The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups.

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy=2,2'-bipyridine and bbob=bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb=bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'-bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the Delta isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Lambda-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the Delta isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

An approach to therapeutic agents through selective targeting of destabilised nucleic acid duplex sequences.

The binding of ΔΔ/ΛΛ-[{Ru(phen)(2)}(2)(µ-bb(n))](4+) {where phen = 1,10-phenanthroline, bb(n) = 1,n-bis[4(4'-methyl-2,2'-bipyridyl)]-alkane (ΔΔ/ΛΛ-Rubb(n))} to the non-self complementary oligonucleotide 5'-d(CGCGATAAGCCGC·5'-GCGGCATTACGCG) (3-DB) has been examined using a 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) displacement assay. The 3-DB oligonucleotide contains two single adenine bulge nucleotides that are separated by three base pairs. (1)H NMR spectroscopy data demonstrated that the adenine bases are intra-helical and that the segment containing the two bulge nucleotides and the three A·T base pairs between the bulges forms a destabilised segment within the stable duplex oligonucleotide. The DAPI displacement assay demonstrated that ΔΔ-Rubb(7)-bound 3-DB with higher affinity than the other members of the ΔΔ/ΛΛ-Rubb(n) series. Molecular models suggested that the seven-carbon chain length in ΔΔ-Rubb(7) was ideal to span the distance between the two bulge sites. The binding of ΔΔ-Rubb(7) to 3-DB was also studied by (1)H NMR spectroscopy and molecular modelling. The selective changes in chemical shifts for the resonances from 3-DB upon addition of ΔΔ-Rubb(7) suggested that the metal complex specifically bound at the destabilised segment between A(5) and A(19). Observation in NOESY spectra of NOE cross peaks between 3-DB and ΔΔ-Rubb(7) confirmed that one of the ruthenium centres bound at the A(5) bulge site, with the other metal centre positioned at the A(19) bulge. In addition, ΔΔ-Rubb(7) was found to bind chromosomal DNA extracted from a suspension of Staphylococcus aureus that had been incubated with the ruthenium(ii) complex. As inert dinuclear ruthenium(ii) complexes are capable of being transported into a bacterial cell and bind chromosomal DNA, it is possible that they could be developed into anti-microbial agents that specifically target destabilised segments of DNA that are recognised by essential DNA-binding proteins.

DNA affinity binding studies using a fluorescent dye displacement technique: the dichotomy of the binding site.

We have observed a number of discrepancies and contradictions in the use of a fluorescent intercalator displacement assay in surveying the binding affinities of dinuclear polypyridyl ruthenium(II) complexes with DNA. By a modification of the assay using the fluorescent minor-groove binder 4',6-diamidino-2-phenylindole, rather than intercalating dyes (ethidium bromide or thiazole orange), results were obtained for all complexes studied which were consistent with relative affinities and stereoselectivities observed with other techniques, including NMR, affinity chromatography and equilibrium dialysis. It is believed that the difference in binding mode between the minor groove-binding Ru(II) complexes and the intercalating fluorescent dyes they are displacing may contribute to these discrepancies.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity.

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

Dinuclear ruthenium(ii) complexes with flexible bridges as non-duplex DNA binding agents.

The stereoisomers of a series of dinuclear ruthenium(ii) complexes [{Ru(phen)(2)}(2)(micro-BL)](4+) (phen = 1,10-phenanthroline) with flexible bridging ligands (BL) bb2 {1,2-bis[4(4'-methyl-2,2'-bipyridyl)]ethane}, bb5 {1,5-bis[4(4'-methyl-2,2'-bipyridyl)]pentane}, bb7 {1,7-bis[4(4'-methyl-2,2'-bipyridyl)]heptane}, and bb10 {1,10-bis[4(4'-methyl-2,2'-bipyridyl)]decane} have been synthesised. Their binding to a control dodecanucleotide, d(CCGGAATTCCGG)(2), and a tridecanucleotide, d(CCGAGAATTCCGG)(2), which contains a single adenine bulge have been studied using fluorescence displacement assays involving intercalating and groove-binding dyes, equilibrium dialysis and binding affinity chromatography. The fluorescence intercalator displacement (FID) assay indicated that LambdaLambda-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the greatest binding affinity with all the oligonucleotides, whereas an analogous fluorescence technique using a minor-groove binding dye, equilibrium dialysis and affinity binding chromatography showed that DeltaDelta-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the strongest binding. An (1)H NMR study of the binding of the DeltaDelta-enantiomer of [{Ru(phen)(2)}(2)(micro-bb7)](4+) to d(CCGAGAATTCCGG)(2) confirmed the selectivity of the metal complex for the bulge site and provided the basis for an energy-minimised binding model of the dinuclear ruthenium complex with the single adenine bulge containing trinucleotide. The binding model demonstrated the ability of the flexibly-linked complex to follow the curvature of the DNA minor groove.

