Efficacy and safety of methylphenidate on attention deficit hyperactivity disorder in children with Down syndrome.

BACKGROUND: Attention deficit hyperactivity disorder (ADHD) is a common co-morbidity that affects up to 44% of children with Down syndrome (DS). There is a need for reliable, good quality research on the use of methylphenidate within this population. The objective of this study is to report our experience regarding the management of ADHD in these children using methylphenidate. METHODS: This study is a retrospective observation of 21 children with DS, followed at Jérôme Lejeune Institute between 2000 and 2018. The diagnosis of ADHD was made using the Diagnostic and Statistical Manual of Mental Disorders criteria. Efficacy was measured as response or non-response on two main symptoms: attention/concentration and hyperactivity/impulsivity. Safety was evaluated by the presence or absence of side effects. RESULTS: Sixteen out of the 21 children (76%) showed improvement with methylphenidate. The average age of treatment onset in responding children was 8 years and 10 months versus 6 years and 3 months in non-responders (P = 0.05). Average dose/weight was significantly different in responders and non-responders (0.82 vs. 0.54 mg/kg/day, respectively; P = 0.03). Twelve children out of 21 (57%) experienced side effects; only three experienced side effects severe enough to require treatment interruption. Most common side effects were loss of appetite and difficulties in falling asleep. CONCLUSION: Methylphenidate was effective and safe in treating ADHD in 76% of cases in children with DS, with few serious side effects to report. Early diagnosis of ADHD is important to improve the quality of life, learning, inclusion and socialisation of children with DS.

Homozygous mutation in ELMO2 may cause Ramon syndrome.

We report on a girl, born to first cousin Lebanese parents, with intellectual disability, seizures, repeated gingivorrhagia, enlarged lower and upper jaws, overgrowth of the gums, high arched and narrow palate, crowded teeth, hirsutism of the back, large abdomen and a small umbilical hernia. Cysts of the mandible, fibrous dysplasia of bones, and enlarged adenoids causing around 60% narrowing of the nasopharyngeal airways were noted at radiographic examination. Her brother presented with the same features in addition to a short stature, an ostium secundum, and more pronounced intellectual disability. He died at the age of 8 years from a severe pulmonary infection and repeated bleeding episodes. A clinical diagnosis of Ramon syndrome was made. Whole exome sequencing studies performed on the family revealed the presence of a novel homozygous missense mutation in ELMO2 gene, p.I606S in the affected individuals. Loss of function mutations in ELMO2 have been recently described in another clinically distinct condition: primary intraosseous vascular malformation or intraosseous hemangioma, called VMOS. Review of the literature and differential diagnoses are discussed.

Search for ReCQL4 mutations in 39 patients genotyped for suspected Rothmund-Thomson/Baller-Gerold syndromes.

Three overlapping conditions, namely Rothmund-Thomson (RTS), Baller-Gerold (BGS) and RAPADILINO syndromes, have been attributed to RECQL4 mutations. Differential diagnoses depend on the clinical presentation, but the numbers of known genes remain low, leading to the widespread prescription of RECQL4 sequencing. The aim of our study was therefore to determine the best clinical indicators for the presence of RECQL4 mutations in a series of 39 patients referred for RECQL4 molecular analysis and belonging to the RTS (27 cases) and BGS (12 cases) spectrum. One or two deleterious RECQL4 mutations were found in 10/27 patients referred for RTS diagnosis. Clinical and molecular reevaluation led to a different diagnosis in 7/17 negative cases, including Clericuzio-type poikiloderma with neutropenia, hereditary sclerosing poikiloderma, and craniosynostosis/anal anomalies/porokeratosis. No RECQL4 mutations were found in the BGS group without poikiloderma, confirming that RECQL4 sequencing was not indicated in this phenotype. One chromosomal abnormality and one TWIST mutation was found in this cohort. This study highlights the search for differential diagnoses before the prescription of RECQL4 sequencing in this clinically heterogeneous group. The combination of clinically defined subgroups and next-generation sequencing will hopefully bring to light new molecular bases of syndromes with poikiloderma, as well as BGS without poikiloderma.

Systematic molecular and cytogenetic screening of 100 patients with marfanoid syndromes and intellectual disability.

