Saccharomyces cerevisiae cultured under aerobic and anaerobic conditions: air-level oxygen stress and protection against stress.

Cells of Saccharomyces cerevisiae were grown aerobically and anaerobically, and levels of the protective compounds, cysteine and glutathione, and activities of defensive enzymes, catalase and superoxide dismutase, against an oxygen stress were determined and compared in both cells. Aerobiosis increased both the compounds and enzyme activities. The elevated synthesis of glutathione could be associated with the increased levels of cysteine which in its turn was found to be controlled by the oxygen-dependent activation of cystathionine beta-synthase.

A steroidogenic cell line with differentiation potential from mouse granulosa cells, transfected with Ad4BP and SV40 large T antigen genes.

Several steroidogenic cell lines of granulosa cells (GC) have been used to elucidate differentiation mechanisms of GC during folliculogenesis. These cell lines, however, are of limited usefulness since they have lost some of their differentiation potential. The transcription factor adrenal-4 binding protein (Ad4BP), also known as steroidogenic factor-1 or NR5A1, is essential for the expression of all P-450 steroidogenic enzymes. By transfection with the Ad4BP gene together with SV40 DNA, we have generated several steroidogenic cell lines. One selective clone, named 4B2, retained its steroidogenic potential and was therefore analyzed in depth. This cell line responded to 8-Br-cAMP by displaying differentiation characteristics similar to those occurring in the differentiation process of primary cultured GC, including enhanced progesterone secretion, a cell shape change from a fibroblastic to epithelioid conformation, elongated mitochondria, increased gap junction formation and inhibition of cell proliferation. Prostaglandin E2 (PGE2), an intraovarian regulator of GC, stimulated cAMP production, and this eicosanoid, like 8-Br-cAMP, induced differentiation properties with the exception of cell conformation in 4B2 cells. These results suggest that expression of Ad4BP may provide the basis for a repertoire of cAMP-sensitive differentiation properties, including morphological alterations and growth inhibition. Thus, the 4B2 cell line may serve as a tool for elucidation of differentiation mechanisms that are under the control of Ad4BP.

Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP.

We have examined the transcriptional activity of four cis-elements, Ad1(CRE), Ad2, Ad3, and Ad4, that are present in the promoter of the bovine CYP11B (11 beta-hydroxylase P-450) gene using beta-globin reporter gene constructs and transient transfection into steroidogenic and nonsteroidogenic cell types. Only Ad1(CRE), a CRE homolog, showed forskolin-dependent transcriptional activity in adrenal tumor Y-1 cells, whereas the other elements were not able to stimulate transcription by themselves. As Ad3 and Ad4 had previously been identified as the cis-elements required for full cAMP-dependent transcription of this gene, we examined the effect of combinations of different cis-elements on the transcription of the reporter gene. In Y-1 cells, Ad1(CRE) and four tandem copies of any one of the other cis-elements substantially activated transcription in response to forskolin treatment. The template carrying Ad1(CRE) and Ad4 was also active in testicular Leydig cells, I-10, whereas it was inactive in nonsteroidogenic PC-12 cells. Transcriptional activation by the 4xAd4/Ad1(CRE) combination presumably depended on the presence of Ad4-binding protein (Ad4BP), which is absent in PC-12 cells, as shown by immunoblot analysis. This was confirmed by cotransfecting an expression vector for Ad4BP into PC-12 cells, which caused forskolin-dependent transcription to increase in proportion to the amount of expression vector. In Y-1 cells, transcriptional activation by forskolin was mimicked by cotransfection of an expression vector for the catalytic subunit of protein kinase-A.(ABSTRACT TRUNCATED AT 250 WORDS)

Dax-1 as one of the target genes of Ad4BP/SF-1.

The DAX-1 (also known as AHC) gene encodes an unusual member of the nuclear hormone receptor superfamily. DAX-1 plays a critical role during gonadal and adrenal differentiation since mutations of the human DAX-1 gene cause X-linked adrenal hypoplasia congenita associated with hypogonadotropic hypogonadism. In recent studies, DAX-1 was reported to function as a transcriptional suppressor of Ad4BP/SF-1, a critical transcription factor in gonadal and adrenal differentiation. With respect to implication of Ad4BP/SF-1 in the transcriptional regulation of the DAX-1 gene, inconsistent findings have been previously reported. We investigated the upstream region of the mouse Dax-1 (also known as Ahch) gene and identified a novel Ad4/SF-1 site by transient transfection and electrophoretic mobility shift assays. In addition, immunohistochemical analyses with a specific antibody to Dax-1 indicated the presence of immunoreactive cells in steroidogenic tissues, pituitary gland, and hypothalamus. Although the distributions of Dax-1 and Ad4BP/SF-1 were very similar, they were not completely identical. The expression of Dax-1 was significantly impaired in knock-out mice of the Ftz-f1 gene, which encodes Ad4BP/ SF-1. Taken together, our findings indicate that Ad4BP/SF-1 controls the transcription of the Dax-1 gene.

