Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 80
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Phys Chem Chem Phys ; 24(8): 4925-4934, 2022 Feb 23.
Artigo em Inglês | MEDLINE | ID: mdl-35137749

RESUMO

A series of polycrystalline NiCr2-xAlxO4 (0.1 ≤ x ≤ 0.25) spinel ceramics have been synthesized using a sol-gel method. DC magnetization measurements are carried out at different temperatures and magnetic fields. A novel magnetization reversal has been observed in the field cooling process for the x = 0.2 sample, which can be ascribed to the competition between two magnetic sublattices due to their different temperature dependences. The magnetic interaction evolution, related to the complex magnetic properties, is revealed by exchange constants that have been estimated according to ferrimagnetic Curie-Weiss fitting and mean field theory. The fitting result confirmed the evolution of antiferromagnetic and ferromagnetic components with Al substitution, which is supported by the observations from the isothermal magnetization measurements. The positive and negative values of the magnetic moment can be utilized for storage applications based on the results of magnetic switching effect measurements.

2.
Zhonghua Zhong Liu Za Zhi ; 43(11): 1148-1155, 2021 Nov 23.
Artigo em Zh | MEDLINE | ID: mdl-34794216

RESUMO

Objective: To investigate the effects of lncRNA LINC00839 on the proliferation, migration and invasion of hepatocellular carcinoma cells and its mechanism. Methods: Real-time quantitative polymerase chain reaction (RT-qPCR) was used to detect the expression of LINC00839 and miR-3666 in hepatocellular carcinoma tissues and adjacent tissues. Pearson correlation was used to analyze the correlation between LINC00839 and miR-3666 expression in liver cancer tissues. Hepatocellular carcinoma cells MHCC97H were cultured in vitro and divided into si-NC group, si-LINC00839 group, miR-NC group, miR-3666 group, si-LINC00839+ anti-miR-NC group, and si-LINC00839+ anti-miR-3666 group. Methylthiazoletrazolium (MTT) method and clone formation experiment were used to detect cell proliferation. Transwell array was used to detect the cell migration and invasion. Western blot was used to detect the protein expressions of p21, E-cadherin and MMP-2. The double luciferase reporter gene experiment was used to verify the regulatory relationship between LINC00839 and miR-3666. Results: Compared with adjacent tissues, the expression level of LINC00839 in hepatocellular carcinoma tissues increased (2.82±0.27 vs. 0.96±0.10, P<0.001), but the expression level of miR-3666 decreased (0.23±0.02 vs. 1.01±0.10, P<0.001). The expression levels of LINC00839 and miR-3666 in liver cancer tissue were negatively correlated (r=-0.658, P<0.001). The survival rate of MHCC97H cells in the si-LINC00839 group [(53.91±5.41)% vs. (100.53±10.22)%], the number of clones formed (92.0±8.0 vs. 164.0±14.3), the number of migration (131.0±12.7 vs. 247.0±22.4), the number of invasion (66.0±6.4 vs. 120.0±11.6) and the protein level of MMP-2 (0.20±0.02 vs. 0.67±0.06) were lower than those in the si-NC group (P<0.001). However, the protein levels of p21 (0.76±0.07 vs. 0.25±0.02) and E-cadherin (0.78±0.08 vs. 0.14±0.01) were higher than those in the si-NC group (P<0.001). LINC00839 targeted and negatively regulated the expression of miR-3666. The survival rate of MHCC97-H cells in the miR-3666 group [(47.93±4.86)% vs. (100.11±10.21)%], the number of clone formation (78.0±7.7 vs. 166.0±15.9), the number of migration (117.0±12.1 vs. 250.0±25.0), the number of invasion (57.0±5.7 vs. 121.0±12.3) and the protein level of MMP-2 (0.16±0.01 vs. 0.69±0.07) were lower than those in the miR-NC group (all P<0.001). However, the protein levels of p21 (0.83±0.08 vs. 0.24±0.02) and E-cadherin (0.87±0.09 vs. 0.13±0.01)were higher than those in the miR-NC group (all P<0.001). The survival rate of MHCC97-H cells in the si-LINC00839+ anti-miR-3666 group [(89.94±9.05)% vs. (54.12±5.39)%], the number of clones (143.0±13.8 vs. 94.0±9.4), the number of migration (208.0±19.8 vs. 129.0±12.6), the number of invasion (108.0±10.1 vs. 65.0±6.4) and the protein level of MMP-2 (0.31±0.03 vs 0.66±0.06) were higher than those in the si-LINC00839+ anti-miR-NC group (P<0.001). However, the protein levels of p21 (0.31±0.03 vs. 0.74±0.07) and E-cadherin (0.28±0.03 vs. 0.80±0.08) were lower than those int the si-LINC00839+ anti-miR-NC group (P<0.001). Conclusion: Inhibition of LINC00839 expression may inhibit the proliferation, migration and invasion of hepatocellular carcinoma cells by targeting up-regulation of miR-3666 expression.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , MicroRNAs , Carcinoma Hepatocelular/genética , Linhagem Celular Tumoral , Movimento Celular , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/genética , MicroRNAs/genética
3.
Phys Chem Chem Phys ; 22(13): 7058-7064, 2020 Apr 06.
Artigo em Inglês | MEDLINE | ID: mdl-32196030

