Effect of Acupuncture for Methadone Reduction : A Randomized Clinical Trial.

BACKGROUND: Methadone maintenance treatment (MMT) is effective for managing opioid use disorder, but adverse effects mean that optimal therapy occurs with the lowest dose that controls opioid craving. OBJECTIVE: To assess the efficacy of acupuncture versus sham acupuncture on methadone dose reduction. DESIGN: Multicenter, 2-group, randomized, sham-controlled trial. (Chinese Clinical Trial Registry: ChiCTR2200058123). SETTING: 6 MMT clinics in China. PARTICIPANTS: Adults aged 65 years or younger with opioid use disorder who attended clinic daily and had been using MMT for at least 6 weeks. INTERVENTION: Acupuncture or sham acupuncture 3 times a week for 8 weeks. MEASUREMENTS: The 2 primary outcomes were the proportion of participants who achieved a reduction in methadone dose of 20% or more compared with baseline and opioid craving, which was measured by the change from baseline on a 100-mm visual analogue scale (VAS). RESULTS: Of 118 eligible participants, 60 were randomly assigned to acupuncture and 58 were randomly assigned to sham acupuncture (2 did not receive acupuncture). At week 8, more patients reduced their methadone dose 20% or more with acupuncture than with sham acupuncture (37 [62%] vs. 16 [29%]; risk difference, 32% [97.5% CI, 13% to 52%]; P < 0.001). In addition, acupuncture was more effective in decreasing opioid craving than sham acupuncture with a mean difference of -11.7 mm VAS (CI, -18.7 to -4.8 mm; P < 0.001). No serious adverse events occurred. There were no notable differences between study groups when participants were asked which type of acupuncture they received. LIMITATION: Fixed acupuncture protocol limited personalization and only 12 weeks of follow-up after stopping acupuncture. CONCLUSION: Eight weeks of acupuncture were superior to sham acupuncture in reducing methadone dose and decreasing opioid craving. PRIMARY FUNDING SOURCE: National Natural Science Foundation of China.

Measurements of Atmospheric HO2 Radicals Using Br-CIMS with Elimination of Potential Interferences from Ambient Peroxynitric Acid.

As a promising direct measurement method of atmospheric hydroperoxyl radicals (HO2), bromide chemical ionization mass spectrometry (Br-CIMS) has been first demonstrated by Sanchez et al. (Atmos. Meas. Tech. 2016, 9, 3851-3861). However, field application of this method is currently still sparse, and there is still a gap between measured HO2 concentrations and calculated ones derived from the atmospheric equilibrium between HO2 and peroxynitric acid (HO2NO2). In this work, we constructed an improved Br-CIMS with optimizations of custom-built front-end devices, chamber pressures, and instrumental voltages to achieve a 3σ detection limit of 0.5 ppt at an integration time of 60 s and a sensitivity of 1-3 cps ppt-1 under a total reagent ion signal of 0.2 MHz for HO2 detection. HO2NO2, a product from atmospheric reactions between HO2 and NO2, can also be detected by Br-CIMS, whose interference on the HO2 measurement was found but nearly eliminated by regulating key CIMS voltages to minimize the decomposition of (BrHO2NO2)- ions in the MS. In addition, a 2 week field campaign was carried out in urban Shanghai, demonstrating that the interference of HO2 from ambient HO2NO2 was less than 10% of the true HO2 signal under our optimized CIMS voltage setting. Our study suggests that Br-CIMS is a reliable technique for atmospheric HO2 measurements.

Prediction of Clinical Response to Dupilumab in Patients with Severe Asthma Using Fractional Exhaled Nitric Oxide Combined with Pulmonary Function Testing.

