Clinical effect of early enteral nutrition support on critically ill neonates with extracorporeal membrane oxygenation.

OBJECTIVE: To investigate the feasibility and clinical outcomes of early enteral nutrition (EN) in critically ill neonates supported by extracorporeal membrane oxygenation (ECMO). METHODS: We retrospectively analyzed the clinical data of 16 critically ill neonates who received ECMO support for respiratory and circulatory failure from July 2021 to December 2022 at our center. The patients were divided into two groups: the early EN group (< 24 h) and the late EN group (> 24 h). The related clinical and nutrition-related indicators between the groups were compared. RESULTS: There was a significant difference in the time from ECMO treatment to the start of EN between the early EN group (9 patients, 56.2%) and the late EN group (7 patients, 43.8%) (P < 0.05). However, there were no significant differences in ECMO duration, hospitalization time, vasoactive-inotropic score (VIS), intestinal oxygen saturation, or routine stool occult blood (OB) test between the two groups (all P > 0.05). The incidence of complications such as intestinal obstruction, abdominal distension, diarrhea, and necrotizing enterocolitis (NEC) was slightly lower in the early EN group, but the differences were not statistically significant (all P > 0.05). The early EN group had a shorter time [3.6 (3.5, 5) vs. 7.5 (5.9, 8.5) d] to reach full gastrointestinal nutrition compared to the late EN group (P < 0.05). CONCLUSION: Providing early nutritional support through enteral feeding to critically ill neonates receiving ECMO treatment is both safe and practical, but close monitoring of clinical and nutritional indicators is essential.

Identification and validation of a fatty acid metabolism-related lncRNA signature as a predictor for prognosis and immunotherapy in patients with liver cancer.

BACKGROUND: Fatty acid (FA) metabolism is considered the emerging cause of tumor development and metastasis, driving poor prognosis. Long non-coding RNAs (lncRNAs) are closely related to cancer progression and play important roles in FA metabolism. Thus, the discovery of FA metabolism-related lncRNA signatures to predict outcome and immunotherapy response is critical in improving the survival of patients with hepatocellular carcinoma (HCC). METHODS: FA metabolism scores and a FA metabolism-related lncRNA signature were constructed using a single-sample gene set enrichment analysis based on The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. "ConsensusClusterPlus" was used to screen molecular subtypes. Chi-squared test and Fisher's exact test were applied to explore the relationship between clinical, genomic mutation characteristics and subtypes. Transcription factor (TF) activity scores, cellular distributions, immune cell infiltration, and immunotherapy response were employed to investigate the functions of FA metabolism-related lncRNA signatures. FA metabolism microarray and western blot were performed to detect the biological function of candidate lncRNAs. RESULTS: A total of 70 lncRNAs that highly correlated with FA metabolism scores in two cohorts were used to construct two distinct clusters. Patients in cluster 2 had lower FA metabolism scores and worse survival than those in cluster 1. Patients in cluster 2 exhibited a high frequency of DNA damage, gene mutations, oncogenic signaling such as epithelial-to-mesenchymal transition, and a high degree of immune cell infiltration. Moreover, the lncRNA signature could predict the effects of immunotherapy in patients with HCC. Furthermore, three lncRNAs (SNHG1, LINC00261, and SNHG7) were identified that were highly correlated with FA metabolism. Additionally, SNHG1 and SNHG7 were found to regulate various FA metabolism-related genes and ferroptosis-related genes in vitro experiments. GSEA analysis revealed that SNHG1 and SNHG7 promote fatty acid beta-oxidation. SNHG1 and SNHG7 silencing dramatically reduced lipid droplets in HCC cells. Many immune-infiltration genes and TFs were overexpressed in HCC tissues with SNHG1 and SNHG7 high expression. CONCLUSIONS: A novel molecular model of FA metabolism-related lncRNAs was developed, which has significantly prognostic potential in HCC diagnosis and aids in clinical decision making.

Unplanned Return to Cardiac Intensive Care Unit of Children After Congenital Heart Surgery: Incidence, Outcomes, and Risk Factors.

