temporal gyrus were shown when we set the right cerebellar lobule IX as the seed region. Furthermore, FC of DLPFC-IPL and cerebello-cerebral circuit, as well as ALFF alterations, were significantly correlated with Montreal Cognitive Assessment scores in MSA patients. We also employed whole-brain voxel-based morphometry analysis, but no gray matter atrophy was detected between the patient subgroups. Our findings indicate that altered spontaneous activity in the DLPFC and the cerebellum and disrupted DLPFC-IPL, cerebello-cerebral networks are possible biomarkers of early cognitive decline in MSA patients.

Detection of mild cognitive impairment in Parkinson's disease using gradient boosting decision tree models based on multilevel DTI indices.

BACKGROUND: Cognitive dysfunction is the most common non-motor symptom in Parkinson's disease (PD), and timely detection of a slight cognitive decline is crucial for early treatment and prevention of dementia. This study aimed to build a machine learning model based on intra- and/or intervoxel metrics extracted from diffusion tensor imaging (DTI) to automatically classify PD patients without dementia into mild cognitive impairment (PD-MCI) and normal cognition (PD-NC) groups. METHODS: We enrolled PD patients without dementia (52 PD-NC and 68 PD-MCI subtypes) who were assigned to the training and test datasets in an 8:2 ratio. Four intravoxel metrics, including fractional anisotropy (FA), mean diffusivity (MD), axial diffusivity (AD), and radial diffusivity (RD), and two novel intervoxel metrics, local diffusion homogeneity (LDH) using Spearman's rank correlation coefficient (LDHs) and Kendall's coefficient concordance (LDHk), were extracted from the DTI data. Decision tree, random forest, and eXtreme gradient boosting (XGBoost) models based on individual and combined indices were built for classification, and model performance was assessed and compared via the area under the receiver operating characteristic curve (AUC). Finally, feature importance was evaluated using SHapley Additive exPlanation (SHAP) values. RESULTS: The XGBoost model based on a combination of the intra- and intervoxel indices achieved the best classification performance, with an accuracy of 91.67%, sensitivity of 92.86%, and AUC of 0.94 in the test dataset. SHAP analysis showed that the LDH of the brainstem and MD of the right cingulum (hippocampus) were important features. CONCLUSIONS: More comprehensive information on white matter changes can be obtained by combining intra- and intervoxel DTI indices, improving classification accuracy. Furthermore, machine learning methods based on DTI indices can be used as alternatives for the automatic identification of PD-MCI at the individual level.

Contributions of bone marrow monocytes/macrophages in myeloproliferative neoplasms with JAK2V617F mutation.

The classic BCR-ABL1-negative myeloproliferative neoplasm (MPN) is a highly heterogeneous hematologic tumor that includes three subtypes, namely polycythemia vera (PV), essential thrombocytosis (ET), and primary myelofibrosis (PMF). Despite having the same JAK2V617F mutation, the clinical manifestations of these three subtypes of MPN differ significantly, which suggests that the bone marrow (BM) immune microenvironment may also play an important role. In recent years, several studies have shown that peripheral blood monocytes play an important role in promoting MPN. However, to date, the role of BM monocytes/macrophages in MPN and their transcriptomic alterations remain incompletely understood. The purpose of this study was to clarify the role of BM monocytes/macrophages in MPN patients with the JAK2V617F mutation. MPN patients with the JAK2V617F mutation were enrolled in this study. We investigated the roles of monocytes/macrophages in the BM of MPN patients, using flow cytometry, monocyte/macrophage enrichment sorting, cytospins and Giemsa-Wright staining, and RNA-seq. Pearson correlation coefficient analysis was also used to detect the correlation between BM monocytes/macrophages and the MPN phenotype. In the present study, the proportion of CD163+ monocytes/macrophages increased significantly in all three subtypes of MPN. Interestingly, the percentages of CD163+ monocytes/macrophages are positively correlated with HGB in PV patients and PLT in ET patients. In contrast, the percentages of CD163+ monocytes/macrophages are negatively correlated with HGB and PLT in PMF patients. It was also found that CD14+CD16+ monocytes/macrophages increased and correlated with MPN clinical phenotypes. RNA-seq analyses demonstrated that the transcriptional expressions of monocytes/macrophages in MPN patients are relatively distinct. Gene expression profiles of BM monocytes/macrophages suggest a specialized function in support of megakaryopoiesis in ET patients. In contrast, BM monocytes/macrophages yielded a heterogeneous status in the support or inhibition of erythropoiesis. Significantly, BM monocytes/macrophages shaped an inflammatory microenvironment, which, in turn, promotes myelofibrosis. Thus, we characterized the roles of increased monocytes/macrophages in the occurrence and progression of MPNs. Our findings of the comprehensive transcriptomic characterization of BM monocytes/macrophages provide important resources to serve as a basis for future studies and future targets for the treatment of MPN patients.