The association of marfanoid habitus (MH) and intellectual disability (ID) has been reported in the literature, with overlapping presentations and genetic heterogeneity. A hundred patients (71 males and 29 females) with a MH and ID were recruited. Custom-designed 244K array-CGH (Agilent®; Agilent Technologies Inc., Santa Clara, CA) and MED12, ZDHHC9, UPF3B, FBN1, TGFBR1 and TGFBR2 sequencing analyses were performed. Eighty patients could be classified as isolated MH and ID: 12 chromosomal imbalances, 1 FBN1 mutation and 1 possibly pathogenic MED12 mutation were found (17%). Twenty patients could be classified as ID with other extra-skeletal features of the Marfan syndrome (MFS) spectrum: 4 pathogenic FBN1 mutations and 4 chromosomal imbalances were found (2 patients with both FBN1 mutation and chromosomal rearrangement) (29%). These results suggest either that there are more loci with genes yet to be discovered or that MH can also be a relatively non-specific feature of patients with ID. The search for aortic complications is mandatory even if MH is associated with ID since FBN1 mutations or rearrangements were found in some patients. The excess of males is in favour of the involvement of other X-linked genes. Although it was impossible to make a diagnosis in 80% of patients, these results will improve genetic counselling in families.

Identification of the gene altered in Berardinelli-Seip congenital lipodystrophy on chromosome 11q13.

Congenital generalized lipodystrophy, or Berardinelli-Seip syndrome (BSCL), is a rare autosomal recessive disease characterized by a near-absence of adipose tissue from birth or early infancy and severe insulin resistance. Other clinical and biological features include acanthosis nigricans, hyperandrogenism, muscular hypertrophy, hepatomegaly, altered glucose tolerance or diabetes mellitus, and hypertriglyceridemia. A locus (BSCL1) has been mapped to 9q34 with evidence of heterogeneity. Here, we report a genome screen of nine BSCL families from two geographical clusters (in Lebanon and Norway). We identified a new disease locus, designated BSCL2, within the 2.5-Mb interval flanked by markers D11S4076 and D11S480 on chromosome 11q13. Analysis of 20 additional families of various ethnic origins led to the identification of 11 families in which the disease cosegregates with the 11q13 locus; the remaining families provide confirmation of linkage to 9q34. Sequence analysis of genes located in the 11q13 interval disclosed mutations in a gene homologous to the murine guanine nucleotide-binding protein (G protein), gamma3-linked gene (Gng3lg) in all BSCL2-linked families. BSCL2 is most highly expressed in brain and testis and encodes a protein (which we have called seipin) of unknown function. Most of the variants are null mutations and probably result in a severe disruption of the protein. These findings are of general importance for understanding the molecular mechanisms underlying regulation of body fat distribution and insulin resistance.

A novel deletion in ZBTB24 in a Lebanese family with immunodeficiency, centromeric instability, and facial anomalies syndrome type 2.

The immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disease characterized by targeted chromosome breakage, directly related to a genomic methylation defect. It manifests with phenotypic and clinical variability, with the most consistent features being developmental delay, facial anomalies, cytogenetic defects and immunodeficiency with a reduction in serum immunoglobulin levels. From the molecular point of view, ICF syndrome was always divided into ICF type I (ICF1) and ICF type 2 (ICF2). Mutations in DNMT3B gene are responsible for ICF1, while mutations in ZBTB24 have been reported to be responsible for ICF2. In this study, we describe a Lebanese family with three ICF2 affected brothers. Sanger sequencing of the coding sequence of ZBTB24 gene was conducted and revealed a novel deletion: c.396_397delTA (p.His132Glnfs*19), resulting in a loss-of-function of the corresponding protein. ZBTB24 belongs to a large family of transcriptional factors and may be involved in DNA methylation of juxtacentromeric DNA. Detailed molecular and functional studies of the ZBTB24 and DNMT3B genes are needed to understand the pathophysiology of ICF syndrome.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

Identification of 28 novel mutations in the Bardet-Biedl syndrome genes: the burden of private mutations in an extensively heterogeneous disease.

