Transcription factor OsSHR2 regulates rice architecture and yield per plant in response to nitrogen.

MAIN CONCLUSION: Mutation of OsSHR2 adversely impacted root and shoot growth and impaired plant response to N conditions, further reducing the yield per plant. Nitrogen (N) is a crucial factor that regulates the plant architecture. There is still a lack of research on it. In our study, it was observed that the knockout of the SHORTROOT 2 (OsSHR2) which was induced by N deficiency, can significantly affect the regulation of plant architecture response to N in rice. Under N deficiency, the mutation of OsSHR2 significantly reduced root growth, and impaired the sensitivity of the root meristem length to N deficiency. The mutants were found to have approximately a 15% reduction in plant height compared to wild type. But mutants showed a significant increase in tillering at post-heading stage, approximately 26% more than the wild type, particularly in high N conditions. In addition, due to reduced seed setting rate and 1000-grain weight, mutant yield was significantly decreased by approximately 33% under low N fertilizer supply. The mutation also changed the distribution of N between the vegetative and reproductive organs. Our findings suggest that the transcription factor OsSHR2 plays a regulatory role in the response of plant architecture and yield per plant to N in rice.

An interlaboratory capillary zone electrophoresis-UV study of various monoclonal antibodies, instruments, and ε-aminocaproic acid lots.

Capillary zone electrophoresis ultraviolet (CZE-UV) has become increasingly popular for the charge heterogeneity determination of mAbs and vaccines. The ε-aminocaproic acid (eACA) CZE-UV method has been used as a rapid platform method. However, in the last years, several issues have been observed, for example, loss in electrophoretic resolution or baseline drifts. Evaluating the role of eACA on the reported issues, various laboratories were requested to provide their routinely used eACA CZE-UV methods, and background electrolyte compositions. Although every laboratory claimed to use the He et al. eACA CZE-UV method, most methods actually deviate from He's. Subsequently, a detailed interlaboratory study was designed wherein two commercially available mAbs (Waters' Mass Check Standard mAb [pI 7] and NISTmAb [pI 9]) were provided to each laboratory, along with two detailed eACA CZE-UV protocols for a short-end, high-speed, and a long-end, high-resolution method. Ten laboratories participated each using their own instruments, and commodities, showing excellence method performance (relative standard deviations [RSDs] of percent time-corrected main peak areas from 0.2% to 1.9%, and RSDs of migration times from 0.7% to 1.8% [n = 50 per laboratory], analysis times in some cases as short as 2.5 min). This study clarified that eACA is not the main reason for the abovementioned variations.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Trichoderma guizhouense NJAU4742 augments morphophysiological responses, nutrient availability and photosynthetic efficacy of ornamental Ilex verticillata.

Winterberry holly (Ilex verticillata [L.] A. Gray), a deciduous shrub producing glossy bright red berries, is a valuable ornamental and medicinal plant with good market prospects. However, the growth and development of I. verticillata are significantly affected by various stresses, and environmentally hazardous agrochemicals are often used to mitigate them. Trichoderma spp., ubiquitous soil-borne eco-friendly plant growth-promoting fungi, are potent biostimulants and biofertilizers and viable alternatives to agrochemicals for healthy and sustainable agriculture. In this study, the temporal efficacy of different dosages of the filamentous fungus Trichoderma guizhouense NJAU4742 in promoting morphophysiological responses of I. verticillata and the physicochemical properties and enzymatic activities of the substrate were investigated. Different concentrations of the strain T. guizhouense NJAU4742 spore suspension (C [0%], T1 [5%, v/m], T2 [10%, v/m] and T3 [15%, v/m]) were injected in the substrate contained in a pot in which 1-year-old I. verticillata was planted for temporal treatment (15, 45 and 75 days) under open-air conditions. The beneficial effects of T2 and/or T3 treatment for a long duration (75 days) were evident on the different root, aerial and photosynthetic traits; total contents of nitrogen (N), phosphorus (P) and potassium (K) in different tissues and the physicochemical properties of the substrate and its enzymatic activities (urease and invertase). Overall, the study revealed the potency of strain T. guizhouense NJAU4742 as a sustainable solution to improve the growth and development and ornamental value of I. verticillata.