OBJECTIVE: Factors leading to an unplanned return to the cardiac intensive care unit (CICU) in children after congenital heart disease and their impact on mortality have not been well characterized. We sought to determine the incidence and outcomes of unplanned return to the CICU. A secondary objective was to identify risk factors. METHODS: Retrospective analysis of the registration data collected by our unit. The study subjects included postoperative patients with congenital heart disease who survived to initial transfer out of the CICU. Patients who unexpectedly returned to the CICU due to an acute change in clinical status were defined as unplanned returns. Demographic, preoperative, intraoperative, and postoperative variables were assessed. Univariate comparisons were performed between the return group and non-return group, and multivariate regression analysis was performed to identify potential risk factors for unplanned return to the CICU. RESULTS: Of the 531 children who met the inclusion criteria, 29 were unplanned returns to the CICU. Respiratory symptoms (41.4%) and cardiac symptoms (44.8%) were the most common reasons for returning to the CICU. Patients with unplanned returns had a higher mortality rate (13.8% vs. 0.56%, P < 0.01). In multivariate analysis, unplanned CICU admission was associated with chromosomal abnormalities (P < 0.01), longer ventilator duration (P < 0.01), and more prolonged cardiopulmonary bypass (P < 0.01) was associated with a return to independence. CONCLUSIONS: Unplanned return to the CICU during the same hospital stay was uncommon but associated with higher mortality. Chromosomal abnormalities, longer ventilator use duration, and prolonged CPB were significant risk factors for the entire cohort. We hope to minimize the impact of unplanned return after congenital heart disease surgery by changing the process of transferring these high-risk postoperative patients out of the CICU and early postoperative care.

WeChat-assisted health education and preoperative care improve the mental state of parents of children with ventricular septal defect.

Many studies have shown that parents of children with congenital heart disease have more stress, anxiety and depression. This study was aimed to explore the effect of implementing WeChat-assisted health education and preoperative care on parents of children with the restrictive ventricular septal defect to improve the psychological state. A prospective randomized controlled study was conducted in a provincial hospital in China. Participants were randomly divided into an intervention group and a control group to explore the psychological state of parents of children with the restricted ventricular septal defect. Before surgery, the state-trait anxiety inventory scale score (STAI) of the WeChat group were 26.8 ± 8.2 and 27.3 ± 7.0, which were significantly higher than those of the leaflet group (37.6 ± 12.9 and 39.3 ± 11.7). Compared with the STAI score at the first visit, the WeChat group preoperative score was significantly lower (P < 0.05). The rate of loss to follow-up in the WeChat group (0%) was significantly lower than that of the leaflet group (14.3%). The complication of the leaflet group was significantly higher than that of the WeChat group. Health education and preoperative care for parents of children with restrictive ventricular septal defect through WeChat can effectively improve the parents' mental state and reduce the incidence of complications and the rate of loss to follow-up.

Proteomics reveals the potential mechanism of Mrps35 controlling Listeria monocytogenes intracellular proliferation in macrophages.

Macrophages are sentinels in the organism which can resist and destroy various bacteria through direct phagocytosis. Here, we reported that expression level of mitochondrial ribosomal protein S35 (Mrps35) continued to decrease over infection time after Listeria monocytogenes (L. monocytogenes) infected macrophages. Our results indicated that knockdown Mrps35 increased the load of L. monocytogenes in macrophages. This result supported that Mrps35 played the crucial roles in L. monocytogenes infection. Moreover, we performed the comprehensive proteomics to analyze the differentially expressed protein of wild type and Mrps35 Knockdown Raw264.7 cells by L. monocytogenes infection over 6 h. Based on the results of mass spectrometry, we presented a wide variety of hypotheses about the mechanism of Mrps35 controlling the L. monocytogenes intracellular proliferation. Among them, experiments confirmed that Mrps35 and 60S ribosomal protein L22-like 1 (Rpl22l1) were a functional correlation or potentially a compensatory mechanism during L. monocytogenes infection. This study provided new insights into understanding that L. monocytogenes infection changed the basic synthesis or metabolism-related proteins of host cells.