RESUMO

Polycrystalline Co2Ti1-xCrxO4 (0 ≤ x ≤ 0.2) inverse spinel ceramics have been synthesized via a sol-gel technique. The dc magnetization measurement in the field-cooled mode shows that negative magnetization could be observed until x reaches 0.2. The exchange constants are calculated using the ferrimagnetic Curie-Weiss fitting and the mean-field theory. This reveals that the strength of the inter sublattice magnetic interaction presents a non-monotonic trend with the increase in Cr content and reaches the minimum at x = 0.1, giving rise to the highest compensation temperature in the x = 0.1 sample. The applicability of the x = 0.1 sample is investigated in light of two prominent magnetic effects: (i) the stable magnetic switching effect indicates the potential applications in magnetic switching and data storage and (ii) the coexistence of normal and inverse magnetocaloric effects suggests a potential application in a constant temperature bath at 54 K.

4.
Zhonghua Yi Xue Za Zhi ; 100(17): 1341-1344, 2020 May 05.
Artigo em Zh | MEDLINE | ID: mdl-32375444

RESUMO

Objective: To investigate the effect of sleep fragmentation on perioperative neurocognitive disorders (PND) and central neuroinflammation by simulating sleep patterns of postoperative patients with sleep fragmentation in aged mice. Methods: Thirty-two elderly ICR mice were randomly divided into four groups (n=8): normal group (C), surgery group (S), fragmented sleep group (F), and surgery+fragmented sleep group (D). Fragmented sleep was conducted after internal fixation of tibia fractures, cognitive function was evaluated by novel object recognition (NOR) and fear conditioning (FC) test, and changes in expression of inflammatory cytokines in hippocampus were detected by ELISA. Results: NOR test: the recognition index (RI) of mice in group C, group S, group F and group D was 0.69±0.07, 0.48±0.07, 0.54±0.10 and 0.50±0.12, respectively. The RI of mice in group S, group F and group D was significantly lower than that in group C (t=4.885, 3.521 and 4.433, all P<0.01). There was no significant difference in RI between group S and group D (t=0.967 1, P>0.05). Contextual FC test: the freezing time of mice in group C, group S, group F and group D was(21.34±6.48), (13.83±4.26), (11.50±6.25) and (6.17±4.77) s, respectively. The freezing time of mice in group S, group F and group D was significantly lower than that in group C (t=2.722, 3.566, 5.496, P<0.05 or P<0.01). The freezing time of mice in group D was significantly lower than that in group S (t=2.774, P<0.05). Cue FC test: the freezing time of mice in group C, group S, group F and group D was (74.36±17.09), (43.91±9.71), (46.34±13.43) and (24.90±14.21) s, respectively. The freezing time of mice in group S, group F and group D was significantly lower than that in group C (t=4.393, 4.043 and 7.136, all P<0.01). The freezing time of mice in group D was significantly lower than that in group S (t=2.743, P<0.05). The levels of TNF-α, IL-6 and IL-1ß in hippocampus of mice in group S, F and D were significantly higher than those in group C, while the levels of TNF-α and IL-6 in hippocampus of mice in group D were significantly higher than those in group S, with statistically significant differences (P<0.05 or P<0.01). Conclusion: Postoperative fragmented sleep aggravates postoperative cognitive impairment and increases the hippocampal neuroinflammation in aged mice.


Assuntos
Transtornos Cognitivos , Cognição , Envelhecimento , Animais , Medo , Hipocampo , Camundongos , Camundongos Endogâmicos ICR
5.
Zhongguo Zhong Yao Za Zhi ; 45(19): 4598-4605, 2020 Oct.
Artigo em Zh | MEDLINE | ID: mdl-33164423