INTRODUCTION: This study aimed to assess the effectiveness of fractional exhaled nitric oxide (FeNO) combined with pulmonary function testing (PFT) for predicting the treatment outcome of patients with severe asthma receiving dupilumab. METHODS: A total of 31 patients with severe asthma visiting our hospital from January 2022 to June 2023 were included in this study, with 28 patients completing a 16-week course of dupilumab treatment. Baseline clinical data, including demographic information, blood eosinophil counts, serum IgE levels, FeNO, asthma control test (ACT), asthma control questionnaire (ACQ), and other parameters, were collected. A predictive model using a generalized linear model was established. RESULTS: Following the 16-week course of dupilumab treatment, 22 patients showed effective response based on GETE scores, while 6 patients were nonresponders. Notably, significant improvements were observed in clinical parameters such as blood eosinophil counts, serum IgE levels, FeNO, FEV1, FEV1%, ACT, and ACQ in both response groups (p < 0.05). FeNO and pulmonary function tests demonstrated AUC values of 0.530, 0.561, and 0.765, respectively, in predicting the clinical efficacy of dupilumab, which were lower than when FeNO was combined with FEV1%. The combination of FeNO and FEV1% had a sensitivity of 1.000 and specificity of 0.591 in predicting treatment response. CONCLUSION: The combined assessment of FeNO and FEV1% provides improved accuracy for predicting the clinical efficacy of dupilumab in managing severe asthma. However, further larger scale clinical studies with comprehensive follow-up data are needed to validate the therapeutic efficacy and applicability across diverse patient populations.

Comparison of cognitive performance in first-episode drug-naïve schizophrenia, bipolar II disorder, and major depressive disorder patients after treatment.

BACKGROUND: Cognitive impairment is a recognized fundamental deficit in individuals diagnosed with schizophrenia (SZ), bipolar II disorder (BD II), and major depressive disorder (MDD), among other psychiatric disorders. However, limited research has compared cognitive function among first-episode drug-naïve individuals with SZ, BD II, or MDD. METHODS: This study aimed to address this gap by assessing the cognitive performance of 235 participants (40 healthy controls, 58 SZ patients, 72 BD II patients, and 65 MDD patients) using the Repeatable Battery for the Assessment of Neuropsychological Status (RBANS) before and after 12 weeks of treatment in SZ, BD II, and MDD patients. To clarify, the healthy controls only underwent RBANS testing at baseline, whereas the patient groups were assessed before and after treatment. The severity of symptoms in SZ patients was measured using the Positive and Negative Syndrome Scale (PANSS), and depression in BD II and MDD patients was assessed using the Hamilton Depression Scale-24 items (HAMD-24 items). RESULTS: Two hundred participants completed the 12-week treatment period, with 35 participants dropping out due to various reasons. This group included 49 SZ patients, 58 BD II patients, and 53 MDD patients. Among SZ patients, significant improvements in immediate and delayed memory were observed after 12 weeks of treatment compared to their initial scores. Similarly, BD II patients showed significant improvement in immediate and delayed memory following treatment. However, there were no significant differences in RBANS scores for MDD patients after 12 weeks of treatment. CONCLUSIONS: In conclusion, the findings of this study suggest that individuals with BD II and SZ may share similar deficits in cognitive domains. It is important to note that standardized clinical treatment may have varying degrees of effectiveness in improving cognitive function in patients with BD II and SZ, which could potentially alleviate cognitive dysfunction.

The risk of Alzheimer's disease and cognitive impairment characteristics in eight mental disorders: A UK Biobank observational study and Mendelian randomization analysis.