First Record of Meloidogyne incognita on Maize (Zea mays) in Shaanxi Province of China.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

Analysis of Mean Corpuscular Volume and Red Cell Distribution Width in Patients with Aplastic Anemia.

To explore the characteristics of hemogram in patients with aplastic anemia (AA), especially mean corpuscular volume (MCV) and red cell distribution width (RDW). We examined the blood routine of 180 new-onset AA patients and used 166 patients with myelodysplastic syndrome (MDS) as controls. Among the 180 AA patients, 105 (58.3%) were diagnosed with severe AA (SAA), while 75 (41.7%) were diagnosed with non-severe AA (NSAA). Compared to MDS, patients with SAA generally had unfavorable hemogram, including significantly lower white blood cell (WBC), absolute neutrophil count (ANC), hemoglobin (Hb), platelet (PLT) and reticulocyte counts (RET). However, WBC, ANC and lymphocyte counts were higher in the NSAA group than in the MDS group; Hb and Ret were comparable between the two groups. 8.5% of SAA patients and 58.1% of NSAA patients presented with macrocytic anemia, whereas 25.7% of SAA and 64.0% of NSAA had a high RDW. In the MDS group, 54.7% of patients presented with macrocytic anemia, and 84.7% had increased RDW. WBC, ANC, PLT, and Ret in a high-RDW group (25.7% of SAA) were significantly higher than in a normal-RDW group (74.3% of SAA). Overall, most SAA patients exhibited normocytic-normochromic anemia, and their hemograms decreased more significantly; more than half of NSAA patients showed macrocytic-heterogeneous anemia, and their hemograms were similar to those of MDS. Patients with elevated RDW may have better residual bone marrow hematopoietic function than those with normal RDW but with more severe anemia.

The effect of different ferrule heights and crown-to-root ratios on fracture resistance of endodontically-treated mandibular premolars restored with fiber post or cast metal post system: an in vitro study.

BACKGROUND: This study aimed to investigate the effects of different ferrule heights and crown-to-root ratios on the fracture resistance of endodontically-treated premolars restored with fiber post or cast metal post system. METHODS: Eighty extracted human mandibular first premolars with single root canal were treated endodontically and cut from 2.0 mm above the buccal cemento-enamel junction, to create horizontal residual roots. The roots were randomly divided into two groups. The roots in group FP were restored with a fiber post-and-core system, while the roots in group MP were restored with a cast metal post-and-core system. Each group was divided into five subgroups with different ferrule heights (0: no ferrule; 1: 1.0 mm ferrule; 2: 2.0 mm ferrule; 3: 3.0 mm ferrule; 4: 4.0 mm ferrule). All specimens were subsequently restored with metal crowns and embedded in acrylic resin blocks. The crown-to-root ratios of the specimens were controlled at approximately 0.6, 0.8, 0.9, 1.1, and 1.3 of the five subgroups, respectively. Fracture strengths and fracture patterns of the specimens were tested and recorded by a universal mechanical machine. RESULTS: Mean fracture strengths (mean ± standard deviation (kN)) of FP/0 to FP/4 and MP/0 to MP/4 were: 0.54 ± 0.09, 1.03 ± 0.11, 1.06 ± 0.17, 0.85 ± 0.11; 0.57 ± 0.10, 0.55 ± 0.09, 0.88 ± 0.13, 1.08 ± 0.17, 1.05 ± 0.18 and 0.49 ± 0.09, respectively. Two-way ANOVA revealed significant effects of different ferrule heights and crown-to-root ratios on the fracture resistance (P < 0.001), but no difference in fracture resistance between two post-and-core systems (P = 0.973). The highest fracture strengths of the specimen were found with the ferrule length of 1.92 mm in group FP and 2.07 mm in group MP, the crown-to-root ratio of which in 0.90 and 0.92 respectively., there is a significant difference in fracture patterns among the groups(P < 0.05). CONCLUSIONS: When a certain height of ferrule is prepared and a cast metal or fiber post-and-core system is restored for the residual root, the clinical crown-to-root ratio of the tooth after restoration should be kept within 0.90 to 0.92, so as to improve the fracture resistance of endodontically-treated mandibular first premolars.