RESUMO

The soil fertility quality is one of the most critical indicators of soil productivity. It directly affects the yield, quality and agricultural efficiency of Chinese medicinal materials. In order to establish the American ginseng planting soil fertility quality evaluation method based on the effective components of American ginseng, Wendeng district, Weihai city, Shandong province, the main producing area of American ginseng, was cited as a case for the study. Twenty-two 4-years American ginseng sampling sites are located at 7 towns. The samples of soil and plant root were collected in the autumn of 2017-2019. The saponin contents of American ginseng and 11 soil chemical properties were measured. The minimum data set(MDS) for assessment of the quality of soil fertility quality was established by correlation analysis and principal component analysis. The evaluation indexes were normalized by membership function. Soil quality index(SQI) that indicates soil comprehensive fertility quality level was calculated according to the critical value of membership function and weight value of each soil index in MDS. The results showed that the total saponin(Rg_1+Re+Rb_1) content of American ginseng in samples ranged from 1.76% to 7.94%. The yield of 8 plots in 2019 ranged from 3 818.7 kg·hm~(-2) to 8 996.4 kg·hm~(-2). MDS includes organic matter, alkaline nitrogen, exchangeable calcium, exchangeable magnesium, effective iron, effective copper, and effective zinc. Based on the mean of 4.825% of total saponin, threshold value of SQI for the region was determined to be 0.15, and 86.36% of soil samples in the county were above the threshold value. The methods and parameters are applicable to selection of high quality American ginseng planting sites and guiding rational fertilization. It also provides a reference for the evaluation of soil fertility quality of other medicinal plants.


Assuntos
Panax , Plantas Medicinais , Agricultura , Nitrogênio/análise , Solo
6.
Zhonghua Yi Xue Za Zhi ; 99(26): 2047-2051, 2019 Jul 09.
Artigo em Zh | MEDLINE | ID: mdl-31315375

RESUMO

Objective: To investigate the applicability of the modified memory sub-test of syndrom kurz test (SKT-M) in middle-aged and elderly Chinese. Methods: Between March 1, 2017, and October 31, 2017, at HwaMei Hospital, 132 patients receiving elective great saphenous vein high ligation and stripping operation and 96 their accompanying dependents, 55-75 years old, were randomly divided into the SKT-M group (n=121) and auditory verbal learning test -huashan version (AVLT-H) group (n=107) using random numeral method. The two groups underwent two corresponding neuropsychological tests respectively on the day before surgery and the second day after surgery. Results: There was no significant difference in the baseline characteristics and all the neuropsychological indices at the two time points between patients and dependents (P>0.05). As a consequence, the data of the patients and dependents were integrated to compare the applicability of SKT-M and AVLT-H. The "low-score" ratio of SKT-M immediate recall (2.4%) was lower than that of AVLT-H test (12.1%) (χ(2)=8.138, P<0.01). Besides, the "low-score" ratio of SKT-M delayed recall (5.7%) was also lower than that of AVLT-H test (20.5%) (χ(2)=11.167, P<0.01). The influence factors of SKT-M were less than that of AVLT-H test. However, the learning effect of SKT-M immediate recall was more significant, for its first testing sore (23.1±5.4) was significantly higher than the second one (21.9±5.1) (t=-3.971, P<0.001). Conclusion: The SKT-M has better applicability to 55-75 years old Chinese than AVLT-H test, but its learning effect should be noted.


Assuntos
Memória de Curto Prazo , Aprendizagem Verbal , Idoso , Povo Asiático , Humanos , Pessoa de Meia-Idade , Testes Neuropsicológicos
7.
Zhonghua Yi Xue Za Zhi ; 98(46): 3773-3777, 2018 Dec 11.
Artigo em Zh | MEDLINE | ID: mdl-30541220

RESUMO

Objective: To investigate effects of two anesthesia methods on the first night sleep quality in middle-aged and elderly patients after surgery. Methods: This was a prospective study conducted from November 2017 to March 2018. Sixty patients, aged 50-70, undergoing elective surgery for unilateral lower extremity varicose vein at Ningbo No.2 Hospital, with American Society of Anesthesiologists (ASA) grade Ⅰ or Ⅱ, were enrolled and randomly allocated to two groups (n=30), general anesthesia group and spinal anesthesia group. On the first day before surgery, the patient's general data were collected and the Pittsburgh sleep quality index (PSQI) was used to assess the patient's sleep status in the past month. The postoperative mean arterial pressure (MAP), heart rate (HR) and pulse oxygen saturation (SpO(2)) in the ward were recorded with a multi-function monitor on first night after surgery. The total sleep time and arousal time were obtained by bispectral index (BIS) monitoring from 20: 00 (the first day) to 6: 00 (the second day). Athens Insomnia Scale (AIS) was recorded at 18: 00 at the second day after surgery. Results: There was no significant difference in general data and PSQI scale scores between the two groups of patients (all P>0.05). And there were no significant differences in MAP, HR, SpO(2) and BIS every 2 hours between the two groups from 20: 00 (the first day) to 6: 00 (the second day)(all P>0.05). Compared with the general anesthesia group, the first night of total sleep time in the spinal anesthesia group was significantly shorter[(357.2±83.4)min vs (275.1±64.8)min, t=-9.635, P<0.05], while the rate of wakefulness, total sleep time, overall sleep quality, daytime mood and daytime physical function were significantly higher[(25.9%, 22.2%, 25.9%, 18.5%18.5%) vs (51.7%, 51.7%, 55.2%, 48.3%44.8%), χ(2)=3.901, 5.192, 4.941, 5.523 and 4.437, all P<0.05], and the cases of postoperative urinary retention and lower limb discomfort were significantly higher[(8 and 6) vs (1 and 0), all P<0.05]. Conclusion: Both anesthesia methods can be safely and effectively applied to middle-aged and elderly patients with lower extremity varicose veins surgery, but patients with general anesthesia show fewer adverse reactions on the first night after surgery and have better sleep quality.


