Helper Component-Proteinase of Triticum Mosaic Virus Is a Viral Determinant of Wheat Curl Mite Transmission.

Triticum mosaic virus (TriMV; genus Poacevirus; family Potyviridae) is an economically important virus in the Great Plains region of the United States. TriMV is transmitted by the wheat curl mite (Aceria tosichella) Type 2 genotype but not by Type 1. Helper component-proteinase (HC-Pro) is a vector transmission determinant for several potyvirids, but the role of HC-Pro in TriMV transmission is unknown. In this study, we examined the requirement of the HC-Pro cistron of TriMV for wheat curl mite (Type 2) transmission through deletion and point mutations and constructing TriMV chimeras with heterologous HC-Pros from other potyvirids. TriMV with complete deletion of HC-Pro failed to be transmitted by wheat curl mites at detectable levels. Furthermore, TriMV chimeras with heterologous HC-Pros from aphid-transmitted turnip mosaic virus and tobacco etch virus, or wheat curl mite-transmitted wheat streak mosaic virus, failed to be transmitted by wheat curl mites. These data suggest that heterologous HC-Pros did not complement TriMV for wheat curl mite transmission. A decreasing series of progressive nested in-frame deletions at the N-terminal region of HC-Pro comprising amino acids 3 to 125, 3 to 50, 3 to 25, 3 to 15, 3 to 8, and 3 and 4 abolished TriMV transmission by wheat curl mites. Additionally, mutation of conserved His20, Cys49, or Cys52 to Ala in HC-Pro abolished TriMV transmissibility by wheat curl mites. These data suggest that the N-terminal region of HC-Pro is crucial for TriMV transmission by wheat curl mites. Collectively, these data demonstrate that the HC-Pro cistron of TriMV is a viral determinant for wheat curl mite transmission.

First report of Triticum mosaic virus infecting oat crop in the United States.

Triticum mosaic virus (TriMV, genus Poacevirus, family Potyviridae) was first reported in 2006 (Seifers et al. 2008) to infect wheat, and since then, it has been established as a constraint for US wheat production (Byamukama et al. 2013). In the field, TriMV often exists as a coinfection with wheat streak mosaic virus (WSMV), and these two viruses interact synergistically to produce severe symptoms and greater yield loss (Byamukama et al. 2012; Tatineni et al. 2022). Both TriMV and WSMV are transmitted by wheat curl mites (Aceria tosichella Keifer) (McMechan et al. 2014). Wheat is the primary host reported for TriMV in the field, but Seifers et al. (2010) established oat, rye, barley, and several other cereals and grasses as hosts under controlled conditions. However, there are no documented cases of TriMV infecting oats in the field. Between 10-25 June, 2023, a total of 273 field oat plants showing foliar yellowing, yellow flecking, and streaking symptoms were collected from four different fields in Nebraska (Big Springs: 41.1029° N, 102.1451° W; Mead: 41.2292° N, 96.4938° W; Odell: 40.0459° N, 96.7984° W; Stumf: 40.5048° N, 101.4223° W). Total RNA was extracted using the MagMax Plant RNA Isolation kit (Thermo Fisher Scientific) and the KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific) (Mondal et al. 2023). Sample RNA was assayed with a single-step multiplex reverse transcription polymerase chain reaction (RT-PCR) to determine presence of WSMV and TriMV. Out of 273 symptomatic oat plants, 254 (93.04%) tested positive for at least one virus. Out of total positive samples, 238 were positive for WSMV (93.70 %), 12 plants tested positive for both TriMV and WSMV (4.70%), and 4 plants were infected with TriMV alone (1.60%). As a secondary confirmation, amplified fragments from the TriMV single infection were gel purified using a gel extraction kit (QIAquick) and sequenced (Eurofins Genomics). The nucleotide sequences were analysed using the BlastN program, compiled, and edited in the BioEdit software (Hall 1999). Sequences were deposited in the NCBI GenBank database (accession number PP475806). Nucleotide BLAST searches of the target coat protein (CP) gene showed > 98% identity to the corresponding sequences in TriMV accession MK318274. For further validation, virus inoculum was prepared by grinding field-collected plant material from plants with only TriMV present in 20 mM sodium phosphate buffer, pH 7.0, and then mechanically inoculating two-week-old oats (cv. Shaw n=8) and wheat (cv. Sattler, n=8) plants. Three weeks post-inoculation, all the eight wheat plants exhibited mild yellowing and streaking symptoms, while oat plants did not show obvious foliar symptoms. All wheat and oat plants were further tested positive with DAC-ELISA (antibodies produced against TriMV CP at the USDA-ARS facility in Lincoln, NE) and with RT-PCR. The specific attribution of these symptoms to TriMV in oats is not possible as none produced prominent symptoms. Asymptomatic oat infection from symptomatic field-collected oat samples could be due to oat cultivar differences. Although the prevalence of TriMV in wheat has been established across the Great Plains of the United States, to our knowledge, this is the first report of TriMV infection in US oat fields. Our finding warrant further investigation into the incidence and impact of the virus in oat crop and its potential for serving as a asymptomatic virus reservoir.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