GM-CSF impairs erythropoiesis by disrupting erythroblastic island formation via macrophages.

Anemia is a significant complication of chronic inflammation and may be related to dysregulated activities among erythroblastic island (EBI) macrophages. GM-CSF was reported to be upregulated and attracted as a therapeutic target in many inflammatory diseases. Among EBIs, we found that the GM-CSF receptor is preferentially and highly expressed among EBI macrophages but not among erythroblasts. GM-CSF treatment significantly decreases human EBI formation in vitro by decreasing the adhesion molecule expression of CD163. RNA-sequence analysis suggests that GM-CSF treatment impairs the supporting function of human EBI macrophages during erythropoiesis. GM-CSF treatment also polarizes human EBI macrophages from M2-like type to M1-like type. In addition, GM-CSF decreases mouse bone marrow (BM) erythroblasts as well as EBI macrophages, leading to a reduction in EBI numbers. In defining the molecular mechanism at work, we found that GM-CSF treatment significantly decreases the adhesion molecule expression of CD163 and Vcam1 in vivo. Importantly, GM-CSF treatment also decreases the phagocytosis rate of EBI macrophages in mouse BM as well as decreases the expression of the engulfment-related molecules Mertk, Axl, and Timd4. In addition, GM-CSF treatment polarizes mouse BM EBI macrophages from M2-like type to M1-like type. Thus, we document that GM-CSF impairs EBI formation in mice and humans. Our findings support that targeting GM-CSF or reprogramming EBI macrophages might be a novel strategy to treat anemia resulting from inflammatory diseases.

Evidence of pyroptosis and ferroptosis extensively involved in autoimmune diseases at the single-cell transcriptome level.

BACKGROUND: Approximately 8-9% of the world's population is affected by autoimmune diseases, and yet the mechanism of autoimmunity trigger is largely understudied. Two unique cell death modalities, ferroptosis and pyroptosis, provide a new perspective on the mechanisms leading to autoimmune diseases, and development of new treatment strategies. METHODS: Using scRNA-seq datasets, the aberrant trend of ferroptosis and pyroptosis-related genes were analyzed in several representative autoimmune diseases (psoriasis, atopic dermatitis, vitiligo, multiple sclerosis, systemic sclerosis-associated interstitial lung disease, Crohn's disease, and experimental autoimmune orchitis). Cell line models were also assessed using bulk RNA-seq and qPCR. RESULTS: A substantial difference was observed between normal and autoimmune disease samples involving ferroptosis and pyroptosis. In the present study, ferroptosis and pyroptosis showed an imbalance in different keratinocyte lineages of psoriatic skinin addition to a unique pyroptosis-sensitive keratinocyte subset in atopic dermatitis (AD) skin. The results also revealed that pyroptosis and ferroptosis are involved in epidermal melanocyte destruction in vitiligo. Aberrant ferroptosis has been detected in multiple sclerosis, systemic sclerosis-associated interstitial lung disease, Crohn's disease, and autoimmune orchitis. Cell line models adopted in the study also identified pro-inflammatory factors that can drive changes in ferroptosis and pyroptosis. CONCLUSION: These results provide a unique perspective on the involvement of ferroptosis and pyroptosis in the pathological process of autoimmune diseases at the scRNA-seq level. IFN-γ is a critical inducer of pyroptosis sensitivity, and has been identified in two cell line models.