INTRODUCTION: The cognitive impairment patterns and the association with Alzheimer's disease (AD) in mental disorders remain poorly understood. METHODS: We analyzed data from 486,297 UK Biobank participants, categorizing them by mental disorder history to identify the risk of AD and the cognitive impairment characteristics. Causation was further assessed using Mendelian randomization (MR). RESULTS: AD risk was higher in individuals with bipolar disorder (BD; hazard ratio [HR] = 2.37, P < 0.01) and major depressive disorder (MDD; HR = 1.63, P < 0.001). MR confirmed a causal link between BD and AD (ORIVW = 1.098), as well as obsessive-compulsive disorder (OCD) and AD (ORIVW = 1.050). Cognitive impairments varied, with BD and schizophrenia showing widespread deficits, and OCD affecting complex task performance. DISCUSSION: Observational study and MR provide consistent evidence that mental disorders are independent risk factors for AD. Mental disorders exhibit distinct cognitive impairment prior to dementia, indicating the potential different mechanisms in AD pathogenesis. Early detection of these impairments in mental disorders is crucial for AD prevention. HIGHLIGHTS: This is the most comprehensive study that investigates the risk and causal relationships between a history of mental disorders and the development of Alzheimer's disease (AD), alongside exploring the cognitive impairment characteristics associated with different mental disorders. Individuals with bipolar disorder (BD) exhibited the highest risk of developing AD (hazard ratio [HR] = 2.37, P < 0.01), followed by those with major depressive disorder (MDD; HR = 1.63, P < 0.001). Individuals with schizophrenia (SCZ) showed a borderline higher risk of AD (HR = 2.36, P = 0.056). Two-sample Mendelian randomization (MR) confirmed a causal association between BD and AD (ORIVW = 1.098, P < 0.05), as well as AD family history (proxy-AD, ORIVW = 1.098, P < 0.001), and kept significant after false discovery rate correction. MR also identified a nominal significant causal relationship between the obsessive-compulsive disorder (OCD) spectrum and AD (ORIVW = 1.050, P < 0.05). Individuals with SCZ, BD, and MDD exhibited impairments in multiple cognitive domains with distinct patterns, whereas those with OCD showed only slight declines in complex tasks.

Tafenoquine and its derivatives as inhibitors for the severe acute respiratory syndrome coronavirus 2.

The pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has severely affected human lives around the world as well as the global economy. Therefore, effective treatments against COVID-19 are urgently needed. Here, we screened a library containing Food and Drug Administration (FDA)-approved compounds to identify drugs that could target the SARS-CoV-2 main protease (Mpro), which is indispensable for viral protein maturation and regard as an important therapeutic target. We identified antimalarial drug tafenoquine (TFQ), which is approved for radical cure of Plasmodium vivax and malaria prophylaxis, as a top candidate to inhibit Mpro protease activity. The crystal structure of SARS-CoV-2 Mpro in complex with TFQ revealed that TFQ noncovalently bound to and reshaped the substrate-binding pocket of Mpro by altering the loop region (residues 139-144) near the catalytic Cys145, which could block the catalysis of its peptide substrates. We also found that TFQ inhibited human transmembrane protease serine 2 (TMPRSS2). Furthermore, one TFQ derivative, compound 7, showed a better therapeutic index than TFQ on TMPRSS2 and may therefore inhibit the infectibility of SARS-CoV-2, including that of several mutant variants. These results suggest new potential strategies to block infection of SARS-CoV-2 and rising variants.

Ocular Characteristics of Pseudophakic Eyes with Malignant Glaucoma.

INTRODUCTION: The aim of the study was to investigate the clinical characteristics and treatment outcomes of the pseudophakic eyes with malignant glaucoma (MG). METHODS: This retrospective case-control study enrolled 53 eyes of 47 patients with primary angle-closure glaucoma having cataract surgery history, including 19 patients (25 eyes) diagnosed with MG and 28 patients (28 eyes) without MG as the match. Among patients diagnosed with MG, 14 patients (18 eyes) underwent zonulo-hyaloido-vitrectomy (ZHV) and the other 5 patients (7 eyes) received conservative treatments. The visual acuity, refraction status, intraocular pressure (IOP), extent of peripheral anterior synechia, classes of anti-glaucoma medications, and ultrasound biomicroscopy (UBM) examination were recorded before cataract surgery, at the diagnosis of MG, and 3 months after ZHV or atropine application, respectively. RESULTS: In the pseudophakic eyes with MG, the IOP cannot be well controlled compared to the matched eyes (27.24 ± 8.72 mm Hg vs. 14.30 ± 2.63 mm Hg, p < 0.001). In addition, there was a difference in the average spherical equivalent refractive error between 2 groups of patients (-2.23 ± 0.84 D in MG vs. -0.12 ± 0.64 D in the matched eyes, p < 0.001). By UBM analysis, the anterior chamber depth (ACD) was shallower in MG than that in the matched eyes (2.34 ± 0.20 mm vs. 3.47 ± 0.29 mm, p < 0.001). The difference between the anterior vault distance of the pseudophakic eyes with MG and that of the matched eyes was also significant (p < 0.001). After treated with ZHV, the IOP was greatly decreased from 27.84 ± 10.14 mm Hg to 15.85 ± 4.41 mm Hg (p < 0.001). The refractive error also changed from -2.11 ± 0.91 D to +0.42 ± 0.99 D (p < 0.001). At the same time, the central ACD was significantly deepened from 2.30 ± 0.39 mm to 3.30 ± 0.31 mm (p < 0.001). CONCLUSION: Uncontrolled IOP and shallow anterior chamber both centrally and peripherally are the primary clinical characteristics for the pseudophakic eyes with MG. An unexpected refractive error or myopic shift for the eyes with PACG after cataract surgery can be an important hint for diagnosis of MG. The typical UBM image is an anterior displacement of the lens-iris diaphragm and a bow-shaped change of the intraocular lens. It is an effective way to treat pseudophakic MG with the ZHV through a peripheral iridectomy.