Performance of remote health education via WeChat to improve the pre-operative nutritional status of infants with non-restrictive ventricular septal defects: A prospective randomised controlled study.

AIM: This study aimed to explore the effect of performing remote health education via WeChat to improve the pre-operative nutritional status of non-restrictive ventricular septal defects (VSD). METHODS: A prospective randomised controlled study was conducted in a provincial maternity and child hospital in China. Participants were randomised regarding education to the intervention group (WeChat) and the control group (leaflets). The nutritional status and complications of the patients were compared after intervening for 1 month. RESULTS: Nutrient status comparison at 1 month after intervention showed that the body weight, head circumference, haemoglobin, albumin and pre-albumin of the WeChat group were significantly higher than those of the leaflet group (P < 0.05). The STRONGkids score of the WeChat group was significantly lower than that of the leaflet group (P < 0.05). The incidence of feeding intolerance and respiratory tract infection in the WeChat group was significantly lower than that found in the leaflet group (P < 0.05). There was no significant difference in the incidence of liver insufficiency and jaundice between the two groups (P > 0.05). CONCLUSION: Providing pre-operative feeding and care guidance for parents of infants with non-restrictive VSD, via remote health education through WeChat, can effectively improve nutritional status and reduce the risk of malnutrition and feeding complications.

The effect of music therapy on chronic pain, quality of life and quality of sleep in adolescents after transthoracic occlusion of ventricular septal defect.

OBJECTIVE: To investigate the effect of music therapy on chronic pain, quality of life, and quality of sleep in adolescent patients after transthoracic occlusion of ventricular septal defects. METHODS: Patients were divided into 2 groups based on whether they received music therapy: a control group and a music group. The music group received 30 minutes of music therapy every day for 6 months after surgery. Patients in the control group received standard treatment and had 30 minutes of quiet time every day for 6 months after surgery. The short-form McGill pain questionnaire (SF-MPQ), the SF-36 scale and the Karolinska Sleep Questionnaire (KSQ) was used as the evaluation tool for chronic pain, quality of life, and quality of sleep, respectively. RESULTS: In terms of the degree of postoperative chronic pain, the Pain Rating Index (PRI) emotion item score in the SF-MPQ evaluation of the music group was significantly lower than that of the control group (1.6 ± 1.1 versus 2.2 ± 0.9). The role emotional (RE) scores of the SF-36 in the music group were significantly higher than that in the control group (77.35 ± 18.55 versus 42.66 ± 22.63). KSQ scores were significantly higher in the music group than in the control group for sleep status (4.1 ± 1.0 versus 3.3 ± 0.9), falling asleep (3.9 ± 1.1 versus 3.1 ± 1.0), and not feeling refreshed by sleep (3.6 ± 1.3 versus 2.7 ± 0.9) (P < .05). CONCLUSION: This study preliminarily showed that music therapy could effectively reduce patients' chronic pain and improve quality of life and sleep after surgery. These results suggest that music therapy may be an essential therapy worth considering in managing patients' postoperative recovery after cardiovascular surgery.

Energy Platform for Directed Charge Transfer in the Cascade Z-Scheme Heterojunction: CO2 Photoreduction without a Cocatalyst.

A universal strategy is developed to construct a cascade Z-Scheme system, in which an effective energy platform is the core to direct charge transfer and separation, blocking the unexpected type-II charge transfer pathway. The dimension-matched (001)TiO2 -g-C3 N4 /BiVO4 nanosheet heterojunction (T-CN/BVNS) is the first such model. The optimized cascade Z-Scheme exhibits ≈19-fold photoactivity improvement for CO2 reduction to CO in the absence of cocatalysts and costly sacrificial agents under visible-light irradiation, compared with BVNS, which is also superior to other reported Z-Scheme systems even with noble metals as mediators. The experimental results and DFT calculations based on van der Waals structural models on the ultrafast timescale reveal that the introduced T as the platform prolongs the lifetimes of spatially separated electrons and holes and does not compromise their reduction and oxidation potentials.

Music Therapy for Early Postoperative Pain, Anxiety, and Sleep in Patients after Mitral Valve Replacement.