Bivalent non-human gal-α1-3-gal glycan epitopes in the Fc region of a monoclonal antibody model can be recognized by anti-Gal-α1-3-Gal IgE antibodies.

Monoclonal antibody (mAb) production using non-human cells can introduce non-human glycan epitopes including terminal galactosyl-α1-3-galactose (α1-3-Gal) moieties. Cetuximab is a commercial mAb associated with causing anaphylaxis in some patients due to the binding of endogenous anti-α1-3-Gal IgE to the Fab (containing bi-α1-3-galactosylated glycans) but not to the Fc region (containing mono-α1-3-galactosylated glycans). Despite being low in abundance in typical commercial mAbs, the inherent sensitivity of cell culture conditions on glycosylation profiles, and the development of novel glycoengineering strategies, novel antibody-based modalities, and biosimilars by various manufacturers with varying procedures, necessitates a better understanding of the structural requirements for anti-α1-3-Gal IgE binding to the Fc region. Herein, we synthesized mAb glycoforms with varying degrees and regioisomers of α1-3-galactosylation and tested their binding to two commercial anti-α1-3-Gal human IgE antibodies derived from a human patient with allergies to red meat (comprising α1-3-Gal epitopes), as well as to the FcγRIIIA receptor. Our results demonstrate that unexpectedly, anti-α1-3-Gal human IgE antibodies can bind to Fc glycans, with bi-α1-3-galactosylation being the most important factor, highlighting that their presence in the Fc region may be considered as a potential critical quality attribute, particularly when using novel platforms in mAb-based biotherapeutics.

Regulatory Verification by Health Canada of Content in Recombinant Human Insulin, Human Insulin Analog, and Porcine Insulin Drug Products in the Canadian Market Using Validated Pharmacopoeial Methods Over Nonvalidated Approaches.

BACKGROUND: For diabetes mellitus treatment plans, the consistency and quality of insulin drug products are crucial for patient well-being. Because biologic drugs, such as insulin, are complex heterogeneous products, the methods for drug product evaluation should be carefully validated for use. As such, these criteria are rigorously evaluated and monitored by national authorities. Consequently, reports that describe significantly lower insulin content than their label claims are a concern. This issue was raised by a past publication analyzing insulin drug products available in Canada, and, as a result, consumers and major patient organizations have requested clarification. METHODS: To address these concerns, this study independently analyzed insulin drug products purchased from local Canadian pharmacies-including human insulin, insulin analogs, and porcine insulin-by compendial and noncompendial reversed-phase high-performance liquid chromatography (RP-HPLC) methods. RESULTS: We demonstrated the importance of using methods fit for purpose when assessing insulin quality. In a preliminary screen, the expected insulin peak was seen in all products except two insulin analogs-insulin detemir and insulin degludec. Further investigation showed that this was not caused by low insulin content but insufficient solvent conditions, which demonstrated the necessity for methods to be adequately validated for product-specific use. When drug products were appropriately assessed for content using the validated type-specific compendial RP-HPLC methods for insulin quantitation, values agreed with the label claim content. CONCLUSIONS: Because insulin drug products are used daily by over a million Canadians, it is important that researchers and journals present data using methods fit for purpose and that readers evaluate such reports critically.

Strategies for the production of isotopically labelled Fab fragments of therapeutic antibodies in Komagataella phaffii (Pichia pastoris) and Escherichia coli for NMR studies.