First report of Arthrobacter woluwensis causing brown blotch disease on white button mushroom (Agaricus bisporus).

Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.

Magnetic and Electronic Properties of Sr Doped Infinite-Layer NdNiO2 Supercell: A Screened Hybrid Density Functional Study.

To understand the influence of doping Sr atoms on the structural, magnetic, and electronic properties of the infinite-layer NdSrNiO2, we carried out the screened hybrid density functional study on the Nd9-nSrnNi9O18 (n = 0-2) unit cells. Geometries, substitution energies, magnetic moments, spin densities, atom- and lm-projected partial density of states (PDOS), spin-polarized band structures, and the average Bader charges were studied. It showed that the total magnetic moments of the Nd9Ni9O18 and Nd8SrNi9O18 unit cells are 37.4 and 24.9 emu g-1, respectively. They are decreased to 12.6 and 4.2 emu g-1 for the Nd7Sr2Ni9O18-Dia and Nd7Sr2Ni9O18-Par unit cells. The spin density distributions demonstrated that magnetic disordering of the Ni atoms results in the magnetism decrease. The spin-polarized band structures indicated that the symmetry of the spin-up and spin-down energy bands around the Fermi levels also influence the total magnetic moments. Atom- and lm-projected PDOS as well as the band structures revealed that Ni(dx2-y2) is the main orbital intersecting the Fermi level. As a whole, electrons of Sr atoms tend to locate locally and hybridize weakly with the O atoms. They primarily help to build the infinite-layer structures, and influence the electronic structure near the Fermi level indirectly.

Ornithine decarboxylase functions in both autophagy and apoptosis in response to ultraviolet B radiation injury.

We present a mechanism for how ornithine decarboxylase (ODC) regulates the crosstalk between autophagy and apoptosis. In cancer cells, low-intensity ultraviolet B (UVBL ) induces autophagy while high-intensity UVB (UVBH ) induces apoptosis. Overexpression of ODC decreases UVBL -induced autophagy by inhibiting Atg5-Atg12 conjugation and suppressing the expression of autophagy markers LC3, Atg7, Atg12, and BECN1 proteins. In contrast, when ODC-overexpressing cells are exposed to UVBH radiation, the levels of LC3-II, Atg5-Atg12 conjugate, BECN1, Atg7, and Atg12 increase, while the apoptosis marker cleaved-PARP proteins decrease, indicating that ODC overexpression induced UVBH -induced autophagy but inhibited UVBH -induced cellular apoptosis. Additionally, when exposed to UVBH radiation, silencing BECN1, Atg5, and Atg12 genes results in a decrease in the level of LC3-II proteins but an increase in the level of cleaved-PARP proteins, and apoptotic bodies were significantly increased while autophagosomes were significantly decreased. These findings imply that ODC inhibits apoptosis in cells via the autophagy pathway. The role of Atg12 in ODC-overexpressing cells exposed to UVBH radiation is investigated using site-directed mutagenesis. Our results indicate that the Atg12-D111S mutant has increased cell survival. The Atg12-ΔG186 mutant impairs autophagy and enhances apoptosis. We demonstrate that when ODC-overexpressing cells are silenced for the Atg12 protein, autophagy and apoptosis are strongly affected, and ODC-induced autophagy protects against UVBH -induced apoptosis via the Atg12 protein.