Assuntos
Anestesia Geral , Idoso , Frequência Cardíaca , Humanos , Extremidade Inferior , Pessoa de Meia-Idade , Estudos Prospectivos , Varizes
8.
Zhonghua Yi Xue Za Zhi ; 98(23): 1844-1848, 2018 Jun 19.
Artigo em Zh | MEDLINE | ID: mdl-29925167

RESUMO

Objective: To observe the clinical characteristics of thoracolumbar vertebral fracture cascade, analyze the relationship between the baseline fractures and the subsequent fractures and compare the distribution differences of subsequent fractures following vertebral augmentation or non-operation. Methods: From July 2012 to August 2016, 1 363 patients admitted to the First Affiliated Hospital of Soochow University with vertebral augmentation for the treatment of vertebral fractures were retrospectively analyzed.There were 190 cases of vertebral fracture cascade, 160 females and 30 males, with an average age of (74±9) years.The location and sequence of all vertebral fractures were recorded.The relationships between the baseline and the subsequent fractures were analyzed.According to different treatment on the baseline vertebral fractures, 190 cases were divided into vertebral augmentation group and non-operation group.The distribution differences of the subsequent fractures following vertebral augmentation and non-operation were compared with chi-square test. Results: Vertebral fracture cascade mainly located in the thoracolumbar spine T(11)-L(2) with an incidence of 52.0%.According to the direction of fracture development, the fracture cascade could be divided into up, down, centrifugation and concentration, and the incidence was 39.8%, 39.2%, 8.4% and 12.6%, respectively.The closer the vertebral body to the baseline fractures, the subsequent fractures incidence was higher.For distance with zero, one, two, three and four vertebrae, the incidence of subsequent vertebral fractures was 36.5%, 26.2%, 15.2%, 11.5% and 3.7%, respectively.A linear relationship was found between the subsequent fractures and the baseline fractures with a correlation coefficient of 0.90.The distribution difference of subsequent fractures between vertebral augmentation and non-operation group was not significant (χ(2)=17.16, P>0.05). Conclusions: The main directions of vertebral fracture cascade is up or down spiral development.The closer the vertebral body to the baseline fractures, the subsequent fractures incidence is higher.Vertebral augmentation doesn't affect the distribution of subsequent fractures.


Assuntos
Fraturas da Coluna Vertebral , Idoso , Idoso de 80 Anos ou mais , Feminino , Fixação Interna de Fraturas , Humanos , Vértebras Lombares , Masculino , Estudos Retrospectivos , Vértebras Torácicas
9.
Zhonghua Yi Xue Za Zhi ; 98(14): 1103-1108, 2018 Apr 10.
Artigo em Zh | MEDLINE | ID: mdl-29690724