BACKGROUND: To investigate the effect of music therapy on early postoperative pain, anxiety, and sleep quality in patients after mechanical mitral valve replacement (MVR). METHODS: A total of 222 patients undergoing mechanical MVR were divided into two groups: the music group and the control group. The patients in the music group received 30 minutes of music therapy every day, whereas the patients in the control group had 30 minutes of quiet time. The visual analogue scale (VAS) was used to evaluate the degree of pain, and the Self-Rating Anxiety Scale (SAS) was used to evaluate the degree of early postoperative anxiety. We also recorded the sleep duration of the patients and used the Verran and Snyder-Halpern (VSH) Sleep Scale to evaluate the sleep quality of the patients. RESULTS: The VAS scores in the music group were significantly lower than those in the control group, and early postoperative anxiety in the music group was also significantly improved compared with that in the control group. The sleep duration in the music group was significantly greater than that in the control group. In the evaluation of sleep quality using the VSH Sleep Scale, the scores for sleep interruption, sleep length, sleep depth, degree of rest, and subjective sleep quality in the music group were significantly lower than those in the control group. CONCLUSIONS: Music therapy can be an effective intervention to reduce early postoperative pain, relieve early postoperative anxiety, prolong sleep time, and improve the sleep quality of patients after mechanical MVR.

A Comparative Study on Breast Milk Feeding and Formula Milk Feeding in Infants With Congenital Heart Disease After Surgery: A Retrospective Study.

OBJECTIVE: To explore the effects of breast milk feeding and formula milk feeding on infants after cardiac surgery in the cardiac intensive care unit (ICU). METHODS: Infants who underwent cardiac surgery in our ICU were divided into two groups, according to feeding type. Breast milk feeding and formula milk feeding were separately implemented in the two groups, and the remaining treatment regimens were the same. The related clinical data and feeding effects were recorded and compared. RESULTS: The prealbumin (147.3 ± 15.2 versus 121.5 ± 18.3mg/L) and albumin (46.4 ± 4.2 versus 40.5 ± 5.1 g/L) levels in the breast milk feeding group were better than those in the formula milk feeding group (P < .05). Infants in the breast milk feeding group achieved a better total enteral nutrition time (3.0 ± 1.2 versus 5.2 ± 2.1 d), average daily weight gain (19.0 ± 3.4 versus 14.4 ± 2.3 g/kg·d), length of ICU stay (6.0 ± 2.2 versus 8.1 ± 2.9 d) and length of hospital stay (13.9 ± 4.2 versus 17.8 ± 5.6 d) than those in the formula milk feeding group (P < .05). The incidence of complications such as feeding intolerance, anemia, dyspeptic diarrhea, and nosocomial infection was lower in the breast milk feeding group than in the formula milk feeding group (P < 0.05). CONCLUSION: Breast milk feeding has a definite nutritional effect on infants after cardiac surgery. It is better than formula milk feeding, making it worthy of popularization and application.

Comparison of Transthoracic Device Closure and Surgical Repair with Right Submammary or Right Infra-axillary Thoracotomy for Perimembranous VSD.

BACKGROUND: Transthoracic device closure (TTDC) and surgical repair with right infra-axillary thoracotomy (SRRIAT) or with right submammary thoracotomy (SRSMT) are all the primary alternative treatments for restrictive perimembranous ventricular septal defect (pmVSD). However, few studies have compared them in terms of effectiveness and complications. METHODS: Patients with restrictive pmVSD undergoing TTDC, or SRRIAT, or SRSMT from March 2016 to February 2017 were retrospectively reviewed in our cardiac center. There were no differences in age (1.3 ± 1.2 vs 1.1 ± 1.1 vs 1.2 ± 1.1 years), gender (35/37 vs 30/33 vs 29/29), body weight (8.3 ± 2.6 vs 8.2 ± 2.4 vs 8.1 ± 2.5 kg), and size of VSD (4.2 ± 1.1 vs 5.2 ± 1.3 vs 5.1 ± 1.2 mm) distribution between the three groups. RESULTS: The procedure success rates were similar in the three groups. The TTDC group had the shortest operative time, postoperative mechanical ventilation time, duration of intensive care, postoperative length of hospital stay, medical cost, and length of the incision. There were no significant differences in terms of operative time, aortic cross-clamping time, duration of cardiopulmonary bypass (CPB), blood transfusion volume, mechanical ventilation time, duration of intensive care, duration of hospital stays, pleural fluid drainage, or cost between the SRSMT and SRRIAT groups. No significant differences were noted in terms of major adverse events. CONCLUSIONS: TTDC, SRRIAT, and SRSMT all showed excellent outcomes and cosmetic appearances for selected VSD patients. TTDC had advantages over SRRIAT and SRSMT in terms of short operation duration and smaller incision size and shorter durations of intensive care and hospital stays.