Infection Dynamics of Potato Virus Y Isolate Combinations in Three Potato Cultivars.

The United States potato industry has recently experienced a strain shift; recombinant potato virus Y (PVY) strains (e.g., PVYNTN) have emerged as the predominant strains over the long dominant ordinary strain (PVYO), yet both are often found as single infections within the same field and as mixed infections within individual plants. To understand mixed infection dynamics in potato plants and in daughter tubers, three potato varieties varying for PVY resistance, 'Red Maria', 'CalWhite', and 'Pike', were mechanically inoculated either at the pre- or postflowering stage with all possible heterologous isolate combinations of two PVYO and two PVYNTN isolates. Virus titer was determined from leaves collected at different positions on the plant at different times, and tuber-borne infection was determined for two successive generations. PVYNTN accumulated to higher levels than PVYO at nearly all sampling time points in 'Pike' potato. However, both virus strains accumulated to similar amounts in 'Red Maria' and 'CalWhite' potato early in the infection when inoculated preflowering; however, PVYNTN dominated at later stages and in plants inoculated postflowering. Regardless of inoculation time, both virus strains were transmitted to daughter plants raised from the tubers for most isolate combinations. The relative titer of PVYNTN and PVYO isolates at the later stages of mother plant development was indicative of what was found in the daughter plants. Although virus titer differed among cultivars depending on their genetics and virus isolates, it did not change the strain outcome in tuber-borne infection in subsequent generations. Differential virus accumulation in these cultivars suggests isolate-specific resistance to PVY accumulation.

Differential Seasonal Prevalence of Yellowing Viruses Infecting Melon Crops in Southern California and Arizona Determined by Multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

Virus and helper component interactions favour the transmission of recombinant potato virus Y strains.

In recent years, several recombinant strains of potato virus Y, notably PVYNTN and PVYN:O have displaced the ordinary strain, PVYO, and emerged as the predominant strains affecting the USA potato crop. Previously we reported that recombinant strains were transmitted more efficiently than PVYO when they were acquired sequentially, regardless of acquisition order. In another recent study, we showed that PVYNTN binds preferentially to the aphid stylet over PVYO when aphids feed on a mixture of PVYO and PVYNTN. To understand the mechanism of this transmission bias as well as preferential virus binding, we separated virus and active helper component proteins (HC), mixed them in homologous and heterologous combinations, and then fed them to aphids using Parafilm sachets. Mixtures of PVYO HC with either PVYN:O or PVYNTN resulted in efficient transmission. PVYN:O HC also facilitated the transmission of PVYO and PVYNTN, albeit with reduced efficiency. PVYNTN HC failed to facilitate transmission of either PVYO or PVYN:O. When PVYO HC or PVYN:O HC was mixed with equal amounts of the two viruses, both viruses in all combinations were transmitted at high efficiencies. In contrast, no transmission occurred when combinations of viruses were mixed with PVYNTN HC. Further study evaluated transmission using serial dilutions of purified virus mixed with HCs. While PVYNTN HC only facilitated the transmission of the homologous virus, the HCs of PVYO and PVYN:O facilitated the transmission of all strains tested. This phenomenon has likely contributed to the increase in the recombinant strains affecting the USA potato crop.

Different potato virus Y strains frequently co-localize in single epidermal leaf cells and in the aphid stylet.

