Bosutinib shows low cross intolerance, in chronic myeloid leukemia patients treated in fourth line. Results of the Spanish compassionate use program.

The role of bosutinib as rescue treatment of Philadelphia chromosome-positive chronic myeloid leukemia (CML) patients after failing three previous tyrosine kinase inhibitors (TKIs) is currently unknown. We report here the largest series (to our knowledge) of patients treated with bosutinib in fourth-line, after retrospectively reviewing 30 patients in chronic phase, and pretreated with imatinib, nilotinib, and dasatinib. With a median follow up of 11.1 months, the probability to either maintain or improve their CCyR response was 56.6% (17/30) and 11 patients (36.7%) achieved or maintained their baseline MMR. In patients not having baseline CCyR, the probabilities of obtaining CCyR, MMR, and MR4.5 were 13, 11, and 14%, respectively. The probabilities of obtaining MMR and deep molecular response MR4.5 in patients with baseline CCyR were 40.0% (6/15) and 20.0% (3/15). At 20 months, progression-free survival was 73%. Grade 3-4 hematological toxicities were more frequent in resistant than intolerant patients (45.4 vs. 0.0%). Nonhematological toxicities were also more frequent in resistant patients, being diarrhea the most conspicuous one. Bosutinib seems to be an appropriate treatment option for patients resistant or intolerant to three prior TKI's.

Do chronic myeloid leukemia patients with late "warning" responses benefit from "watch and wait" or switching therapy to a second generation tyrosine kinase inhibitor?

In the latest recommendations for the management of chronic-phase chronic myeloid leukemia suboptimal responses have been reclassified as "warning responses." In contrast to previous recommendations current guidance advises close monitoring without changing therapy. We have identified 198 patients treated with first-line imatinib, with a warning response after 12 months of treatment (patients with a complete cytogenetic response but no major molecular response [MMR]). One hundred and forty-six patients remained on imatinib, while 52 patients changed treatment to a second generation tyrosine kinase inhibitor (2GTKI). Changing therapy did not correlate with an increase in overall survival or progression-free survival. Nevertheless, a significant improvement was observed in the probability of a MMR: 24% vs. 42% by 12 months and 43% vs. 64% by 24 months (P = 0.002); as well as the probability of achieving a deep molecular responses (MR(4.5) ): 1% vs. 17% and 7% vs. 23% by 12 and 24 months, respectively (P = <0.001) .The treatment change to 2GTKI remained safe; however, we have observed a 19% of treatment discontinuation due to side effects. We have observed an improvement of molecular responses after changing treatment to 2GTKI in patients with late suboptimal response treated with imatinib first line. However, these benefits were not correlated with an improvement of progression free survival or overall survival.

Genomic actions of 1,25-dihydroxyvitamin D3 on insulin receptor gene expression, insulin receptor number and insulin activity in the kidney, liver and adipose tissue of streptozotocin-induced diabetic rats.

BACKGROUND: this study set out to examine the effects of the treatment with 1,25-dihydroxyvitamin D3 (1,25D3) [150 IU/Kg (3.75 microg/Kg) one a day, for 15 days] to non-diabetic rats and in rats rendered diabetic by a single injection of streptozotocin [65 mg/kg]. RESULTS: treatment with 1,25D3 to non-diabetic rats did not affect the biochemical parameters measured in the plasma and urine of these animals. Likewise, insulin receptor expression in the kidney, liver, or adipose tissue and insulin-stimulated glucose transport in adipocytes from these animals were not affected either. Treatment with 1,25D3 to streptozotocin-induced diabetic rats did not correct the hyperglycemia, hypoinsulinemia, glycosuria or ketonemia induced by the diabetes, although it partially reversed the over-expression of the insulin receptor gene in the liver and adipose tissue, without altering the normal expression of this gene in the kidney. These effects were accompanied by a normalization of the number of insulin receptors without altering receptor affinity but improving the insulin response to glucose transport in adipocytes from these diabetic animals. Moreover, a computer search in the rat insulin receptor promoter revealed the existence of two candidate vitamin D response element (VDRE) sequences located at -256/-219 bp and -653/-620 bp, the first overlapped by three and the second by four AP-2-like sites. CONCLUSION: these genomic actions of 1,25D3 could represent beneficial effects associated with the amelioration of diabetes via mechanisms that possibly involve direct transcriptional activation of the rat insulin receptor gene. The candidate VDREs identified may respond to 1,25D3 via activation of the vitamin D receptor, although this remains to be investigated.

CB1 receptor blockade reduces the anxiogenic-like response and ameliorates the neurochemical imbalances associated with alcohol withdrawal in rats.