Upregulation of LncDQ is Associated with Poor Prognosis and Promotes Tumor Progression via Epigenetic Regulation of the EMT Pathway in HCC.

BACKGROUND/AIMS: Long noncoding RNAs (lncRNAs) are key regulators of cancer initiation and progression. In this study, we investigated the clinical value and functional role of LncRNA DQ786243 (LncDQ) in the pathogenesis of hepatocellular carcinoma (HCC). METHODS: To investigate the expression level of LncDQ in HCC, we performed quantitative real-time PCR using total RNA extracted from HCC tumor tissues and their matched non-neoplastic counterparts, as well as from the serum of HCC patients and healthy volunteers. The correlation of LncDQ expression with clinicopathologic features and prognosis was analyzed. The functional role of LncDQ in cell proliferation, migration, and invasion were evaluated by MTT cell viability, wound healing, and transwell assays in vitro and in vivo. RNA immunoprecipitation and chromatin immunoprecipitation assays were performed to analyze the potential mechanism of LncDQ in HCC cells. RESULTS: LncDQ was upregulated in both HCC tissue samples and serum and was correlated with low survival rate and adverse clinical pathological characteristics. Multivariate analysis demonstrated that LncDQ expression was an independent prognostic factor for HCC. The area under the receiver operating characteristic curve was 0.804 with a sensitivity of 0.72 and a specificity of 0.8. Knockdown of LncDQ induced inhibition of cell proliferation, migration, and invasion in vitro and in vivo. Mechanistically, LncDQ regulated the epithelial-mesenchymal transition pathway by interacting with EZH2, to epigenetically repress the expression of E-cadherin in HCC cells. CONCLUSIONS: Taken together, the results of our study indicate that LncDQ plays a critical role in HCC progression, and may serve as a potential diagnostic and prognostic biomarker for HCC.

Thoracoscope-Assisted Mitral Valve Replacement with a Small Incision in the Right Chest: A Chinese Single Cardiac Center Experience.

BACKGROUND The aim of this study was to investigate the safety, feasibility, and clinical effectiveness of thoracoscopy-assisted mitral valve replacement via thoracic right-anterior minimal incision. MATERIAL AND METHODS A retrospective analysis was conducted of 225 patients with mitral valve lesions who were treated in our hospital from August 2012 to August 2015. Group A included 105 patients undergoing thoracoscopy-assisted mitral valve replacement via a thoracic right-anterior minimal incision, and group B included 120 patients undergoing conventional mitral valve replacement. We collected and analyzed clinical data from both groups. RESULTS The procedures were successful in patients of both groups. No severe complications or mortality were reported. Postoperative mechanical ventilation time (8.6±2.4 h vs. 12.4±3.2 h), duration of intensive care (1.7±1.2 d vs. 2.8±1.3 d), duration of postoperative analgesia use (28.7±8.9 h vs. 36.3±7.5 h), postoperative length of hospital stay (8.2±2.2 d vs. 12.8±2.1 d), pleural fluid drainage (210.5±60.5 ml vs. 425.4±75.6 ml), blood transfusion amount (420.5±80.4 ml vs. 658.3±96.7 ml), and operative incision length (4.7±1.1 cm vs. 22.4±2.5 cm) were significantly shorter (or lower) in group A than in group B. There were different advantages and disadvantages in the 2 kinds of operative procedure in terms of postoperative complications. CONCLUSIONS Thoracoscopy-assisted mitral valve replacement via thoracic right-anterior minimal incision has the same clinical efficacy, safety, and feasibility as conventional mitral valve replacement.