Iron chelation of hetrombopag in aplastic anemia: a post hoc analysis of a phase II study.

Hetrombopag is the only CFDA-approved thrombopoietin (TPO) receptor agonist for severe aplastic anemia (SAA) in China. Its chemical structure has an iron chelation domain. To explore the iron chelation effect of hetrombopag, we performed a post hoc analysis of the phase II clinical trial (NCT03557099). Thirty-five immunosuppressive therapy (IST)-refractory SAA patients were enrolled in the study, and the longitudinal changes of serum ferritin (SF) were assessed. At 18 weeks post-hetrombopag initiation, 51.4% of patients showed decreased SF levels by a median of 49.0 (18.1-95.5) % from baseline (median ΔSF decrease value, 917.2 ng/ml, range from 104.0 to 7030.0 ng/ml). A decrease in SF was found in 75.0% of hematologic responders and 31.6% of non-responders. Among the 24 patients with iron overload, 12 had decreased SF levels by up to 51% of the baseline. Patients with normal SF levels also showed decreased SF levels, and iron deficiency occurred in two patients. In conclusion, hetrombopag showed a powerful and rapid iron chelation effect.

Risk of colon cancer-related death in people who had cancer in the past.

BACKGROUND: The rate of second primary malignancies (SPM) is gradually increasing. Yet, the risk of death from primary cancer vs. SPM is still not well understood. In this study, we investigated the survival of patients with colorectal cancer (as SPM) who had cancer in the past (prior cancer) and the risk factors of SPM death in this population. MATERIALS AND METHODS: Based on the Surveillance, Epidemiology, and End Results (SEER) database, we identified 1866 colon cancer patients with prior cancer in our main cohort and 43,959 colon cancer patients, including 37,440 patients with colon cancer as only malignancy and 6519 patients with colon cancer as subsequent colon cancer (SCC), in a second cohort and 3429 colon cancer patients, including 2371 patients with prior colon cancer (PCC) and 1058 patients with colon cancer as SPM, in a third cohort. After propensity score matching, 6519 pairs of subjects were identified in second cohort. RESULTS: Patients with prior prostate and breast cancer had a higher risk of developing colon cancer compared to those with gastrointestinal cancer. Also, colon cancer patients with different prior cancer had different survival rates. Furthermore, except for prior lung cancer (52.78 vs. 25.93%), most subjects died due to colon cancer complications. The ratio of colon cancer deaths to prior cancer deaths in patients with a low stage and high stage was 1.51 and 6.64, respectively. In addition, colon cancer-specific survival (CSS) and OS rates were significantly lower in subjects with colon cancer as the SPM than in those with PCC. Also, compared with PCC, SPM was associated with OS and CSS with HR 1.59 (95 CI 1.43-1.78) and HR 2.00 (95% CI 1.70-2.36). Furthermore, compared with only colon cancer, SCC was associated with OS and CSS with HR 1.23 (95 CI 1.17-1.29) and HR 1.13 (95% CI 1.06-1.21). CONCLUSIONS: Prior cancer was found to have an adverse impact on OS in patients with colon cancer (secondary cancer), most of whom died due to colon cancer as secondary cancer itself rather than prior cancer. Early detection and treatment strategies should be investigated in this population.

Effect of Er:YAG laser irrigation with different etching modes on the push-out bond strength of fiber posts to the root dentine.