There is strong evidence that blocking CB1 receptors may reduce alcohol intake in alcohol-dependent individuals. However, there is still limited evidence that CB1 receptor antagonists may also be beneficial in the attenuation of alcohol withdrawal syndrome, even though alcohol withdrawal appears to be milder in CB1 receptor knockout mice. Here we have examined whether the CB1 receptor antagonist rimonabant (SR141716) can alleviate the behavioral symptoms and revert the neurochemical imbalance elicited by a 3-h interruption of chronic alcohol exposure (7.2% in the drinking water for 10 days) in male Wistar rats. Administration of rimonabant attenuated the strong anxiogenic traits of the animals that developed when regular alcohol intake was interrupted. This may reflect the correction of the GABA/glutamate imbalances developed by the animals that received rimonabant in various brain regions involved in emotional (e.g. prefrontal cortex) and motor (e.g. caudate-putamen and globus pallidus) responses. In addition, rimonabant also affected the dopamine deficits generated by alcohol abstinence in the amygdala and ventral-tegmental area, albeit to a lesser extent. However, this antagonist was unable to correct the impairment caused by alcohol abstinence in serotonin and neuropeptide Y. The endocannabinoid activity in the brain of alcohol-abstinent rats indicated that the behavioral and neurochemical improvements caused by rimonabant were not related to the attenuation of a possible increase in this activity generated by alcohol withdrawal. Conversely, the density of CB1 receptors was reduced in alcohol-abstinent animals (e.g. globus pallidus, substantia nigra), as were the levels of endocannabinoids and related N-acylethanolamines (e.g. amygdala, caudate-putamen). Thus, rimonabant possibly enhances an endogenous response generated by interrupting the regular use of alcohol. In summary, rimonabant might attenuate withdrawal symptoms associated with alcohol abstinence, an effect that was presumably due to the normalization of GABA and glutamate, and to a lesser extent, dopamine transmission in emotion- and motor-related areas.

Switching to second-generation tyrosine kinase inhibitor improves the response and outcome of frontline imatinib-treated patients with chronic myeloid leukemia with more than 10% of BCR-ABL/ABL ratio at 3 months.

Chronic myeloid leukemia patients display heterogeneous responses to imatinib. Survival depends on baseline clinical characteristics (including prognostic scoring systems) and on early response (such as >10% BCR-ABL/ABL ratio at 3 months of therapy). The results of switching to second-generation tyrosine kinase inhibitors (2GTKIs) may contain a bias since, in the majority of these studies, patients who switch treatment due to intolerance or failure are censored or excluded. We analyzed the Spanish Registry data on switching in an intention-to-treat analysis of patients in standard clinical practice. Switching to 2GTKIs improves responses from 45% to 75% of complete cytogenetic response (CCyR) and from 15% to 45% of major molecular response (MMR) in the group without molecular response 1 (MR1) at 3 months and from 70% to 87% in CCyR and from 52% to 87% in MMR in the group with MR1. The final response rate is poorer in the group with no MR1 at 3 months. Nevertheless, the differences in the rates of response were not translated into differences in major events (transformations or deaths), and the final progression-free survival and overall survival were similar.

Transcriptional inhibition of the human insulin receptor gene by aldosterone.

In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding and insulin responsiveness in U-937 human promonocytic cells treated with aldosterone. The mechanism for this inhibition could be diminished IR gene transcription, since aldosterone did not affect hIR mRNA stability. All the effects were mediated by a downregulation of the mineralocorticoid receptor (MR, NR3C2) expressed at both the RNA and protein levels, suggesting that MR could act as a transcription factor that binds to hormone response elements in the hIR gene promoter. Indeed, MR has been shown to bind glucocorticoid response elements (GREs) in target genes. Given that five GREs have been characterized in the hIR promoter, we decided to test whether these elements could mediate the aldosterone-elicited inhibition of hIR expression detected by us in U-937 cells. In the present report, we demonstrate that aldosterone inhibits the activity of the hIR wild-type promoter by 23%, and causes 23 and 31% reductions in the activity of progressive deletions of this promoter comprised of fragments up to -1473 and -876bp, respectively. This indicates that the -876 to -271bp region of the hIR promoter may be sufficient for this transcriptional inhibition by aldosterone. We also provide evidence for direct MR interaction with some of the GREs of this promoter region, specifically with the cGRE1 and cGRE3, presumably as MR-MR homodimers, and with pGRE as a MR-GR heterodimer. This heterodimer may play the most relevant role and participate in the cross-talk between mineralocorticoids, glucocorticoids and insulin signalling in U-937 cells.

Identification of a Vitamin D response element in the human insulin receptor gene promoter.

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.