The Short and Midterm Follow-Up of Transthoracic Device Closure of Perimembranous Ventricular Septal Defect in Adults.

BACKGROUND: The purpose of this study was to assess the short- and mid-term follow-up results of transthoracic device closure of perimembranous ventricular septal defect (pmVSD) in adults. METHODS: Sixty-one adults underwent transthoracic device closure of pmVSD at our institution from Jan. 2012 to Jan. 2016. All relevant clinical data were recorded and analyzed. All patients were invited to undergo contrast transthoracic echocardiography (TTE) for 12 months to 60 months after VSD closure. Phone interviews were conducted to further evaluate the cardiac function status. RESULTS: All patients were successfully occluded using this procedure. The most frequent complication was transient cardiac arrhythmia, which was easily treated during the perioperative period. During the follow-up period, we found no recurrence, malignant arrhythmia, thrombosis, device embolization, valve damage, device failure, or cases of death. The total occlusion rate was 100 percent in the 12 months of follow-up, and most of patients showed significant improvement in their clinical status. From the TTE data, the intracardiac structure and cardiac function were improved in the follow-up. CONCLUSION: Transthoracic device closure of perimembranous ventricular septal defect in adults is a safe and feasible technique. The short- and mid-term follow-up results were satisfactory, but long-term follow-up is required to better assess the safety and feasibility of this method in adults.

The expression levels of transcription factors T-bet, GATA-3, RORγt and FOXP3 in peripheral blood lymphocyte (PBL) of patients with liver cancer and their significance.

OBJECTIVES: To investigate the expression of transcriptional factors (TFs) T-bet, GATA-3, RORγt and FOXP in peripheral blood mononuclear cells (PBMC) of patients with hepatocellular carcinoma (HCC) and to evaluate the correlation between the imbalances of Th1/Th2, Th17/Treg at the expression levels and liver cancer Methods: The peripheral venous blood was drawn from 20 HCC-patients (HCC-group) and 20 health participants (C-group). The expression levels of Th1, Th2 and Th17 and the major Treg-specific TFs T-bet, GATA-3, RORγt and FOXP3 in the PBMC were measured with quantitative real-time PCR(RT-qPCR). RESULTS: The mRNA level of Th1-specific TF T-bet in HCC-group was significantly lower than that of C-group (52.34±34.07 VS 104.01±56.00, P<0.01); the mRNA level of Th2-specifc TF, GATA-3, in HCC group was significantly higher than that in C-group (1.38±1.15 VS 0.58±0.65, P<0.05) and T-bet mRNA/GATA-3 mRNA ratio was significantly lower in HCC-group than in C-group (86.01±116.71 VS 461.88±708.81, P<0.05). The mRNA level of Th17-specific TF RORγt in HCC-group was significantly higher than that of C-group (72.32±32.82 VS 33.07±22.86, P<0.01). Treg-specific TF FOXP3 mRNA level was significant higher in HCC-group than in C-group (3.17±1.59 VS 1.39±1.13, P<0.01) CONCLUSION: T-bet mRNA level was reduced whereas GATA-3 mRNA level was increased and T-bet/GATA-3 ratio was significantly reduced in PBMC, indicating that Th1/Th2 ratio was of imbalance at TF levels in PBMC of HCC, displaying Th2 thrift phenomena. The mRNA levels of RORγt and FOXP3 in PBMC of HCC were significantly increased, indicating the existence of a predominant phenomenon of Th17- and Treg-expressing PBMC in HCC.

Case report: Intrahepatic cholangiectasis with Clonorchis sinensis infection.