Functional difference between Ad4BP and ELP, and their distributions in steroidogenic tissues.

Ad4BP, a zinc finger DNA-binding protein, was identified as a transcription factor regulating steroidogenic P-450 genes in a cAMP-dependent manner. Immunochemical and immunohistochemical studies with steroidogenic tissues, adrenal, ovary, and testis, were performed using the antiserum to Ad4BP. Ad4BP was expressed to the same extent in the three zones of the adrenal cortex. Immunohistochemical examination of ovarian follicle and corpus luteum showed the expression of Ad4BP. The granulosa and thecal cells, the two distinct types of the steroidogenic cells in the follicle, gave Ad4BP signals, which were stronger than in the latter cells than in the former. Immunoblot analyses of mature and regressed corpora lutea indicated a parallel expression of Ad4BP and side-chain cleavage P-450, and both proteins significantly decreased in the regressed tissues. Leydig cells surrounding seminiferous tubules gave clear immunostaining signals for Ad4BP. ELP, a mammalian counterpart of Drosophila FTZ-F1 detected in EC cells, and are isoforms transcribed from the same gene. The Ad4BP and ELP forms recognize same nucleotide sequences. Reverse transcriptase-polymerase chain reaction with specific primers for ELP revealed that steroidogenic tissues contained ELP as well as Ad4BP. The effects of the two proteins on the transcription of the CYP11B gene were compared using the expression vectors of Ad4BP and ELP. ELP did not activate transcription and showed a weak inhibitor effect on the Ad4BP-dependent transactivation of the CYP11B gene promoter when transfected simultaneously. A gel shift analysis using in vitro synthesized Ad4BP and ELP revealed that the binding activity of ELP is significantly weaker than that of Ad4BP.

Ad4BP in the human adrenal cortex and its disorders.

Ad4BP, a zinc finger DNA-binding protein, is a transcription factor that regulates the expression of the steroidogenic P450 genes. We performed immunoblotting and immunohistochemistry of Ad4BP in 34 human adrenal cortex specimens, which included adrenocortical adenomas and carcinomas. Immunoblotting revealed a single band of 53K, corresponding to the mol wt of Ad4BP. The immunohistochemical studies demonstrated that Ad4BP immunoreactivity was present exclusively in the nuclei of nearly all of the adrenocortical parenchymal cells in both the normal and the pathological human adrenal specimens. Ad4BP was immunostained with equal intensity and frequency among the different cell types. Ad4BP immunoreactivity was also observed in areas of marked degenerative changes, such as lipomyelomatous lesions, and in poorly differentiated carcinoma cells. These results suggest a close association of Ad4BP expression with the biological phenotype of adrenocortical parenchymal cells. Ad4BP therefore seems to play important roles in the induction and maintenance of the transcription of all steroidogenic P450 genes in human adrenocortical cells, even after malignant transformation.

Immunohistochemical localization of Ad4-binding protein with correlation to steroidogenic enzyme expression in cycling human ovaries and sex cord stromal tumors.

Ad4-binding protein (Ad4BP) has been demonstrated recently as a transcription factor that serves as a general regulator of all steroidogenic P450 genes. We examined the expression of Ad4BP in 32 normal cycling human ovaries and 22 human ovarian sex cord stromal tumors by immunoblotting and immunohistochemistry. Immunoblotting of normal cycling human ovaries revealed a single band of 53 kilodaltons, corresponding to the mol wt of Ad4BP. We also correlated Ad4BP expression with the immunolocalization of the steroidogenic enzymes (side-chain cleavage cytochrome P450, cytochrome P450 17 alpha-hydroxylase, and cytochrome P450 aromatase). Ad4BP immunoreactivity, which was present only in the nuclei, was observed sporadically in the granulosa cells and adjacent stromal cells in the preantral follicles. In the dominant antral follicles, Ad4BP was detected in both granulosa and theca interna cells. However, in the nondominant antral follicles, Ad4BP was observed only in theca interna cells. In the corpus luteum, Ad4BP was present in both luteinized granulosa and thecal cells. Ad4BP was also expressed in some atretic follicles and degenerating corpora lutea. The spatial and temporal localization of Ad4BP in the normal cycling human ovary generally correlated well with that of steroidogenic enzymes. However, expression of the steroidogenic enzymes followed that of Ad4BP during the developing stages of the preantral follicle and vice versa during the process of follicular atresia. In ovarian sex cord stromal tumors, Ad4BP expression was observed in tumor cells that were positive for steroidogenic enzymes, but not in nonsteroidogenic tumor cells. These results, especially the in situ colocalization of Ad4BP and the steroidogenic enzymes, suggest that Ad4BP has the potential to control steroidogenic P450 expression in both normal and pathological human ovaries.