CRL4AMBRA1 targets Elongin C for ubiquitination and degradation to modulate CRL5 signaling.

Multi-subunit cullin-RING ligases (CRLs) are the largest family of ubiquitin E3 ligases in humans. CRL activity is tightly regulated to prevent unintended substrate degradation or autocatalytic degradation of CRL subunits. Using a proteomics strategy, we discovered that CRL4AMBRA1 (CRL substrate receptor denoted in superscript) targets Elongin C (ELOC), the essential adapter protein of CRL5 complexes, for polyubiquitination and degradation. We showed that the ubiquitin ligase function of CRL4AMBRA1 is required to disrupt the assembly and attenuate the ligase activity of human CRL5SOCS3 and HIV-1 CRL5VIF complexes as AMBRA1 depletion leads to hyperactivation of both CRL5 complexes. Moreover, CRL4AMBRA1 modulates interleukin-6/STAT3 signaling and HIV-1 infectivity that are regulated by CRL5SOCS3 and CRL5VIF, respectively. Thus, by discovering a substrate of CRL4AMBRA1, ELOC, the shared adapter of CRL5 ubiquitin ligases, we uncovered a novel CRL cross-regulation pathway.

A novel electrochemical sensor based on autotropic and heterotrophic nitrifying biofilm for trichloroacetic acid toxicity monitoring.

Trichloroacetic acid (TCA), a toxic substance produced in the disinfection process of wastewater treatment plants, will accumulate in the receiving water. The detection of TCA in the water can achieve the purpose of early warning. However, currently there are few reports on microbial sensors used for TCA detection, and the characteristics of their microbial communities are still unclear. In this work, a toxicity monitoring microbial system (TMMS) with nitrifying biofilm as a sensing element and cathode oxygen reduction as a current signal was successfully constructed for TCA detection. The current and nitrification rate showed a linear relationship with low TCA concentration from 0 to 50 µg/L (R2current = 0.9892, R2nitrification = 0.9860), and high concentration range from 50 to 5000 µg/L (R2current = 0.9883, R2nitrification = 0.9721). High-throughput sequencing revealed that the TMMS was composed of autotrophic/heterotrophic nitrifying and denitrifying microorganisms. Further analysis via symbiotic relationship network demonstrated that Arenimonas and Hyphomicrobium were the core nodes for maintaining interaction between autotropic and heterotrophic nitrifying bacteria. Kyoto Encyclopedia of Genes and Genomes analysis showed that after adding TCA to TMMS, the carbon metabolism and the abundance of the tricarboxylic acid cycle pathway were reduced, and the activity of microorganisms was inhibited. TCA stress caused a low abundance of nitrifying and denitrifying functional enzymes, resulting in low oxygen consumption in the nitrification process, but more oxygen supply for cathode oxygen reduction. This work explored a novel sensor combined with electrochemistry and autotrophic/heterotrophic nitrification, which provided a new insight into the development of microbial monitoring of toxic substances.

Peptidylarginine deiminase 2 promotes T helper 17-like T cell activation and activated T cell-autonomous death (ACAD) through an endoplasmic reticulum stress and autophagy coupling mechanism.