RESUMO

Objective: To explore the effect of berberine on chronic inflammatory pain and the comorbid depression and the associated mechanisms. Methods: Forty healthy male ICR mice (2 months, 25-30 g) were used in the present study. The chronic inflammatory pain was induced by intraplantar injection of complete freund's adjuvant (CFA) to the hind paws. All animals were divided into 4 groups (n=10 for each group) according to random number table: the saline group (group A), the chronic pain group (group B), the saline+ berberine group (group C) and the chronic pain+ berberine group (group D). The baseline data of pain and depressive performance were measured on the day before any drug treatment.On d1, mice of B and D groups received intraplantar injections of 50 µl CFA emulsion (1∶1 diluted with saline); mice of A and C groups received intraplantar injections of the same volume of saline. During d15-d21, mice of C and D groups received intraperitoneal injections of berberine (50 mg/kg, daily for 7 days); mice of A and B groups received the equal volume of saline. The Hargreaves tests and the Von Frey tests were conducted before the injection of CFA and on d7, d14, d17 and d21 to measure the thermal and mechanical pain thresholds. The forced swimming tests and novelty-suppressed feeding tests were performed before the injection of CFA and on d21 to measure the depressive performance. After the behavioral tests, the levels of inflammatory cytokines interleukin-1ß (IL-1ß), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α) at the lumbar (L4-L5) spinal cord were examined by enzyme-linked immunosorbent assay(ELISA). The mRNA level of chemokine C-C motif ligand 2 (CCL2) in the lumbar spinal cord was examined by quantitative real-time polymerase chain reaction(qRT-PCR). Results: Compared with group A, the thermal withdrawal latency of group B mice on d7, d14, d17, d21 was declined[(3.40±0.67)s vs (10.55±1.58)s, (7.49±1.04)s vs (11.47±1.92)s, (6.46±0.56)s vs (11.60±1.86)s, (6.04±0.54)s vs (10.33±1.59)s, all P<0.01], and the mechanical threshold was also decreased[(0.15±0.03)g vs (0.78±0.24)g, (0.23±0.12)g vs (0.60±0.16)g, (0.30±0.12)g vs (0.72±0.25)g, (0.40±0.00)g vs (0.72±0.19)g, all P<0.01], on d21 the immobility time was increased[(161.60±35.79)s vs (88.92±53.24)s , P<0.05]and the time of feeding latency was decreased[(227.40±57.5)s vs (77.25±26.45)s, P<0.01], suggesting that CFA could induce hyperalgesia and depression. After berberine treatment (daily for 7 days), compared with group B, the thermal withdrawal latency of group D mice was increased[(9.99±2.68)s vs (6.04±0.54)s, P<0.01], the mechanical threshold was elevated[(0.80±0.21)g vs (0.40±0.00)g, P<0.01], the immobility time was decreased[(92.97±44.31)s vs (161.60±35.79)s, P<0.05], and the feeding latency was declined[(105.00±50.00)s vs (227.40±57.5)s, P<0.01]. Compared with group A, the concentrations of spinal IL-1ß, IL-6 and TNF-α in group B were increased[(29.90±4.87)pg/ml vs (21.00±5.46)pg/ml, (131.10±26.12)pg/ml vs (60.68±23.47)pg/ml, (21.54±4.93)pg/ml vs (11.39±3.66) pg/ml , all P<0.01], the mRNA level of CCL2 was upregulated[(2.21±0.60) vs (1.00±0.37), P<0.01]. After berberine treatment (daily for 7 days), compared with group B, the concentrations of IL-1ß, IL-6 and TNF-α in group D were decreased[(19.44±4.83)pg/ml vs (29.90±4.87) pg/ml , (57.82±32.28)pg/ml vs (131.10±26.12)pg/ml , (9.29±2.46)pg/ml vs (21.54±4.93) pg/ml, all P<0.01], the mRNA level of CCL2 was downregulated[(1.33±0.40)vs (2.21±0.60), P<0.05]. Conclusion: Berberine can reverse chronic inflammatory pain induced by CFA and alleviated the comorbid depression. Its anti-nociceptive and anti-depressive effects may associate with downregulation of the spinal levels of the inflammatory cytokines and mRNA transcription of CCL2.


Assuntos
Berberina/farmacologia , Dor Crônica/tratamento farmacológico , Citocinas/metabolismo , Depressão/tratamento farmacológico , Animais , Quimiocinas , Citocinas/efeitos dos fármacos , Transtorno Depressivo , Regulação para Baixo , Ensaio de Imunoadsorção Enzimática , Adjuvante de Freund , Hiperalgesia , Inflamação , Interleucina-1beta , Interleucina-6 , Masculino , Camundongos , Camundongos Endogâmicos ICR , Medição da Dor , Limiar da Dor , RNA Mensageiro , Reação em Cadeia da Polimerase em Tempo Real , Medula Espinal , Fator de Necrose Tumoral alfa , Regulação para Cima
10.
Orthod Craniofac Res ; 20 Suppl 1: 100-105, 2017 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-28643923

RESUMO

OBJECTIVE: Correlating mechanical forces with quantifiable physical changes in the dentoalveolar complex. SETTING AND SAMPLE POPULATION: Male 6-week C57BL/6 mice (N=3), micro X-ray-computed tomography; post-analysis software to extract physical changes in periodontal ligament (PDL)-space. MATERIALS AND METHODS: Silicone-elastic bands were placed between maxillary molars for 1 week, with the contralateral side as internal control. Average displacements between crowns and roots, and changes in PDL-spaces were evaluated by registering X-ray tomograms of experimental and control hemi-maxillae. Histology illustrated mineral formation and resorption-related events within narrowed and widened volumes of the PDL-space. RESULTS: 3D maps of changes in PDL-space between molars illustrated coronal and root displacements of 640 µm and 180 µm, respectively, compared to 70 µm in controls. Orthodontic tooth movement (OTM) specimens exhibited an average net change of -20 µm in narrowed and +30 µm in widened PDL-spaces. Bone and cementum were affected by the force on molars, and primary cementum was more affected than secondary cementum. CONCLUSIONS: This novel approach illustrates the importance of 3D-imaging and analysing 3D alveolar socket subjected to OTM otherwise omitted by 2D micrographs. A measured force on the crown elicits a response related to narrowed and widened regions in the 3D complex. OTM that exceeds PDL-space can illicit biological responses that attempt to restore physiologic PDL-space via remodelling of the periodontium. Regenerated weaker bone due to aseptic inflammation caused by orthodontics could leave patients at a higher risk of bone loss or root resorption if they later develop periodontitis, a form of septic inflammation.