Selectivity at a three-base bulge site in the DNA binding of DeltaDelta-[{Ru(phen)2} 2(mu-dppm)]4+ [dppm is 4,6-bis(2-pyridyl)pyrimidine; phen is 1,10-phenanthroline].

The binding of the stereoisomers of [{Ru(phen)2}2(mu-bpm)]4+, [{Ru(phen)2}2(mu-dppm)]4+ and [{Ru(phen)2}2(mu-bb)]4+ {phen is 1,10-phenanthroline; bpm is 2,2'-bipyrimidine, dppm is 4,6-bis(2-pyridyl)pyrimidine, bb is 1,2-bis[4-(4'-methyl-2,2'-bipyridyl)]ethane} to an oligonucleotide duplex [d(GCATCGAAAGCTACG).d(CGTAGCCGATGC)] containing a three-base bulge has been studied using a fluorescence intercalator displacement assay. Of the dinuclear ruthenium complexes, the dppm-linked species showed the strongest binding to the oligonucleotide, with the DeltaDelta isomer binding slightly more strongly than the meso isomer and the LambdaLambda isomer exhibiting the weakest binding. In order to determine whether the DeltaDelta-[{Ru(phen)2}2(mu-dppm)]4+ metal complex specifically bound at the three-base bulge site, a 1H NMR study of the binding of the metal complex to the oligonucleotide duplex d(GCATCGAAAGCTACG)*d(CGTAGCCGATGC) was carried out. Although a detailed picture of the metal complex-oligonucleotide association could not be determined from the NMR results owing to the broadening of the resonances from the metal complex and nucleotide residues at the bulge site, the NMR results do indicate that the metal complex specifically binds at the three-base bulge site. The combined results of this study suggest that the dppm-bridged dinuclear ruthenium complexes have considerable potential as probes for the unusual secondary structure obtained by the insertion of a three-base bulge within duplex DNA.

meso-[{Ru(phen)2}2(mu-HAT)]4+: a high-affinity DNA hairpin probe {HAT = 1,4,5,8,9,12-hexaazatriphenylene; phen = 1,10-phenanthroline}.

1H NMR spectroscopy and fluorescent intercalator displacement (FID) assays have been used to investigate the DNA-binding abilities of two series of dinuclear polypyridyl ruthenium(II) complexes of the form [{Ru(L)2}2(mu-BL)]4+ {L = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (Me2bpy), 1,10-phenanthroline (phen), or 4,7-dimethyl-1,10-phenanthroline (Me2phen); BL = 2,2'-bipyrimidine (bpm) or 1,4,5,8,9,12-hexaazatriphenylene (HAT)}. Preliminary FID surveys of these metal complexes against a variety of different oligonucleotides revealed that those complexes based upon the HAT bridging ligand induced greater fluorescence decreases in dye-bound DNA than did their bpm-bridged counterparts, suggesting a higher binding affinity by the HAT-bridged species. Furthermore, the greatest fluorescence decreases were typically observed in an oligonucleotide featuring a six-base hairpin loop. The apparent binding affinity of the metal complexes was also found to be a function of the stereochemistry and identity of the terminal ligands of the complex. The meso (DeltaLambda) stereoisomer generally induced greater fluorescence decreases than did either enantiomer (DeltaDelta or LambdaLambda), phen-based terminal ligands performed better than bpy-based terminal ligands, and those terminal ligands with methyl substituents demonstrated stronger apparent binding than did their non-methylated analogues. NMR experiments on meso-[{Ru(phen)2}2(mu-HAT)]4+ and meso-[{Ru(Me2phen)2}2(mu-HAT)]4+ demonstrated that both complexes bound with high affinity to the six-base hairpin oligonucleotide at the stem-loop interface and provided evidence to support stronger binding by the methylated species. meso-[{Ru(phen)2}2(mu-HAT)]4+ was found to bind poorly to duplex DNA and smaller four-base hairpin loops in FID and NMR experiments, whereas FID data suggest that the methylated analogue binds relatively strongly to most oligonucleotide sequences (the four- and six-base hairpins in particular). These results demonstrate that binding affinity can come at the expense of selectivity, with meso-[{Ru(phen)2}2(mu-HAT)]4+ proving to be an efficient compromise between the two as a high-affinity DNA hairpin probe.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents.

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.