Molecular cloning and expression of the SF-1/Ad4BP gene in the frog, Rana rugosa.

SF-1/Ad4BP is a transcriptional factor that was originally found to be a mammalian homologue of the Drosophila Ftz-F1 (fushi tarazu factor 1) (), and transcribed from a gene designated the Ftz-F1 gene (). Ftz-F1 gene-deficient mice lack adrenal glands and gonads. Besides mammals, however, the SF-1/Ad4BP cDNA has only been isolated to date in fish and birds. To understand its role(s) for adrenal and gonadal development in vertebrates, cloning of this gene in animals other than mammals is required. In this study, we succeeded to isolate frog (Rana rugosa) SF-1/Ad4BP cDNA from a testis lambdagt10 cDNA library. It encoded a protein of 468 amino acids, and its open reading frame (ORF) shared 70% similarity with that of chicken OR2.1 (a SF-1/Ad4BP homologue) and 62% with bovine SF-1/Ad4BP. SF-1/Ad4BP mRNA was expressed in the testes, brains, adrenals/kidneys and spleens, but not ovaries, of adult frogs. In addition, we also cloned the 5'-untranslated region (4.6kb) of the SF-1/Ad4BP gene with exons I and II. Genomic structure analysis revealed that frog SF-1/Ad4BP was also transcribed from the same gene as that of mammals. However, many Ftz-F1-related proteins have been reported so far. The Ftz-F1 gene does not encode all of those Ftz-F1-related proteins. Thus, the name of Ftz-F1 is not adequate for the gene coding SF-1/Ad4BP. Here, we propose the use of SF-1/Ad4BP instead of Ftz-F1 for the gene that encodes SF-1/Ad4BP in vertebrates.

Molecular cloning of cDNA for cholesterol 7 alpha-hydroxylase from rat liver microsomes. Nucleotide sequence and expression.

A complete cDNA clone encoding cholesterol 7 alpha-hydroxylase was isolated from a rat liver cDNA library by the use of specific antibodies to the enzyme. The isolated cDNA clone was 3.6 kbp long and contained a 1509-bp open reading frame encoding 503 amino acid residues (Mr = 56,880). The identity of the cDNA was confirmed by expression of cholesterol 7 alpha-hydroxylase activity and the immunoreactive protein in COS cells transfected with pSVL expression vector carrying the cDNA insert. The primary structure of cholesterol 7 alpha-hydroxylase deduced from the nucleotide sequence of the cDNA indicated that the enzyme constitutes a novel P-450 family.

Possible steroid binding site common to adrenal cytochrome P-450scc and prostatic steroid binding protein.

By searching the entire PIR-protein-sequence data base, we have found that a dodecapeptide sequence in bovine adrenal cytochrome P-450scc is closely related to that in rat prostatic steroid binding protein. The two proteins belong to unrelated protein families, but both have steroids as substrates or ligands. Thus, the dodecapeptides may be important for substrate/ligand recognition in the individual proteins.

Transcription factor adrenal 4 binding protein as a marker of adrenocortical malignancy.

Adrenal 4 binding protein (Ad4BP) is a transcription factor that regulates the expression of the steroidogenic enzymes and is expressed primarily in steroidogenic cells. We immunolocalized Ad4BP in adrenocortical carcinoma (eight cases) and various malignancies that histologically simulate an adrenocortical carcinoma to evaluate the value of Ad4BP as an immunohistochemical marker of adrenocortical carcinoma. These malignancies examined were renal cell carcinoma (20 cases), hepatocellular carcinoma (10 cases), malignant melanoma (eight cases), ovarian (six cases) and uterine (three cases) clear cell carcinoma, large cell carcinoma of the lung (five cases), and pheochromocytoma (three cases). Nuclear Ad4BP immunoreactivity was observed only in adrenocortical carcinoma cases but not in other tumors examined. Almost all of the adrenocortical carcinoma cells were immunohistochemically positive for Ad4BP including cells associated with bizarre nuclei. These results show that application of Ad4BP immunostain can contribute greatly to the differential diagnosis of adrenocortical carcinoma.