Clonorchis sinensis infections persist globally among humans. These pathogens mainly inhabit the intrahepatic biliary system. Most individuals with clonorchiasis exhibit mild symptoms. The absence of distinctive symptoms often results in delayed diagnosis and treatment, potentially leading to chronic infection. We herein report a case of a 29-year-old female presented with a year-long history of abdominal distention and dyspepsia. Imaging revealed intrahepatic bile duct dilatation, intrahepatic bile duct cyst, and associated deposits. One month post-cystectomy, the patient developed massive ascites and a significant increase in eosinophil count. After treatment, multiple worms were observed in the drainage tube. Morphological and DNA metagenomic analyses confirmed the presence of C. sinensis. Clinical manifestations of C. sinensis vary widely. Imaging serves as a valuable diagnostic tool in endemic areas, especially in detecting intrahepatic duct dilation where the flukes reside. In addition to intrahepatic bile duct dilation, abnormal echoes within the bile duct and the presence of floating objects in the gallbladder significantly aid in diagnosis. Clinicians may encounter these parasitic diseases unexpectedly, underscoring the importance of understating such cases in routine practice and contributing to our broader understanding of managing similar cases in clinical settings.

Predictive value of a stemness-based classifier for prognosis and immunotherapy response of hepatocellular carcinoma based on bioinformatics and machine-learning strategies.

Objective: Significant advancements have been made in hepatocellular carcinoma (HCC) therapeutics, such as immunotherapy for treating patients with HCC. However, there is a lack of reliable biomarkers for predicting the response of patients to therapy, which continues to be challenging. Cancer stem cells (CSCs) are involved in the oncogenesis, drug resistance, and invasion, as well as metastasis of HCC cells. Therefore, in this study, we aimed to create an mRNA expression-based stemness index (mRNAsi) model to predict the response of patients with HCC to immunotherapy. Methods: We retrieved gene expression and clinical data of patients with HCC from the GSE14520 dataset and the Cancer Genome Atlas (TCGA) database. Next, we used the "one-class logistic regression (OCLR)" algorithm to obtain the mRNAsi of patients with HCC. We performed "unsupervised consensus clustering" to classify patients with HCC based on the mRNAsi scores and stemness subtypes. The relationships between the mRNAsi model, clinicopathological features, and genetic profiles of patients were compared using various bioinformatic methods. We screened for differentially expressed genes to establish a stemness-based classifier for predicting the patient's prognosis. Next, we determined the effect of risk scores on the tumor immune microenvironment (TIME) and the response of patients to immune checkpoint blockade (ICB). Finally, we used qRT-PCR to investigate gene expression in patients with HCC. Results: We screened CSC-related genes using various bioinformatics tools in patients from the TCGA-LIHC cohort. We constructed a stemness classifier based on a nine-gene (PPARGC1A, FTCD, CFHR3, MAGEA6, CXCL8, CABYR, EPO, HMMR, and UCK2) signature for predicting the patient's prognosis and response to ICBs. Further, the model was validated in an independent GSE14520 dataset and performed well. Our model could predict the status of TIME, immunogenomic expressions, congenic pathway, and response to chemotherapy drugs. Furthermore, a significant increase in the proportion of infiltrating macrophages, Treg cells, and immune checkpoints was observed in patients in the high-risk group. In addition, tumor cells in patients with high mRNAsi scores could escape immune surveillance. Finally, we observed that the constructed model had a good expression in the clinical samples. The HCC tumor size and UCK2 genes expression were significantly alleviated and decreased, respectively, by treatments of anti-PD1 antibody. We also found knockdown UCK2 changed expressions of immune genes in HCC cell lines. Conclusion: The novel stemness-related model could predict the prognosis of patients and aid in creating personalized immuno- and targeted therapy for patients in HCC.

[Corrigendum] lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR­15b­5p/Wnt3A axis.

Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR­15b­5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'­end [the sequence of this primer on p. 2, right­hand column, line 25 should have been written as 5'­CTTCTGCTGGGCTGTTGAGTG­3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR­15b­5p, the authors used the mature miR­15b­5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR­15b­5p, and therefore the sequence of the forward primer of miR­15b­5p on line 27 should have been written as 5'­TAGCAGCACATCATGGTTTACA­3'. Moreover, a universal reverse primer was used for the reverse primer of miR­15b­5p, as provided by the kit [specifically, the authors used an Mir­X miRNA qRT­PCR TB Green Kit (Takara Bio USA, Inc.) for detecting the expression of miR­15b­5p, and the reverse primer was supplied in the kit]; however, a different primer sequence used in the authors' lab was erroneously written as the reverse primer of miR­15b­5p in the manuscript. Finally, note that the title was published with a typographical error: "miR­15p­5p" in the title should have been written as "miR­15b­5p", as appeared elsewhere throughout the paper, and the corrected title is presented above.  The authors are grateful to the Editor of Molecular Medicine Reports for allowing them the opportunity to publish this corrigendum, and all the authors agree with its publication. The authors also regret the inconvenience that these mistakes have caused. [Molecular Medicine Reports 23: 318, 2021; DOI: 10.3892/mmr.2021.11957].

A new goodness-of-fit measure for probit models: Surrogate R2.

Probit models are used extensively for inferential purposes in the social sciences as discrete data are prevalent in a vast body of social studies. Among many accompanying model inference problems, a critical question remains unsettled: how to develop a goodness-of-fit measure that resembles the ordinary least square (OLS) R2 used for linear models. Such a measure has long been sought to achieve 'comparability' of different empirical models across multiple samples addressing similar social questions. To this end, we propose a novel R2 measure for probit models using the notion of surrogacy - simulating a continuous variable S as a surrogate of the original discrete response (Liu & Zhang, Journal of the American Statistical Association, 113, 845 and 2018). The proposed R2 is the proportion of the variance of the surrogate response explained by explanatory variables through a linear model, and we call it a surrogate R2 . This paper shows both theoretically and numerically that the surrogate R2 approximates the OLS R2 based on the latent continuous variable, preserves the interpretation of explained variation, and maintains monotonicity between nested models. As no other pseudo R2 , McKelvey and Zavoina's and McFadden's included, can meet all the three criteria simultaneously, our measure fills this crucial void in probit model inference.

CDCA8 induced by NF-YA promotes hepatocellular carcinoma progression by regulating the MEK/ERK pathway.

BACKGROUND: Hepatocellular carcinoma (HCC) is one of the most lethal malignant tumors. Cell division cycle associated 8 (CDCA8) is an important multifactorial regulator in cancers. However, its up and downstream targets and effects in HCC are still unclear. METHODS: A comprehensive bioinformatics analysis was performed using The Cancer Genome Atlas dataset (TCGA) to explore novel core oncogenes. We quantified CDCA8 levels in HCC tumors using qRT-PCR. HCC cell's proliferative, migratory, and invasive abilities were detected using a Cell Counting Kit-8 (CCK-8) assay, 5-ethynyl-2'-deoxyuridine (EdU) assay, clone formation, and a Transwell assay. An orthotopic tumor model and tail vein model were constructed to determine the effects of CDCA8 inhibition in vivo. The mechanism underlying CDCA8 was investigated using RNA sequencing. The prognostic value of CDCA8 was assessed with immunohistochemical staining of the tissue microarrays. RESULTS: CDCA8 was identified as a novel oncogene during HCC development. The high expression of CDCA8 was an independent predictor for worse HCC outcomes both in publicly available datasets and in our cohort. We found that CDCA8 knockdown inhibited HCC cell proliferation, colony formation, and migration by suppressing the MEK/ERK pathway in vitro. Moreover, CDCA8 deficiency significantly inhibited tumorigenesis and metastasis. Next-generation sequencing and laboratory validation showed that CDCA8 silencing inhibited the expression of TPM3, NECAP2, and USP13. Furthermore, NA-YA overexpression upregulated the expression of CDCA8. CDCA8 knockdown could attenuate NF-YA-mediated cell invasion in vitro. The expression of NF-YA alone or in combined with CDCA8 were validated as significant independent risk factors for patient survival. CONCLUSION: Our findings revealed that the expression of CDCA8 alone or in combined with NF-YA contributed to cancer progression, and could serve as novel potential therapeutic targets for HCC patients.