Bardet-Biedl syndrome (BBS), an emblematic disease in the rapidly evolving field of ciliopathies, is characterized by pleiotropic clinical features and extensive genetic heterogeneity. To date, 14 BBS genes have been identified, 3 of which have been found mutated only in a single BBS family each (BBS11/TRIM32, BBS13/MKS1 and BBS14/MKS4/NPHP6). Previous reports of systematic mutation detection in large cohorts of BBS families (n > 90) have dealt only with a single gene, or at most small subsets of the known BBS genes. Here we report extensive analysis of a cohort of 174 BBS families for 12/14 genes, leading to the identification of 28 novel mutations. Two pathogenic mutations in a single gene have been found in 117 families, and a single heterozygous mutation in 17 families (of which 8 involve the BBS1 recurrent mutation, M390R). We confirm that BBS1 and BBS10 are the most frequently mutated genes, followed by BBS12. No mutations have been found in BBS11/TRIM32, the identification of which as a BBS gene only relies on a single missense mutation in a single consanguineous family. While a third variant allele has been observed in a few families, they are in most cases missenses of uncertain pathogenicity, contrasting with the type of mutations observed as two alleles in a single gene. We discuss the various strategies for diagnostic mutation detection, including homozygosity mapping and targeted arrays for the detection of previously reported mutations.

Stüve-Wiedemann syndrome: long-term follow-up and genetic heterogeneity.

Stüve-Wiedemann syndrome (SWS, OMIM 601559) is a severe autosomal recessive condition caused by mutations in the leukemia inhibitory receptor (LIFR) gene. The main characteristic features are bowing of the long bones, neonatal respiratory distress, swallowing/sucking difficulties and dysautonomia symptoms including temperature instability often leading to death in the first years of life. We report here four patients with SWS who have survived beyond 36 months of age with no LIFR mutation. These patients have been compared with six unreported SWS survivors carrying null LIFR mutations. We provide evidence of clinical homogeneity of the syndrome in spite of the genetic heterogeneity.

Recessive osteogenesis imperfecta caused by LEPRE1 mutations: clinical documentation and identification of the splice form responsible for prolyl 3-hydroxylation.

BACKGROUND: Recessive forms of osteogenesis imperfecta (OI) may be caused by mutations in LEPRE1, encoding prolyl 3-hydroxylase-1 (P3H1) or in CRTAP, encoding cartilage associated protein. These proteins constitute together with cyclophilin B (CyPB) the prolyl 3-hydroxylation complex that hydroxylates the Pro986 residue in both the type I and type II collagen alpha1-chains. METHODS: We screened LEPRE1, CRTAP and PPIB (encoding CyPB) in a European/Middle Eastern cohort of 20 lethal/severe OI patients without a type I collagen mutation. RESULTS: Four novel homozygous and compound heterozygous mutations were identified in LEPRE1 in four probands. Two probands survived the neonatal period, including one patient who is the eldest reported patient (17 7/12 years) so far with P3H1 deficiency. At birth, clinical and radiologic features were hardly distinguishable from those in patients with autosomal dominant (AD) severe/lethal OI. Follow-up data reveal that the longer lived patients develop a severe osteochondrodysplasia that overlaps with, but has some distinctive features from, AD OI. A new splice site mutation was identified in two of the four probands, affecting only one of three LEPRE1 mRNA splice forms, detected in this study. The affected splice form encodes a 736 amino acid (AA) protein with a "KDEL" endoplasmic reticulum retention signal. While western blotting and immunocytochemical analysis of fibroblast cultures revealed absence of this P3H1 protein, mass spectrometry and SDS-urea-PAGE data showed severe reduction of alpha1(I)Pro986 3-hydroxylation and overmodification of type I (pro)collagen chains in skin fibroblasts of the patients. CONCLUSION: These findings suggest that the 3-hydroxylation function of P3H1 is restricted to the 736AA splice form.

Feeding problems and gastrointestinal diseases in Down syndrome.