Tissue-specific transcription of P-450(11 beta) gene in vitro.

The transcriptional activity of P-450(11 beta) gene was studied with an in vitro transcription system using nuclear extracts prepared from bovine adrenal cortex. Template plasmids were constructed with the promoter region of the bovine P-450(11 beta) gene and a G-less cassette as a reporter gene. Deletion analysis of the promoter region revealed two neighboring sites, Ad1 and Ad2, which are necessary for efficient transcription of the templates. These sites are highly conserved among bovine, mouse, and human genes. Though the Ad1 site, TGACGTGA, showed high homology to the consensus sequence of the cAMP-responsive element, TGACGTCA, with one base substitution, the Ad2 site showed no similarity to any regulatory element reported so far. Gel shift assay using synthetic nucleotides containing Ad1 and/or Ad2 indicated that three factors bound to these regions in adrenal cortex nuclear extract, two factors to Ad2 and one factor to Ad1. DNase I footprint analysis also showed the binding of factors to the Ad1 and Ad2 regions. Catenated synthetic nucleotides containing Ad1 and/or Ad2 inhibited the transcriptional activity of P-450(11 beta) gene. The P-450(11 beta) promoter expressed a stronger transcriptional activity in the nuclear extract of adrenal cortex than in that of liver. On the other hand, the promoter of alpha 1-antitrypsin gene, which is expressed only in liver, showed an opposite tissue specificity of transcription. Addition of adrenal cortex nuclear extract to liver nuclear extract activated specifically the P-450(11 beta) promoter in proportion to the quantity of adrenal cortex nuclear extract added.(ABSTRACT TRUNCATED AT 250 WORDS)

Cloning and characterization of bovine cytochrome P-450(11 beta) genes.

We isolated 4 different clones of the P-450(11 beta) gene from a bovine genomic library. These genomic clones were highly homologous with each other. Two of the isolated clones were pseudogenes. Determination of its nucleotide sequences indicated that the bovine P-450(11 beta) gene is divided into 9 exons by 8 introns and that it is about 8.5 kb in total length. The number of exons and the locations of intron insertion into the P-450(11 beta) gene are identical with those in the case of P-450(SCC), but different from those of other microsomal P-450s.

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene.

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)

Structural gene of cytochrome b-562 from the cytochrome b-c1 complex of Rhodobacter sphaeroides.

The structural gene coding for cytochrome b-562 isolated from the cytochrome b-c1 complex of Rhodobacter (Rhodopseudomonas) sphaeroides has been cloned. Its nucleotide sequence has been determined and the amino acid sequence was deduced therefrom. It consists of 157 amino acids (Mr 17,237) and contains four hydrophobic segments. The first 30 residues in the predicted amino acid sequence are the same as those determined for the NH2-terminal portion of purified cytochrome b-562. The amino acid composition is in accord with that determined for the pure protein. From the hydropathy profile and molar ratio of protoheme to cytochrome b-562, it is suggested that the structural and functional unit of the cytochrome is a two-heme cross-linked homodimer.

Site-directed mutagenesis of basic amino acid residues in the extension peptide of P-450(SCC) precursor: effects on the import of the precursor into mitochondria.

The precursor of cytochrome P-450(SCC) (preP-450(SCC], an inner membrane protein of adrenal cortex mitochondria, has an extension peptide consisting of 39 amino acids which is thought to play an essential role in the import of the precursor into mitochondria. The amino terminal portion of the extension peptide contains three positively charged amino acid residues, Arg(4), Arg(9), and Lys(14). To investigate their role in the import of preP-450(SCC) into mitochondria, they were replaced by other amino acids, Ser or Thr, by site-directed mutagenesis. The import of mutated preP-450(SCC)s with single amino acid substitution was much less efficient than with the original precursor. The mutated preP-450(SCC)s with two or three substitutions were not imported. These results suggest that the positively charged amino acid residues in the amino terminal portion of the extension peptide are essential for the import of preP-450(SCC) into mitochondria.

Position specificity in n-hexane hydroxylation by two forms of cytochrome P-450 in rat liver microsomes.