Single aphids can simultaneously or sequentially acquire and transmit multiple potato virus Y (PVY) strains. Multiple PVY strains are often found in the same field and occasionally within the same plant, but little is known about how PVY strains interact in plants or in aphid stylets. Immuno-staining and confocal microscopy were used to examine the spatial and temporal dynamics of PVY strain mixtures (PVYO and PVYNTN or PVYO and PVYN) in epidermal leaf cells of 'Samsun NN' tobacco and 'Goldrush' potato. Virus binding and localization was also examined in aphid stylets following acquisition. Both strains systemically infected tobacco and co-localized in cells of all leaves examined; however, the relative amounts of each virus changed over time. Early in the tobacco infection, when mosaic symptoms were observed, PVYO dominated the infection although PVYNTN was detected in some cells. As the infection progressed and vein necrosis developed, PVYNTN was prevalent. Co-localization of PVYO and PVYN was also observed in epidermal cells of potato leaves with most cells infected with both viruses. Furthermore, two strains could be detected binding to the distal end of aphid stylets following virus acquisition from a plant infected with a strain mixture. These data are in contrast with the traditional belief of spatial separation of two closely related potyviruses and suggest apparent non-antagonistic interaction between PVY strains that could help explain the multitude of emerging recombinant PVY strains discovered in potato in recent years.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Potato virus Y Transmission Efficiency from Potato Infected with Single or Multiple Virus Strains.

There has been a recent shift in the prevalence of Potato virus Y (PVY) strains affecting potato with the ordinary strain PVYO declining and the recombinant strains PVYNTN and PVYN:O emerging in the United States. Multiple PVY strains are commonly found in potato fields and even in individual plants. Factors contributing to the emergence of the recombinant strains are not well defined but differential aphid transmission of strains from single and mixed infections may play a role. We found that the transmission efficiencies by Myzus persicae, the green peach aphid, of PVYNTN, PVYN:O, and PVYO varied depending on the potato cultivar serving as the virus source. Overall transmission efficiency was highest from sources infected with three virus strains, whereas transmission from sources infected with one or two virus strains was not significantly different. Two strains were concomitantly transmitted by individual aphids from many of the mixed-source combinations, especially if PVYO was present. Triple-strain infections were not transmitted by any single aphid. PVYO was transmitted most efficiently from mixed-strain infection sources. The data do not support the hypothesis that differential transmission of PVY strains by M. persicae is a major contributing factor in the emergence of recombinant PVY strains in the U.S. potato crop.

Responses of Aphid Vectors of Potato leaf roll virus to Potato Varieties.

Potato leaf roll virus (PLRV) can reduce tuber yield and quality in potato. Green peach aphid (Myzus persicae [Sulzer]) and potato aphid (Macrosiphum euphorbiae [Thomas]) are the two most important potato-colonizing PLRV vectors in the Pacific Northwest. We compared My. persicae and Ma. euphorbiae densities and PLRV incidences among potato varieties in the field to clarify the relationships between aphid abundance and PLRV incidence in plants. Aphids were sampled weekly over three years in the potato varieties Russet Burbank, Ranger Russet, and Russet Norkotah in a replicated field trial. In all years, My. persicae was more abundant than Ma. euphorbiae, representing at least 97% of samples. My. persicae densities did not differ among potato varieties across years; very low numbers of Ma. euphorbiae precluded such statistical comparisons for this species. PLRV infection did not differ significantly among potato varieties, although the percent of PLRV-infected plants differed among years when all varieties were combined (46% in 2013, 29% in 2011, 13% in 2012). For Ranger Russet and Russet Norkotah, PLRV incidence was positively correlated with aphid abundance as well as proportion of PLRV-positive aphids. In Russet Burbank, only aphid abundance was positively correlated with PLRV infection. Our results suggest that the three most commonly grown potato varieties in our region do not differ in their susceptibility to PLRV infection, and that aphid density was a consistent indicator of the risk of infection by this virus across varieties. Both of these findings can be used to hone PLRV monitoring and modeling efforts.

Sequential acquisition of Potato virus Y strains by Myzus persicae favors the transmission of the emerging recombinant strains.

In the past decade recombinant strains of Potato virus Y (PVY) have overtaken the ordinary strain, PVYO, as the predominant viruses affecting the US seed potato crop. Aphids may be a contributing factor in the emergence of the recombinant strains, but studies indicate that differences in transmission efficiency of individual PVY strains either from single or mixed infections, although variable, are not generally significant. Multiple strains of PVY are present in all potato production areas and common in many potato fields. Therefore, it is likely that individual alate aphids moving through a potato field will sequentially encounter multiple strains as they "taste test" multiple potato plants while looking for a suitable host. This study examined the transmission likelihood and efficiency of three common PVY strains when acquired sequentially by individual aphids. Green peach aphids (Myzus persicae, Sulzer) were allowed a 2-3min acquisition access period (AAP) on potato leaves infected with PVYO, PVYN:O or PVYNTN, followed by another 2-3min AAP on a second potato leaf infected with a different PVY strain before being transferred to healthy potato seedlings for a 24h inoculation access period. All possible combinations of the three strains were tested. Strain-specific infection of the recipient plants was determined by TAS-ELISA and RT-PCR 3-4wk post-inoculation. The recombinant strains, PVYN:O and PVYNTN, were transmitted more efficiently than PVYO when they were sequentially acquired regardless of the order acquired. PVYN:O and PVYNTN were transmitted with similar efficiencies when they were sequentially acquired regardless of the order. The recombinant strains appear to preferentially bind to the aphid stylet over PVYO or they may be preferentially released during inoculation. This may contribute to the increased incidence of the recombinant strains over PVYO in fields or production regions where multiple PVY strains are detected.

Contribution of Noncolonizing Aphids to Potato Virus Y Prevalence in Potato in Idaho.

Potato virus Y (PVY) is a major concern for potato production in the United States given its impact on both crop quality and yield. Although green peach aphid, Myzus persicae (Sulzer), is the most efficient PVY vector, it may be less abundant in potato-growing areas of Idaho relative to non-potato-colonizing aphid vectors of PVY that may disperse from nearby cereal fields and other crops. A field study was conducted during 2012-2013 to examine if noncolonizing aphids disperse to nearby potato fields as cereal crops dry down before harvest. The aphid fauna was sampled weekly in four different potato fields in south-central and southeastern Idaho using yellow sticky traps and yellow pan traps. Potato fields were chosen with an adjacent cereal field such that the prevailing westerly wind would facilitate aphid dispersal from cereal fields to potato. Non-potato-colonizing aphids sampled included 10 cereal aphid species, the most abundant of which were Rhopalosiphum padi L. and Metopolophium dirhodum (Walker). More than 35 species from noncereal hosts also were found. Overall, green peach aphid abundance was relatively low, ranging from 0.5-2.5% of the total aphid capture between years and among fields. In both years and all locations, cereal aphid abundance peaked in mid- to late July (cereal ripening stage) and decreased thereafter as cereal crops dried. PVY prevalence in the potato fields increased following these increases in aphid abundance. This study suggests that cereal aphids and other noncolonizing aphids are important contributors to PVY prevalence in potato in southern Idaho.

Interactions among potato genotypes, growth stages, virus strains, and inoculation methods in the potato virus Y and green peach aphid pathosystem.

Potato virus Y (PVY) is an economically important and reemerging potato pathogen in North America. PVY infection reduces yield, and some necrotic and recombinant strains render tubers unmarketable. Although PVY(O) is the most prevalent strain in the United States, the necrotic and recombinant strains PVY(NTN) and PVY(N:O) are becoming more widespread. Infection rates in aphid-inoculated (Myzus persicae (Sulzer)) and mechanically inoculated plants were compared across two potato genotypes ('Yukon Gold' and A98345-1), three PVY strains (PVY(O), PVY(N:O), and PVY(NTN)), and two growth stages at inoculation (pre- and postflowering). Susceptibility of genotypes was measured as infection rate using a double-antibody sandwich-enzyme-linked immunosorbent assay; virus titer and tuber mass also were recorded from the infected plants. Yukon Gold generally was more susceptible than A98345-1 to all three PVY strains, especially following mechanical inoculation. Within genotypes, Yukon Gold was most susceptible to PVY(O) and A98345-1 was most susceptible to PVY(N:O). Plants exhibited age-based resistance, with both genotypes showing higher susceptibility at the pre- than postflowering stage. The overall ranking pattern of virus titer in infected plants was PVY(O) > PVY(NTN) > PVY(N:O); across all three strains, infected Yukon Gold had higher titer than infected A98345-1 plants. Yukon Gold plants had lower tuber mass than A98345-1 when infected, and there were differences between the two inoculation methods in regard to tuber mass for the three stains. The results showed differences in infection response between inoculation methods and as a function of genotype, strain, inoculation stage, and their interactions. These factors should be considered when screening genotypes for resistance.