Assuntos
Ligamento Periodontal/fisiologia , Coroa do Dente , Técnicas de Movimentação Dentária/métodos , Animais , Fenômenos Biomecânicos , Cemento Dentário/fisiologia , Análise do Estresse Dentário , Imageamento Tridimensional , Masculino , Maxila , Camundongos , Camundongos Endogâmicos C57BL , Ligamento Periodontal/diagnóstico por imagem , Interpretação de Imagem Radiográfica Assistida por Computador , Reabsorção da Raiz/fisiopatologia , Estresse Mecânico , Torque , Microtomografia por Raio-X
11.
Zhonghua Yi Xue Za Zhi ; 96(23): 1811-4, 2016 Jun 21.
Artigo em Zh | MEDLINE | ID: mdl-27356787

RESUMO

OBJECTIVE: To observe the changes in pelvic balance after posterior reduction of balanced L5-S1 Ⅲ-grade isthmic spondylolisthesis in adults. METHODS: A total of 18 adult patients with balanced L5-S1 Ⅲ-grade isthmic spondylolisthesis were retrospectively studied after successful treatment by posterior decompression, reduction and L5-S1 interbody fusion in Department of Orthopedic Surgery, the First Affiliated Hospital of Soochow University from October 2009 to October 2014.L5-S1 of eight patients were fixed with pedical strews, while others were fixed upgrade to L4.Spino-pelvic parameters: slipping percentage (SP), spondy slip angle (SSA), pelvic incidence (PI), sacral slope (SS), pelvic tilt (PT) and lumbar lordosis (LL) were measured on standing lateral view radiograms.The changes in pelvic balance were analyzed after posterior reduction. RESULTS: All the patients experienced significant changes in SP and SSA with (42.4%±8.3)% and (9.8±4.9)°improved significantly while no significant differences were recorded in PI, PT, SS and LL. PI, PT, SS and LL passed from an average(61.1±6.2)°, (16.2±4.5)°, (44.8±2.9)°, (51.3±9.3)°preoperatively to (61.4±6.1)°, (14.9±4.0)°, (46.5±3.0)°, (48.6±7.0)°respectively.According to K-means cluster analysis, pelvic balance improved postoperatively.No significant correlation was found for ΔPT, ΔSS with ΔSP, while ΔPT and ΔSS had a significant correlation with ΔSSA (correlation coefficient -0.77 and 0.82 respectively). CONCLUSION: Posterior SSA reduction in adults with balanced L5-S1 Ⅲ-grade isthmic spondylolisthesis can improve the former pelvic balance.


Assuntos
Descompressão Cirúrgica , Vértebras Lombares/cirurgia , Pelve/cirurgia , Postura , Espondilolistese/cirurgia , Adulto , Humanos , Instabilidade Articular , Lordose/diagnóstico por imagem , Vértebras Lombares/diagnóstico por imagem , Pelve/diagnóstico por imagem , Complicações Pós-Operatórias/diagnóstico por imagem , Complicações Pós-Operatórias/etiologia , Período Pós-Operatório , Radiografia , Estudos Retrospectivos , Sacro , Espondiloartropatias , Espondilolistese/diagnóstico por imagem , Resultado do Tratamento
12.
Zhonghua Yan Ke Za Zhi ; 52(11): 876-880, 2016 Nov 11.
Artigo em Zh | MEDLINE | ID: mdl-27852406

RESUMO

Myopia is a public health problem in the world and its prevalence and incidence are rising in recent years. Studies have shown that myopia is a kind of complex genetic diseases. And sclera-remodeling plays an important role in the development of myopia. The recent research advances in association with both sclera-remodeling relevant gene polymorphisms and myopia are reviewed in this article. (Chin J Ophthalmol, 2016, 52: 876-880).