The hydroxylation of n-hexane by rat liver microsomes was studied and the contribution of different molecular species of cytochrome P-450 to the hydroxylation reaction was examined. In the case of untreated rats, the products of NADPH-dependent n-hexane hydroxylation were 1-, 2-, and 3-hexanols, and the major one was 2-hexanol. Phenobarbital (PB) treatment of animals resulted in a significant increase of the hydroxylation activity. The formation of 2- and 3-hexanols was much more significantly increased than that of 1-hexanol. On the other hand, 3-methylcholanthrene (MC) treatment stimulated the formation of 3-hexanol and the formation of the other two isomeric alcohols was rather decreased. These observations suggested the position specificities of the PB-inducible form (P-450(PB)) and MC-inducible form (P-450(MC)) of cytochrome P-450 in the hydroxylation of n-hexane. Inhibition experiments using antibodies specific to P-450(PB) and P-450(MC) also indicated that P-450(PB) was more active in the hydroxylation at the 2-position whereas P-450(MC) was more specific for the 3-position. NADPH-dependent n-hexane hydroxylation systems were reconstituted by the use of purified NADPH-cytochrome P-450 reductase and P-450(PB) or P-450(MC), and the activities of the reconstituted systems supported the proposed position specificities of these two forms of cytochrome P-450 in n-hexane hydroxylation.

Contribution of Ad4BP, a steroidogenic cell-specific transcription factor, to regulation of the human CYP11A and bovine CYP11B genes through their distal promoters.

We analyzed the upstream regions of the human CYP11A and bovine CYP11B genes, and identified a distal promoter in each gene. The distal promoters are located at -1.8 to -1.5 kb in the upstream region of the CYP11A gene and -1.5 to -1.1 kb in the upstream region of the CYP11B gene. Transient transfection of CAT plasmid carrying each of the two distal promoters indicated that the regions had a transcriptional activating function and that the function was stimulated by cAMP. The basal and cAMP-stimulated transcriptional activities were detected only in steroidogenic cells. On structural analyses of the regions, we identified two Ad4 sites and a cAMP responsive element in the distal promoter of CYP11A, and two Ad4 sites and one NF-IL6 binding site in the distal promoter of CYP11B. The presence of an Ad4 site in common suggests its major contribution of the transcriptional activation. We also investigated the functional interactions between the distal promoters and basal promoters of both genes. Interestingly, the two distal promoters showed different requirements as to the basal promoter.

Molecular cloning and nucleotide sequence of cDNA of microsomal carboxyesterase E1 of rat liver.

cDNA clones of the mRNA for rat liver carboxyesterase E1, one of the carboxyesterases exclusively located on the luminal side of microsomal vesicles, were isolated. Sequence analysis of 2 kbp long cDNA revealed the primary structure of carboxyesterase E1, which consisted of 549 amino acids (Mr 60, 171.71) and contained an extra peptide of 18 amino acids at the NH2-terminus of the mature enzyme. Comparison of the deduced primary structure and sequences of some proteolytic fragments of the purified enzyme indicated the multiplicity of the enzyme. The extra peptide at the NH2-terminal had features in common with the signal peptides of most secretory proteins. However, no polar amino acid residues existed before the hydrophobic core of the signal peptide. A new interpretation is proposed to explain how the signal peptide without the NH2-terminal polar residues works. A tetrapeptide (KDEL) which was shown to keep a few microsomal proteins in the lumen of the endoplasmic reticulum was not found in the primary structure of carboxyesterase E1, which suggested the existence of another mechanism for retention of proteins in the lumen of endoplasmic reticulum. Carboxyesterase E1 showed significant homology with the COOH-terminal portion of thyroglobulin.

Gene structure of human cytochrome P-450(SCC), cholesterol desmolase.

Four independent clones containing a part of the P-450(SCC), cholesterol desmolase, gene were isolated from human genomic libraries using bovine P-450(SCC) cDNA as a probe. These clones covered the entire P-450(SCC) gene except for a part of the 1st intron. The gene is at least 20 kb long and is split into 9 exons by 8 introns. The sequence analysis revealed that the nine separated exons code for a primary structure consisting of 521 amino acids which shows 72% homology with that of bovine P-450(SCC). A CATT sequence and a TATAAT sequence, which are possibly a "CAT" box, and a "TATA" box, respectively, are present 129 and 91 bp upstream from the initiation codon. An unusual exon/intron junctional sequence that begins with GC was found in the 6th intron of the gene. A putative extension peptide consisting of 39 amino acids was found in the sequence of human P-450(SCC) by comparison with that of the bovine counterpart. Two conserved regions were found in the extension peptide of these two forms of P-450(SCC), suggesting a functional role of the portions in the mitochondrial localization and processing of P-450(SCC) precursor. The mature form of human P-450(SCC) has only one cysteine residue, which was located in the center of the HR2 region (Gotoh et al. (1983) J. Biochem. 97, 807-817). This observation established beyond doubt that the sole cysteine residue in the HR2 region is the 5th ligand to the heme.