Peptididylarginine deiminase type 2 (PADI2) catalyzes the conversion of arginine residues to citrulline residues on proteins. We demonstrate that PADI2 induces T cell activation and investigate how PADI2 promotes activated T cell autonomous death (ACAD). In activated Jurkat T cells, overexpression of PADI2 significantly increases citrullinated proteins and induces endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling, ultimately resulting in the expression of autophagy-related proteins and autophagy. PADI2 promoted autophagy and resulted in the early degradation of p62 and the light chain 3B (LC3B)-II accumulation. In Jurkat T cells, silencing the autophagy-related gene (Atg) 12 protein inhibits PADI2-mediated autophagy and promotes ER stress and apoptosis, whereas overexpression of Atg12 decreased ER stress and prolonged autophagy to promote cell survival. Additionally, PADI2 regulates T cell activation and the production of Th17 cytokines in Jurkat T cells (interleukins 6, IL-17A, IL-17F, IL-21, and IL-22). In Jurkat T cells, silencing IL-6 promotes autophagy mediated by PADI2 and inhibits PADI2-induced apoptosis, whereas silencing Beclin-1 increases the activation and survival of Th17-like T cells while decreasing autophagy and apoptosis. PADI2 silencing alleviates ER stress caused by PADI2 and decreases cytokine expression associated with Th17-like T cell activation and ACAD. We propose that PADI2 was involved in Th17 lymphocyte ACAD via a mechanism involving ER stress and autophagy that was tightly regulated by PADI2-mediated citrullination. These findings suggest that inhibiting Th17 T cell activation and the development of severe autoimmune diseases may be possible through the use of novel antagonists that specifically target PADI2.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Atmospheric gaseous organic acids in winter in a rural site of the North China Plain.

Organic acids are important contributors to the acidity of atmospheric precipitation, but their existence in the Chinese atmosphere is largely unclear. In this study, twelve atmospheric gaseous organic acids, including C1-C9 alkanoic acids, methacrylic acid, pyruvic acid, and benzoic acid, were observed in the suburb of Wangdu, Hebei Province, a typical rural site in the northern China plain from 16th December, 2018 to 22nd January, 2019, using a Vocus® Proton-Transfer-Reaction time-of-flight mass spectrometer (Vocus PTR-ToF). The quantification of C2-C4 alkanoic acids by the Vocus PTR-ToF was calibrated according to the titration of a NaOH solution by C2-C4 alkanoic acids from home-made permeation sources, and the other organic acids except for formic acid were quantified based on the kcap-sensitivity linearity in the Vocus PTR-ToF, whereas formic acid was not quantified because our instrument setting led to a significant underestimation in its concentration. The average total concentration of eleven gaseous organic acids was 6.96 ± 5.20 ppbv (parts per billion by volume). The average concentration of acetic acid was the highest (3.86 ± 3.00 ppbv), followed by propanoic acid, butyric acid, and methacrylic acid. Domestic straw burning was likely the dominant source of the observed gaseous organic acids according to the good correlations between acetonitrile and organic acids and between particulate K+ and organic acids, and traffic emissions could also have contributed. During episodes with continuously high concentrations of organic acids, short-distance transport dominated in Wangdu according to the backward trajectory analysis. Baoding, Shijiazhuang, and Hengshui areas were the main source areas based on potential source contribution function and concentration weighing track analysis.

Regulation of polyamine homeostasis through an antizyme citrullination pathway.

This study reveals an uncovered mechanism for the regulation of polyamine homeostasis through protein arginyl citrullination of antizyme (AZ), a natural inhibitor of ornithine decarboxylase (ODC). ODC is critical for the cellular production of polyamines. AZ binds to ODC dimers and promotes the degradation of ODC via the 26S proteasome. This study demonstrates the protein citrullination of AZ catalyzed by peptidylarginine deiminase type 4 (PAD4) both in vitro and in cells. Upon PAD4 activation, the AZ protein was citrullinated and accumulated, leading to higher levels of ODC proteins in the cell. In the PAD4-overexpressing and activating cells, the levels of ODC enzyme activity and the product putrescine increased with the level of citrullinated AZ proteins and PAD4 activity. Suppressing cellular PAD4 activity reduces the cellular levels of ODC and downregulates cellular polyamines. Furthermore, citrullination of AZ in the C-terminus attenuates AZ function in the inhibition, binding, and degradation of ODC. This paper provides evidence to illustrate that PAD4-mediated AZ citrullination upregulates cellular ODC and polyamines by retarding ODC degradation, thus interfering with the homeostasis of cellular polyamines, which may be an important pathway regulating AZ functions that is relevant to cancer biology.

Is reducing new particle formation a plausible solution to mitigate particulate air pollution in Beijing and other Chinese megacities?