The objective of this study was to evaluate the effect of Er:YAG laser irrigation on the push-out bond strength of fiber posts to the root dentine. Sixty extracted human mandibular first premolars were collected and decoronated. The residual roots received endodontic treatment. The treated roots were randomly divided into three groups according to different irrigation protocols: group LAI (Er:YAG laser-activated irrigation), group PUI (passive ultrasonic irrigation, positive control), and group CSI (conventional syringe irrigation, negative control) (n = 20). Each group was divided into two subgroups, either total-etching modes or self-etching modes (n = 10). After fiber post restoration, all roots were sectioned into seven 1.0-mm-thick slices. The slices received a push-out test by a universal test machine. The resin tag on the segments' bonding interfaces was observed by scanning electron microscope. There were significant differences in the effects of the irrigation method, bonding modes, and root regions on the push-out bond strength among the groups (p < 0.05). The specimens with Er:YAG laser-activated irrigation and self-etching mode showed significantly the highest bonding strength (p < 0.001). The lengths and densities of resin tags in group PUI or group LAI with self-etching modes were longer than those in group CSI with total-etching modes. The laser-activated irrigation with self-etching modes improved the bond strength of fiber post to root dentine compared to the passive ultrasonic irrigation or conventional syringe irrigation with total or self-etching modes.

First Report of Southern Root-Knot Nematode (Meloidogyne incognita) on Gynostemma pentaphyllum in China.

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

Overexpression of MxbHLH18 Increased Iron and High Salinity Stress Tolerance in Arabidopsis thaliana.

In the life cycle of apple, it will suffer a variety of abiotic stresses, such as iron stress and salt stress. bHLH transcription factors (TFs) play an indispensable role in the response of plants to stress. In this study, a new bHLH gene named MxbHLH18 was separated from Malus xiaojinensis. According to the results of subcellular localization, MxbHLH18 was localized in the nucleus. Salt stress and iron stress affected the expression of MxbHLH18 in Malus xiaojinensis seedlings to a large extent. Due to the introduction of MxbHLH18, the resistance of Arabidopsis thaliana to salt, high iron and low iron was significantly enhanced. Under the environmental conditions of high iron and low iron, the overexpression of MxbHLH18 increased many physiological indexes of transgenic Arabidopsis compared to wild type (WT), such as root length, fresh weight and iron content. The high level expression of MxbHLH18 in transformed Arabidopsis thaliana can not only increased the content of chlorophyll and proline, as well as increasing the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT); it also reduced the content of malondialdehyde (MDA), which was more obvious under high salt conditions. In addition, the relative conductivity, H2O2 content and O2- content in transgenic Arabidopsis decreased under salt stress. Meanwhile, MxbHLH18 can also regulate the expression of downstream genes associated with salt stress (AtCBF1/2/3, AtKIN1 and AtCOR15a/b) and iron stress (AtIRT1, AtFRO2, AtNAS2, ATACT2, AtZIF1 and AtOPT3). Therefore, MxbHLH18 can actively promote the adaptability of plants to the growth environment of salt and low and/or iron.

Overexpression of a Malus baccata MYB Transcription Factor Gene MbMYB4 Increases Cold and Drought Tolerance in Arabidopsis thaliana.

In the natural environment, plants often face unfavorable factors such as drought, cold, and freezing, which affect their growth and yield. The MYB (v-myb avian myeloblastosis viral oncogene homolog) transcription factor family is widely involved in plant responses to biotic and abiotic stresses. In this study, Malus baccata (L.) Borkh was used as the research material, and a gene MbMYB4 of the MYB family was cloned from it. The open reading frame (ORF) of MbMYB4 was found to be 762 bp, encoding 253 amino acids; sequence alignment results and predictions of the protein structure indicated that the MbMYB4 protein contained the conserved MYB domain. Subcellular localization showed that MbMYB4 was localized in the nucleus. In addition, the use of quantitative real-time PCR (qPCR) technology found that the expression of MbMYB4 was enriched in the young leaf and root, and it was highly affected by cold and drought treatments in M. baccata seedlings. When MbMYB4 was introduced into Arabidopsis thaliana, it greatly increased the cold and drought tolerance in the transgenic plant. Under cold and drought stresses, the proline and chlorophyll content, and peroxidase (POD) and catalase (CAT) activities of transgenic A. thaliana increased significantly, and the content of malondialdehyde (MDA) and the relative conductivity decreased significantly, indicating that the plasma membrane damage of transgenic A. thaliana was lesser. Therefore, the overexpression of the MbMYB4 gene in A. thaliana can enhance the tolerance of transgenic plants to cold and drought stresses.