BACKGROUND AND METHOD: Feeding problems and gastrointestinal disorders are the most common anomalies in people with Down syndrome (DS) and have a significant impact on their daily life. This study lists the various anomalies on the basis of 504 references selected from a PubMed search in October 2018. RESULTS: The anomalies are grouped into three categories: anatomical anomalies: duodenal atresia and stenosis (3.9%), duodenal web and annular pancreas; aberrant right subclavian artery (12% of children with DS with cardiac anomaly); Hirschsprung's disease (2.76%); anorectal malformation (1.16%); congenital vascular malformations of the liver; orofacial cleft, bifid uvula (4.63%), and submucous orofacial cleft; esophageal atresia (0.5-0.9%); pyloric stenosis (0.3%); diaphragmatic hernia; malrotation of small intestine or duodenum inversum; omphalocele, gastroschisis or anomalies of the median line, anomalies of the umbilical vein; biological, immunological, and infectious anomalies: neonatal cholestasis (3.9%); neonatal hepatic fibrosis; Helicobacter pylori infection (75.8% in institutionalized children with DS, between 29.2 and 19.5% in non-institutionalized); non-alcoholic fatty liver disease (NAFLD; 82% in obese and 45% in non-obese); biliary lithiasis (6.9% under 3 years); celiac disease (6.,6%); geographical tongue (4%); hepatitis B virus sensitivity; autoimmune hepatitis and cholangitis; Crohn's disease, inflammatory bowel disease (IBD); pancreatitis; vitamin D deficiency (45.2% in Italy); functional disorders: suction, swallowing and chewing disorders (13 of 19 children with DS under 4 years); gastroesophageal reflux (47% in children with sleep apnea); achalasia (0,5% in adults); obesity (51.6% of males and 40.0% of females in Ireland) and overweight (32.0% and 14.8%); constipation (19.0%). Based on their practice, the authors insist on the following points: malformations are sometimes detected late (chronic vomiting after the introduction of food pieces, resistant constipation despite appropriate measures); prescription of preventive doses of vitamin D is advised; jaundice in a baby with DS may be retentional; in the event of transient leukemoid reaction it is vital to monitor liver function; the patient with geographic tongue must be reassured; for celiac serology there is no consensus on the staring age and the frequency, we propose every year from the age of 2; we advise to test people with DS for H. pylori infection if they are attending specialized institutions; abdominal ultrasounds must be systematic during the first months of life; detection of NAFLD is recommended; people with DS must be vaccinated against hepatitis B; breastfeeding is possible with maternal support; it is important to start speech therapy very early; feeding difficulties are often overlooked by the family and educators; gastroesophageal reflux is often pathological; preventing obesity must start from birth using body mass index for the general population; it is necessary to do everything for their meals to be joyful.

A novel locus for autosomal recessive primary torsion dystonia (DYT17) maps to 20p11.22-q13.12.

Primary torsion dystonia is a clinically and genetically heterogeneous group of movement disorders. Fifteen different types of dystonia have been described to date, of whom 14 loci have been mapped, but only seven genes identified. Several different modes of inheritance have been described, including autosomal dominant transmission with reduced penetrance (12 loci), recessive X-linked (one locus), and autosomal recessive transmission (three loci). In this study, we describe the localization of a novel form of autosomal recessive, primary focal torsion dystonia using a genomewide search in a large consanguineous Lebanese family with three affected individuals. Homozygosity mapping with 382 microsatellite markers was conducted. Linkage analysis and haplotype construction allowed us to identify a novel locus designated as DYT17, within a 20.5-Mb interval on chromosome 20. Of the 270 known genes spread on this interval, 27 candidate genes were tested and excluded as responsible for the disease. Fine mapping by identification of other dystonia families linked to chromosome 20 and sequencing of candidate genes in the refined interval is required in order to identify the causative gene in DYT17.

Molecular analysis of F8 in Lebanese haemophilia A patients: novel mutations and phenotype-genotype correlation.

Haemophilia A (HA) is an X-linked recessive hereditary bleeding disorder affecting one in 5000 men, resulting from mutations in the F8 gene. Our objective was to identify the spectrum of mutations of the F8 gene in Lebanese patients, and to perform genotype/phenotype correlations. A group of 79 HA patients from 55 unrelated families was studied. Patients were screened for intron 22 and intron 1 inversion using PCR. In the absence of mutations in both introns, a dHPLC screening followed by a DNA sequencing of all coding regions was performed. When patients presented novel mutations, 150 control chromosomes were tested to exclude common polymorphisms. Large deletions were confirmed by MLPA technique. The mRNA was specifically studied whenever a splice site mutation was detected. In addition, studies of the putative biochemical function and FVIII 3D structures were conducted. Thirty-four mutations were identified in this study of which 21 were novel: 11 missense, two nonsense, two splice sites, five small deletions and one large deletion. Inhibitor found in three over 75 patients correlated with large deletion, intron 22 inversion, and nonsense mutations. We were able to identify all causative mutations in those HA patients. This knowledge represents a huge step for genetic counselling.

International cooperation in the expansion of a newborn screening programme in Lebanon: a possible model for other programmes.

Tandem mass spectrometry (MS/MS) is rapidly gaining support, even in less-developed nations, as the method of choice for the newborn screening of metabolic disorders, although difficulties in acquiring this technology may at times be major obstacles in several Middle East and North Africa (MENA) countries. In Lebanon, international cooperation allowed this acquisition at the Newborn Screening Laboratory (NSL) of the Saint Joseph University (USJ) in the capital city of Beirut. NSL is currently screening up to 20% of all newborns in Lebanon. The expansion was made possible through initial collaboration with the Metabolic Laboratory at the Hamburg University Medical Center (HUMC) and subsequently with other centres. During phase I of the expansion (2006-2007), blood spots were shipped to HUMC with rapid couriers twice a week and electronic reports were sent back generally within 4 days after shipment. Positive cases were recalled to NSL and new specimens were sent back for confirmation at HUMC. During that first phase, the Beirut staff received training at the HUMC and in other centres. Phase II was a transitory period of 4 months during which machines were installed in Beirut and working procedures were adopted and documented. The activity has now entered a consolidation phase (Phase III) in which all measurements are exclusively performed in Beirut while HUMC acts as a backup centre. International cooperation remains crucial for periodic quality assurance procedures, and for supporting the transformation of the USJ-NSL into a training centre able to transfer MS/MS technology to the MENA region.

[Mirror hand deformity: a new phenotype with literature review]. / Main en miroir: une nouvelle forme avec revue de la littérature.

We report the case of a child who presented polydactyly with eight triphalangeal fingers, no thumb or radius and ulnar dimelia. Hand, wrist, forearm and elbow function was compromised, particularly due to wrist stiffness in flexion, the absence of forearm pronation supination and severe limitation of elbow motion. In addition, the child underwent surgery for pyloric hypertrophy and also presented a multicystic kidney. We present the clinical, anatomic, electromyographic, genetic and therapeutic aspects of this rare deformity and discuss data presented in the literature.

Mutation screening in Borjeson-Forssman-Lehmann syndrome: identification of a novel de novo PHF6 mutation in a female patient.

BACKGROUND: Börjeson-Forssman-Lehmann syndrome (BFLS; MIM 301900) is an infrequently described X linked disorder caused by mutations in PHF6, a novel zinc finger gene of unknown function. OBJECTIVE: To present the results of mutation screening in individuals referred for PHF6 testing and discuss the value of prior X-inactivation testing in the mothers of these individuals. RESULTS: 25 unrelated individuals were screened (24 male, one female). Five PHF6 mutations were detected, two of which (c.940A-->G and c.27_28insA) were novel. One of these new mutations, c.27_28insA, was identified in a female BFLS patient. This was shown to be a de novo mutation arising on the paternal chromosome. This is the first report of a clinically diagnosed BFLS female with a confirmed PHF6 mutation. In addition, the X-inactivation status of the mothers of 19 males with suggested clinical diagnosis of BFLS was determined. Skewed (> or =70%) X-inactivation was present in five mothers, three of whom had sons in whom a PHF6 mutation was detected. The mutation positive female also showed skewing. CONCLUSIONS: The results indicate that the success of PHF6 screening in males suspected of having BFLS is markedly increased if there is a positive family history and/or skewed X-inactivation is found in the mother.

Revisiting the craniosynostosis-radial ray hypoplasia association: Baller-Gerold syndrome caused by mutations in the RECQL4 gene.

Baller-Gerold syndrome (BGS) is a rare autosomal recessive condition with radial aplasia/hypoplasia and craniosynostosis (OMIM 218600). Of >20 cases reported so far, a few appear atypical and have been reassigned to other nosologic entities, including Fanconi anaemia, Roberts SC phocomelia, and Pfeiffer syndromes after demonstration of corresponding cytogenetic or molecular abnormalities. Clinical overlap between BGS, Rothmund-Thomson syndrome (RTS), and RAPADILINO syndrome is noticeable. Because patients with RAPADILINO syndrome and a subset of patients with RTS have RECQL4 mutations, we reassessed two previously reported BGS families and found causal mutations in RECQL4 in both. In the first family, four affected offspring had craniosynostosis and radial defect and one of them developed poikiloderma. In this family, compound heterozygosity for a R1021W missense mutation and a g.2886delT frameshift mutation of exon 9 was found. In the second family, the affected male had craniosynostosis, radial ray defect, poikiloderma, and short stature. He had a homozygous splice site mutation (IVS17-2A>C). In both families, the affected offspring had craniosynostosis, radial defects, and growth retardation, and two developed poikiloderma. Our results confirm that BGS in a subgroup of patients is due to RECQL4 mutations and could be integrated into a clinical spectrum that encompasses RTS and RAPADILINO syndrome.

DNMT3B mutations and DNA methylation defect define two types of ICF syndrome.

ICF syndrome is a rare autosomal recessive disease characterized by variable immunodeficiency, centromeric instability, and facial abnormalities. Mutations in the catalytic domain of DNMT3B, a gene encoding a de novo DNA methyltransferase, have been recognized in a subset of patients. ICF syndrome is a genetic disease directly related to a genomic methylation defect that mainly affects classical satellites 2 and 3, both components of constitutive heterochromatin. The variable incidence of DNMT3B mutations and the differential methylation defect of alpha satellites allow the identification of two types of patients, both showing an undermethylation of classical satellite DNA. This classification illustrates the specificity of the methylation process and raises questions about the genetic heterogeneity of the ICF syndrome.

Homozygosity mapping of a Dyggve-Melchior-Clausen syndrome gene to chromosome 18q21.1.

Dyggve-Melchior-Clausen syndrome (DMC) is an autosomal recessive condition characterised by short trunk dwarfism, scoliosis, microcephaly, coarse facies, mental retardation, and characteristic radiological features. X rays show platyspondyly with double vertebral hump, epiphyseal dysplasia, irregular metaphyses, and a characteristic lacy appearance of the iliac crests. Electron microscopy of chondrocytes have shown widened cisternae of rough endoplasmic reticulum and biochemical analyses have shown accumulation of glucosaminoglycan in cartilage, but the pathogenesis of DMC remains unexplained. Here, we report on the homozygosity mapping of a DMC gene to chromosome 18q21.1 in seven inbred families (Zmax=9.65 at theta=0 at locus D18S1126) in the genetic interval (1.8 cM) defined by loci D18S455 and D18S363. Despite the various geographical origins of the families reported here (Morocco, Tunisia, Portugal, and Lebanon), this condition was genetically homogeneous in our series. Continuing studies will hopefully lead to the identification of the disease causing gene.

Genotype-phenotype relationships in Berardinelli-Seip congenital lipodystrophy.

Generalised lipodystrophy of the Berardinelli-Seip type (BSCL) is a rare autosomal recessive human disorder with severe adverse metabolic consequences. A gene on chromosome 9 (BSCL1) has recently been identified, predominantly in African-American families. More recently, mutations in a previously undescribed gene of unknown function (BSCL2) on chromosome 11, termed seipin, have been found to be responsible for this disorder in a number of European and Middle Eastern families. We have studied the genotype/phenotype relationships in 70 affected subjects from 44 apparently unrelated pedigrees of diverse ethnic origin. In all subjects, hepatic dysfunction, hyperlipidaemia, diabetes mellitus, and hypertrophic cardiomyopathy were significant contributors to morbidity with no clear differences in their prevalence between subjects with BSCL1 or BSCL2 and those with evidence against cosegregation with either chromosome 9 or 11 (designated BSCLX). BSCL2 appears to be a more severe disorder than BSCL1 with a higher incidence of premature death and a lower prevalence of partial and/or delayed onset of lipodystrophy. Notably, subjects with BSCL2 had a significantly higher prevalence of intellectual impairment than those with BSCL1 or BSCLX (p<0.0001, OR 17.0, CI 3.6 to 79.0). The higher prevalence of intellectual impairment and the increased risk of premature death in BSCL2 compared to BSCL1 emphasise the importance of molecular diagnosis of this syndrome and have clear implications for genetic counselling.