Atmospheric gas-to-particle conversion is a crucial or even dominant contributor to haze formation in Chinese megacities in terms of aerosol number, surface area and mass. Based on our comprehensive observations in Beijing during 15 January 2018-31 March 2019, we are able to show that 80-90% of the aerosol mass (PM2.5) was formed via atmospheric reactions during the haze days and over 65% of the number concentration of haze particles resulted from new particle formation (NPF). Furthermore, the haze formation was faster when the subsequent growth of newly formed particles was enhanced. Our findings suggest that in practice almost all present-day haze episodes originate from NPF, mainly since the direct emission of primary particles in Beijing has considerably decreased during recent years. We also show that reducing the subsequent growth rate of freshly formed particles by a factor of 3-5 would delay the buildup of haze episodes by 1-3 days. Actually, this delay would decrease the length of each haze episode, so that the number of annual haze days could be approximately halved. Such improvement in air quality can be achieved with targeted reduction of gas-phase precursors for NPF, mainly dimethyl amine and ammonia, and further reductions of SO2 emissions. Furthermore, reduction of anthropogenic organic and inorganic precursor emissions would slow down the growth rate of newly-formed particles and consequently reduce the haze formation.

The Influence of Allogrooming Behavior on Individual Innate Immunity in the Subterranean Termite Reticulitermes chinensis (Isoptera: Rhinotermitidae).

Insect societies have evolved a series of disease defenses against pathogens, including social sanitary behavior and individual innate immunity. However, whether sanitary behavior can affect individual innate immunity remains unknown. Here, we exposed the termite Reticulitermes chinensis Snyder to the entomopathogenic fungus Metarhizium anisopliae (Metchnikoff) Sorokin(Ascomycota: Hypocreales), and then measured their allogrooming behavior, conidia load, infection mortality, antifungal activity and immune gene expressions . Our results showed that most of the fungal conidia were fast removed from the cuticles of the grouped termites by intensive allogrooming behavior, resulting in low mortality. The antifungal activity and immune gene expressions (termicin and transferrin) in grouped exposed termites were significantly lower than those in single exposed termite but not significantly different from those in unexposed treatments. These results suggest that allogrooming behavior can fast remove fungal conidia from termite cuticles and then decrease their physiological investment in individual innate immunity.

Secure Transmission in mmWave Wiretap Channels: On Sector Guard Zone and Blockages.

Millimeter-wave (mmWave) communication is one of the key enabling technologies for fifth generation (5G) mobile networks. In this paper, we study the problem of secure communication in a mmWave wiretap network, where directional beamforming and link blockages are taken into account. For the secure transmission in the presence of spatially random eavesdroppers, an adaptive transmission scheme is adopted, for which sector secrecy guard zone and artificial noise (AN) are employed to enhance secrecy performance. When there exists no eavesdroppers within the sector secrecy guard zone, the transmitter only transmits information-bearing signal, and, conversely, AN along with information-bearing signal are transmitted. The closed-form expressions for secrecy outage probability (SOP), connection outage probability (COP) and secrecy throughput are derived under stochastic geometry. Then, we evaluate the effect of the sector secrecy guard zone and AN on the secrecy performance. Our results reveal that the application of the sector secrecy guard zone and AN can significantly improve the security of the system, and blockages also can be utilized to improve secrecy performance. An easy choice of transmit power and power allocation factor is provided for achieving higher secrecy throughput. Furthermore, increasing the density of eavesdroppers not always deteriorates the secrecy performance due to the use of the sector secrecy guard zone and AN.

Error Analysis of the K-Rb-21Ne Comagnetometer Space-Stable Inertial Navigation System.

According to the application characteristics of the K-Rb-21Ne comagnetometer, a space-stable navigation mechanization is designed and the requirements of the comagnetometer prototype are presented. By analysing the error propagation rule of the space-stable Inertial Navigation System (INS), the three biases, the scale factor of the z-axis, and the misalignment of the x- and y-axis non-orthogonal with the z-axis, are confirmed to be the main error source. A numerical simulation of the mathematical model for each single error verified the theoretical analysis result of the system's error propagation rule. Thus, numerical simulation based on the semi-physical data result proves the feasibility of the navigation scheme proposed in this paper.