Tricuspid valve dysplasia with severe tricuspid regurgitation: fetal pulmonary artery size predicts lung viability in the presence of small lung volumes.

Congenital tricuspid valve disease (Ebstein's anomaly, tricuspid valve dysplasia) with severe tricuspid regurgitation and cardiomegaly is associated with poor prognosis. Fetal echocardiography can accurately measure right atrial enlargement, which is associated with a poor prognosis in the fetus with tricuspid valve disease. Fetal lung volumetric assessments have been used in an attempt to predict viability of fetuses using ultrasonogram and prenatal MRI. We describe a fetus with tricuspid dysplasia, severe tricuspid regurgitation, right atrial enlargement and markedly reduced lung volumes. The early gestational onset of cardiomegaly with bilateral lung compression raised the possibility of severe lung hypoplasia with decreased broncho-alveolar development. Use of fetal echocardiography with measurement of pulmonary artery size combined with prenatal MRI scanning of lung volumes resulted in an improved understanding of this anomaly and directed the management strategy towards a successful Fontan circulation.

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Identification and management of neonatal skull fractures.

OBJECTIVE: Suspected skull fractures in the neonate are uncommon and present a management dilemma. We hypothesized that skull fractures are more common than reported in the literature and that few infants require any intervention. STUDY DESIGN: We retrospectively reviewed the charts of 21 infants referred to our level IV Neonatal Intensive Care Unit for possible skull fracture over a 3-year period after birth trauma, suspicious findings on clinical exam, or accidental falls in the birth hospital. RESULTS: Skull films at the birth hospital were unreliable for fracture in 23% of cases. Seven of nine infants with accidental falls had fracture on computed tomography scan. Only three infants required neurosurgical intervention, all after severe birth trauma associated with instrumentation. CONCLUSION: Skull fractures are more common than previously reported in neonates after accidental falls, but few infants with skull fractures require neurosurgical intervention.

The oxygen trail: tissue oxygenation.

Aerobic cellular respiration depends on the efficient supply of oxygen and substrate to the mitochondria. There is an oxygen cascade from the environment to the subcellular environment. Efficient oxygen delivery depends on the coordinated interaction between the respiratory and circulatory systems. The circulation at both macro- and microvascular levels is under the control of humoral and neural factors. There is local autoregulation of flow at the tissue level by metabolic factors which reflect the energy state of the tissues. The response to hypoxia involves the activation of cytokines and genetically controlled factors which maximise capillary perfusion and haemoglobin concentration, and regulate cell metabolism. The formation of reactive oxygen species under such conditions has a detrimental effect on the mitochondria with respiratory chain dysfunction, increased permeability transition, and cell death. This review aims to explore the mechanisms by which the body attempts to maintain tissue oxygen levels at conditions optimal for cell survival.