Assuntos
Miopia/genética , Pesquisa , Esclera/fisiologia , Humanos , Polimorfismo Genético
15.
Plant Dis ; 97(2): 291, 2013 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30722332

RESUMO

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5'CCAAGCTCAACATGTTTAGC 3', nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5'ACTGCATCTTGCCTATCCTT 3', nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

16.
J Dent Res ; 102(2): 227-237, 2023 02.
Artigo em Inglês | MEDLINE | ID: mdl-36303441

RESUMO

Stressful stimuli can activate the hypothalamic-pituitary-adrenal (HPA) axis. Clinically, it has been widely reported that stressful events are often accompanied by teeth clenching and bruxism, while mastication (chewing) can promote coping with stress. Trigeminal motoneurons in the trigeminal motor nucleus supplying the chewing muscles receive direct inputs from interneurons within the peritrigeminal premotor area (Peri5). Previous studies found that the paraventricular hypothalamic nucleus (PVH) participates in trigeminal activities during stressful events. However, the neural pathway by which the stress-induced oral movements alleviate stress is largely unknown. We hypothesized that paraventricular-trigeminal circuits might be associated with the stress-induced chewing movements and anxiety levels. First, we observed the stress-coping effect of wood gnawing on stress-induced anxiety, with less anxiety-like behaviors seen in the open field test and elevated plus maze, as well as decreased corticosterone and blood glucose levels, in response to stress in mice. We then found that excitotoxic lesions of PVH reduced the effect of gnawing on stress, reflected in more anxiety-like behaviors; this emphasizes the importance of the PVH in stress responses. Anterograde, retrograde, transsynaptic, and nontranssynaptic tracing through central and peripheral injections confirmed monosynaptic projections from PVH to Peri5. We discovered that PVH receives proprioceptive sensory inputs from the jaw muscle and periodontal ligaments, as well as provides motor outputs via the mesencephalic trigeminal nucleus (Me5) and Peri5. Next, pathway-specific functional manipulation by chemogenetic inhibition was conducted to further explore the role of PVH-Peri5 monosynaptic projections. Remarkably, PVH-Peri5 inhibition decreased gnawing but did not necessarily reduce stress-induced anxiety. Moreover, neuropeptide B (NPB) was expressed in Peri5-projecting PVH neurons, indicating that NPB signaling may mediate the effects of PVH-Peri5. In conclusion, our data revealed a PVH-Peri5 circuit that plays a role in the stress response via its associations with oromotor movements and relative anxiety-like behaviors.


Assuntos
Neurônios , Núcleo Hipotalâmico Paraventricular , Camundongos , Animais , Núcleo Hipotalâmico Paraventricular/fisiologia , Ansiedade , Vias Neurais/fisiologia , Adaptação Psicológica
17.
Zhonghua Kou Qiang Yi Xue Za Zhi ; 57(7): 716-723, 2022 Jul 02.
Artigo em Zh | MEDLINE | ID: mdl-35790511

RESUMO

Objective: To analyze the influences of leukocytes on improving blood glucose control in patients with type 2 diabetes mellitus (T2DM) and periodontitis after periodontal mechanical therapy. Methods: Thirty-five patients visiting Peking University Third Hospital from March 2011 to August 2012, as well as thirty-four patients visiting Peking University Hospital of Stomatology from March 2011 to August 2012 and December 2016 to December 2018 were selected in this research. These subjects were non-smokers, and with moderate to severe chronic periodontitis and T2DM. The full set of periodontal examinations including probing depth (PD), attachment loss (AL), bleeding index (BI) and plaque index (PLI) were conducted. Besides, counts of white blood cells (WBC), parameters of glucose and lipids metabolites such as fasting blood glucose (FBG), glycosylated hemoglobin (HbA1c), total cholesterol (TC), triglyceride (TG), high density lipoprotein (HDL) and low density lipoprotein (LDL) in serum were examined before treatment. Then, oral hygiene instruction, scaling and root planing (SRP) were carried out. Three months after SRP, the baseline examinations were repeated in all patients. According to the baseline leukocyte counts, the patients were divided into subgroups: low WBC group (WBC<6.19×109/L) and high WBC group (WBC≥6.19×109/L). Paired t-test for comparison of changes after treatment, analysis of co-variance for comparing the intervention effects between subgroups, and multifactor Iogistic regression analysis were performed. Results: Three months after SRP, all periodontal indexes were significantly improved in both groups. Leukocyte counts decreased significantly in high WBC group (7.64±1.51 vs. 6.89±1.53, P=0.008). In high WBC group, HbA1c (7.67±1.35 vs. 7.18±1.09, P=0.001) and LDL (3.28±0.76 vs. 2.67±0.85, P=0.042) decreased significantly, while there were no such differences in low WBC group. Influence of leukocyte level on HbA1c (OR=0.12, P=0.038) and LDL (OR=0.15, P=0.001) improvement was statistically significant. Hierarchical analysis showed such improvement notably perform in female [HbA1c (OR=0.30, P=0.021), LDL (OR=0.34, P=0.001)] and severe periodontitis group [HbA1c (OR=0.15, P=0.025), LDL (OR=0.24, P=0.017)]. Through interaction test, female and leukocyte counts at baseline had relative excess risk affecting the effect of periodontal intervention on HbA1c (P=0.036) and LDL (P=0.005). Conclusions: SRP could significantly improve the blood glucose and lipid control in patients who had T2DM and chronic periodontitis with relative higher leukocytes level. Female patients with severe periodontitis showed more obviously effects.