The importance and fast growth of therapeutic monoclonal antibodies, both innovator and biosimilar products, have triggered the need for the development of characterization methods at high resolution such as nuclear magnetic resonance (NMR) spectroscopy. However, the full power of NMR spectroscopy cannot be unleashed without labelling the mAb of interest with NMR-active isotopes. Here, we present strategies using either Komagataella phaffii (Pichia pastoris) or Escherichia coli that can be widely applied for the production of the antigen-binding fragment (Fab) of therapeutic antibodies of immunoglobulin G1 kappa isotype. The E. coli approach consists of expressing Fab fragments as a single polypeptide chain with a cleavable linker between the heavy and light chain in inclusion bodies, while K. phaffii secretes a properly folded fragment in the culture media. After optimization, the protocol yielded 10-45 mg of single chain adalimumab-Fab, trastuzumab-Fab, rituximab-Fab, and NISTmAb-Fab per liter of culture. Comparison of the 2D-1H-15N-HSQC spectra of each Fab fragment, without their polyhistidine tag and linker, with the corresponding Fab from the innovator product showed that all four fragments have folded into the correct conformation. Production of 2H-13C-15N-adalimumab-scFab and 2H-13C-15N-trastuzumab-scFab (>98% enrichment for all three isotopes) yielded NMR samples where all amide deuterons have completely exchanged back to proton during the refolding procedure.

A focused immune response targeting the homotypic binding domain of the carcinoembryonic antigen blocks the establishment of tumor foci in vivo.

Metastatic forms of cancers remain the main cause of death in cancer patients. In this study, we demonstrate that directing a sustained antibody response towards the homotypic binding function of CEA interferes with the implantation and development of tumor foci in CEA-expressing transgenic (CEA.Tg) mice. Specifically, vaccinating CEA.Tg mice with a recombinant, altered self-form of the CEA Ig V-like N domain led to the production of circulating IgG1 and IgG2a antibodies that inhibited CEA-mediated adhesion of murine carcinoma expressing CEA (MC38.CEA) and mediated antibody-dependent lysis of tumor cells. Moreover, vaccinated CEA.Tg mice were resistant to the development of tumor nodules in the lungs and the peritoneal cavity, suggesting that mounting a focused antibody response to the CEA N domain may represent a simple therapeutic strategy to control the establishment of metastatic foci in cancer patients.

Can China's national Five-Year Plan for environmental protection induce corporate green innovations?

This study investigates the effect of China's national Five-Year Plan for environmental protection (FYPEP) on corporate green innovations based on the two-way fixed effect model and panel data about the green patents of China's publicly listed corporations during 1990-2020. Furthermore, the heterogeneity of these green innovations is further discussed with reference to the types of innovation, enterprise ownership, and the location of the corporations. It is found that FYPEP significantly induced corporation green innovations at regional and industrial levels. Heterogeneity analysis indicates that the inductive effect of FYPEP is stronger on green utility model patents than on green invention patents. State-owned enterprises react to green innovation policies more significantly than do private businesses. The inductive effect of FYPEP is stronger in Eastern China than in mid- and Western China. From the perspective of government intervention, this research renders a new framework for the formulation of policies of national environmental protection and corporate green innovation.

Selective reversed-phase high-performance liquid chromatography method for the determination of intact SARS-CoV-2 spike protein.

Protein-based vaccines are playing an increasingly important role in the COVID-19 pandemic. As late-stage clinical data are finalized and released, the number of protein-based vaccines expected to enter the market will increase significantly. Most protein-based COVID-19 vaccines are based on the SARS-CoV-2 spike protein (S-protein), which plays a major role in viral attachment to human cells and infection. As a result, in order to develop and manufacture quality vaccines consistently, it is imperative to have access to selective and efficient methods for the bioanalytical assessment of S-protein. In this study, samples of recombinant S-protein (hexS-protein) and commercial S-protein were used to develop a selective reversed-phase HPLC (RP-HPLC) method that enabled elution of the intact S-protein monomer as a single peak on a wide pore, C8-bonded chromatographic column. The S-protein subunits, S1 and S2 subunits, were clearly separated from intact S-protein and identified. The results of this study set the foundation for reversed-phase HPLC method development and analysis for selective and efficient separation of S-protein monomer from its subunits.

Identification of a New Badnavirus in the Chinaberry (Melia azedarach) Tree and Establishment of a LAMP-LFD Assay for Its Rapid and Visual Detection.

The Chinaberry tree, a member of the Meliaceae family, is cultivated in China for use in traditional medicines. In 2020, Chinaberry trees with leaf deformation symptoms were found in Hangzhou, Zhejiang province, China. In order to identify possible pathogenic viruses, a symptomatic sample was subjected to deep sequencing of small interfering RNAs. Assembly of the resulting sequences led to the identification of a novel badnavirus, provisionally designated Chinaberry tree badnavirus 1 (ChTBV1). With the recent development of China's seedling industry and increasing online shopping platforms, the risk of tree virus transmission has increased substantially. Therefore, it is important to detect the occurrence of ChTBV1 to ensure the safety of the Chinaberry tree seedling industry. Here, we describe the development and validation of a sensitive and robust method relying on a loop-mediated isothermal amplification (LAMP) assay, targeting a 197 nt region, to detect ChTBV1 from Chinaberry tree leaves. The LAMP assay was also adapted for rapid visualization of results by a lateral flow dipstick chromatographic detection method.

Intramolecular cross-linking of proteins with azobenzene-based cross-linkers.

The photo-control of protein activity can often be achieved via the photo-control of protein structure. Intramolecular cross-linkers that change length upon photoisomerization provide a means to photo-control protein structure by linking to pairs of Cys residues in a protein sequence. In this protocol, we describe general methods for introducing intramolecular cross-linkers, both UV light switchable and red-light switchable, under either denaturing or native conditions.

A Yeast System for Discovering Optogenetic Inhibitors of Eukaryotic Translation Initiation.

The precise spatiotemporal regulation of protein synthesis is essential for many complex biological processes such as memory formation, embryonic development, and tumor formation. Current methods used to study protein synthesis offer only a limited degree of spatiotemporal control. Optogenetic methods, in contrast, offer the prospect of controlling protein synthesis noninvasively within minutes and with a spatial scale as small as a single synapse. Here, we present a hybrid yeast system where growth depends on the activity of human eukaryotic initiation factor 4E (eIF4E) that is suitable for screening optogenetic designs for the down-regulation of protein synthesis. We used this system to screen a diverse initial panel of 15 constructs designed to couple a light switchable domain (PYP, RsLOV, AsLOV, Dronpa) to 4EBP2 (eukaryotic initiation factor 4E binding protein 2), a native inhibitor of translation initiation. We identified cLIPS1 (circularly permuted LOV inhibitor of protein synthesis 1), a fusion of a segment of 4EBP2 and a circularly permuted version of the LOV2 domain from Avena sativa, as a photoactivated inhibitor of translation. Adapting the screen for higher throughput, we tested small libraries of cLIPS1 variants and found cLIPS2, a construct with an improved degree of optical control. We show that these constructs can both inhibit translation in yeast harboring a human eIF4E in vivo, and bind human eIF4E in vitro in a light-dependent manner. This hybrid yeast system thus provides a convenient way for discovering optogenetic constructs that can regulate human eIF4E-dependent translation initiation in a mechanistically defined manner.

Photoswitchable affinity reagents: Computational design and efficient red-light switching.

Photo-controlled affinity reagents seek to provide modular spatiotemporal control of bioactivity by conferring photo-switchability of function on an affinity reagent scaffold. Here we used Rosetta-based computational methods to screen for sites on the Fynomer affinity reagent structure for attachment of photoswitchable cross-linkers. Both established UV-based cross-linkers (azobenzene-iodoacetamide (IAC)) and an azonium-based efficient red light switchable cross-linker, piperazino-tetra-ortho-methoxy azobenzene (PIP), were then tested experimentally. Several sites compatible with Fynomer function were identified, including sites showing rapid (<10s) red light (633 nm) modulation of function. While a range of overall target binding affinities were observed, the degree of photo-switchability of Fynomer function was generally small (<2-fold). Computational models suggest that local flexibility limits the degree of switching seen in these designs.