18.
Artigo em Inglês | MEDLINE | ID: mdl-34177040

RESUMO

Understanding the uptake and clearance kinetics of new drugs and contrast agents is an important aspect of drug development that typically involves a combination of imaging and analysis of harvested organs. Although these techniques are well-established and can be quantitative, they generally do not preserve high resolution biodistribution information. In this context, fluorescence whole-body cryo-imaging is a promising technique for recovering 3D drug/agent biodistributions at a high resolution throughout an entire study animal at specific time points. A common challenge associated with fluorescence imaging in tissue is that agent signal can be confounded by endogenous fluorescence signal which is often observed in the visible window. One method to address this issue is to acquire hyperspectral images and spectrally unmix agent signal from confounding autofluorescence signals using known spectral bases. Herein, we apply hyperspectral whole-body cryo-imaging and spectral unmixing to examine the distribution of multiple fluorescent agents in excretion organ regions.

19.
Zhonghua Xue Ye Xue Za Zhi ; 42(7): 583-590, 2021 Jul 14.
Artigo em Zh | MEDLINE | ID: mdl-34455746

RESUMO

Objective: To summarize the clinical and pathological features of intravascular NK and T cell lymphoma for better understanding of such disease to reduce misdiagnosis and miss-diagnosis. Methods: Clinical and pathological features were analyzed retrospectively in one case of intravascular peripheral T-cell lymphoma, not otherwise specified (IVPTCL, NOS) , with literatures review. Results: The case presented in this study was a 66-year-old man. PET/CT scan showed multiple lymph nodes enlargement throughout the body. Normal lymph node structure could not be observed by tissue biopsy, while lymph follicles were partially disrupted. High-power light microscope revealed a large number of blood vessels with diffuse proliferation and dilation, where atypical lymphoid cell mass was restricted in the lumen and partially infiltrated the large blood vessel wall. These tumor cells were medium to large with moderate cytoplasm. The nucleus was irregular, single or multiple nucleoli could be seen, chromatin was condensed, some were empty and bright, and mitotic figures could be seen. Immunohistochemical staining showed that the neoplastic cells were positive for expression of CD3, CD43, CD8, GrB, TIA-1 and perforin. EBER in situ hybridization result was negative. Polymerase chain reaction test identified a clonal gene rearrangement of T-cell receptor γ. The patient was treated with CHOP in combination with chidamide, but died of infection and cardiopulmonary failure within 2 months. 56 cases of intravascular NK/T cell lymphoma with definite classification were collected from relevant literatures, including 47 cases with nasal type of extranodal NK/T cell lymphoma (27 were male and 20 were female) , 8 cases with anaplastic large cell lymphoma (3 males and 5 females) , and only one case with de nova IVPTCL, NOS in brain. We report the second case of IVPTCL,NOS, and notably originated from lymph node for the first time. Conclusions: Intravascular NK/T cell lymphoma is a highly aggressive disease with no effective treatment at present. Involvement of Lymph node has rarely been reported, and further studies on more cases are necessary.


Assuntos
Linfoma Extranodal de Células T-NK , Linfoma de Células T Periférico , Idoso , Feminino , Humanos , Hibridização In Situ , Masculino , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Estudos Retrospectivos
20.
Front Plant Sci ; 12: 832044, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-35197991

RESUMO

Asymmetric responses of aboveground net primary productivity (ANPP) to precipitation were identified as a signal to predict ecosystem state shifts at temperate grassland zones in Inner Mongolia, China. However, mechanism studies were still lacking. This study hypothesized that the enhanced growth and newly emerged herbaceous after increased precipitation resulted in the highest asymmetry at the transition zone between desert and typical steppe. We monitored the responses of the normalized difference vegetation index (NDVI) of different species to precipitation events using un-manned aerial vehicle technology to test this hypothesis. NDVI and species richness were measured twice at fixed points in July and August with a time interval of 15 days. Results showed that: (1) From July to August, NDVI in the transition zone increased significantly after precipitation (P < 0.05), but NDVI in both the desert and typical steppe showed a non-significant change (P > 0.05). (2) In the transition zone, NDVI increases from the shrub and herbaceous contributed to 37 and 63% increases of the site NDVI, respectively. (3) There was a significant difference in species richness between July and August in the transition zone (P < 0.05), mainly caused by the herbaceous (Chenopodiaceae, Composite, Convolvulaceae, Gramineae, Leguminosae, and Liliaceae), which either emerged from soil or tillers growth from surviving plants. This study demonstrated that herbaceous dominant the changes of NDVI in the transition zone, which provides a scientific basis for the mechanism studies of ANPP asymmetric response to precipitation and warrants long-term measurements.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA