RESUMO
Household air pollution from biomass cookstoves is estimated to be responsible for more than two and a half million premature deaths annually, primarily in low and middle-income countries where cardiometabolic disorders, such as Type II Diabetes, are increasing. Growing evidence supports a link between ambient air pollution and diabetes, but evidence for household air pollution is limited. This cross-sectional study of 142 women (72 with traditional stoves and 70 with cleaner-burning Justa stoves) in rural Honduras evaluated the association of exposure to household air pollution (stove type, 24-hour average kitchen and personal fine particulate matter [PM2.5 ] mass and black carbon) with glycated hemoglobin (HbA1c) levels and diabetic status based on HbA1c levels. The prevalence ratio (PR) per interquartile range increase in pollution concentration indicated higher prevalence of prediabetes/diabetes (vs normal HbA1c) for all pollutant measures (eg, PR per 84 µg/m3 increase in personal PM2.5 , 1.49; 95% confidence interval [CI], 1.11-2.01). Results for HbA1c as a continuous variable were generally in the hypothesized direction. These results provide some evidence linking household air pollution with the prevalence of prediabetes/diabetes, and, if confirmed, suggest that the global public health impact of household air pollution may be broader than currently estimated.
RESUMO
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.
RESUMO
Sarcopenic obesity (SO) is defined as the combination of excess fat mass (obesity) and low skeletal muscle mass and function (sarcopenia). The identification and classification of factors related to SO would favor better prevention and diagnosis. The present article aimed to (i) define a list of factors related with SO based on literature analysis, (ii) identify clinical conditions linked with SO development from literature search and (iii) evaluate their relevance and the potential research gaps by consulting an expert panel. From 4746 articles screened, 240 articles were selected for extraction of the factors associated with SO. Factors were classified according to their frequency in the literature. Clinical conditions were also recorded. Then, they were evaluated by a panel of expert for evaluation of their relevance in SO development. Experts also suggested additional factors. Thirty-nine unique factors were extracted from the papers and additional eleven factors suggested by a panel of experts in the SO field. The frequency in the literature showed insulin resistance, dyslipidemia, lack of exercise training, inflammation and hypertension as the most frequent factors associated with SO whereas experts ranked low spontaneous physical activity, protein and energy intakes, low exercise training and aging as the most important. Although literature and expert panel presented some differences, this first list of associated factors could help to identify patients at risk of SO. Further work is needed to confirm the contribution of factors associated with SO among the population overtime or in randomized controlled trials to demonstrate causality.
Assuntos
Obesidade , Sarcopenia , Humanos , Obesidade/complicações , Fatores de Risco , Exercício Físico , Músculo Esquelético/fisiopatologia , Resistência à Insulina , Envelhecimento/fisiologia , VotaçãoRESUMO
The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 x 10(-4) and 8 x 10(-4) nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 x 10(-4) and 11 x 10(-4) nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.
Assuntos
Evolução Molecular , Doenças das Plantas/virologia , Vírus de Plantas/genética , Vírus de RNA/genética , África , Sequência de Bases , Mutação , Oryza , Homologia de SequênciaRESUMO
Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.
RESUMO
In Côte d'Ivoire, the S2 strain of Rice yellow mottle virus (RYMV) predominated in the forested zones, including the "rice belt" to the west, in each of the cropping systems where rice was grown. The S1 strain occurred more frequently in the northern Guinean savanna, and only S1 isolates were found further north in the Sahelo-Soudanian zones. In mixed infection, S2 dominated over S1 both in viral capsid and RNA contents under temperature regimes encompassing those observed in savanna and forested zones of Côte d'Ivoire. There was no evidence of interactions in virus accumulation between the West African strains S1 or S2 with the more distantly related East African strain S4. Field trials emphasized the impact of RYMV, which induced yield losses of 40 to 60% in several widely grown cultivars of Oryza sativa indica and O. sativa japonica. We report the high resistance of the O. indica cv. Gigante under field conditions which was apparent with all the S1 and S2 isolates tested. Responses to RYMV infection of several cultivars were isolate dependent. With most differential cultivars, responses were not strain specific, with the exception of the O. japonica cv. Idsa6, in which the S2 isolates always induced higher yield losses than the S1 isolates.
RESUMO
A series of 54 patients with chronic aortic insufficiency with little (38) or no symptoms (16) were studied. All had severe regurgitation leading to discussion of aortic valve replacement. All patients (44 male and 10 female) underwent clinical, radiological, electrocardiographic, hemodynamic and angiographic investigation with assessment of left ventricular volume by monoplane 30 degrees cineangiography on entry to the study. They were then followed-up for an average of 36 months and the data assessed in a prospective study. At the end of the 36 months period, 4 patients had been lost to follow-up but were still alive, 31 patients were unchanged (Group A) and 19 patients had deteriorated (Group B). The parameters characterising Group B (P less than 0.001) were: corrected cardiac surface area of 1,72 +/- 0,13, a Sokolow index of 60,1 +/- 18,8 mm an ejection fraction of 56.2 +/- 14 % and a left ventricular end diastolic value of 225,3 ml/m2. Therefore, in chronic asymptomatic aortic incompetence, the parameters of cardiac dilatation, cardiac surface area greater than 1,70 and left ventricular end diastolic volume greater than 170 ml/m2, would appear to be good indications for aortic valve replacement. However, the values are nor formal criteria because a discrepancy between symptoms and the volumetric measurements may be observed in some cases, and also large variations in these measurements may be observed in patients in the same functional class.
Assuntos
Insuficiência da Valva Aórtica/fisiopatologia , Adulto , Insuficiência da Valva Aórtica/mortalidade , Doença Crônica , Feminino , Seguimentos , Hemodinâmica , Humanos , Masculino , Pessoa de Meia-Idade , Prognóstico , Fatores de TempoAssuntos
Cobre/deficiência , Doenças da Medula Espinal/sangue , Idoso de 80 Anos ou mais , Vértebras Cervicais/diagnóstico por imagem , Cobre/sangue , Diagnóstico Diferencial , Feminino , Humanos , Doenças da Medula Espinal/diagnóstico por imagem , Deficiência de Vitamina B 12/sangue , Deficiência de Vitamina B 12/diagnóstico por imagem , Deficiência de Vitamina B 12/tratamento farmacológicoAssuntos
Doença das Coronárias/cirurgia , Revascularização Miocárdica , Antagonistas Adrenérgicos beta/uso terapêutico , Idoso , Angina Pectoris/cirurgia , Anticoagulantes/uso terapêutico , Doença das Coronárias/tratamento farmacológico , Humanos , Pessoa de Meia-Idade , Revascularização Miocárdica/métodos , Revascularização Miocárdica/mortalidade , PrognósticoRESUMO
The roles of guttation fluid, irrigation water, contact between plants and transplantation into contaminated soil in the transmission of Rice yellow mottle virus (RYMV) were assessed. RYMV presence and infectivity were tested by Enzyme-Linked Immunosorbent Assay (ELISA) and by inoculation to susceptible rice cultivar BG90-2. The virus was readily detected in guttation fluid collected from infected rice plants. Transmission tests from this fluid led to high disease incidence (86.6%). Irrigation water collected at the base of infected plants growing in pots was less infectious, as inoculations led to disease incidences below 40%. No virus was detected and could be transmitted from field-irrigation water. Up to 44% healthy rice plants whose leaves were in contact with those of infected plants became infected but, no transmission occurred through intertwined roots. Transplantation of rice seedling into virus-contaminated soil also led to plant infection. However, virus survival in the soil decrease rapidly and infectivity was completely lost 14 days after soil contamination. Altogether, these results indicated that high planting densities of rice are likely to favour secondary spread of rice yellow mottle disease. Transplantation of rice seedlings not earlier than 2 weeks after soil preparation should prevent soil transmission of the virus. Although guttation fluid is highly infectious its contribution to virus infectivity in irrigation water is negligible as field-irrigation water was not found to be an infectious source for RYMV.
Assuntos
Oryza/metabolismo , Oryza/virologia , Doenças das Plantas/virologia , Vírus de Plantas/genética , Plantas/virologia , Vírus de RNA/metabolismo , Tenuivirus/genética , Ensaio de Imunoadsorção Enzimática , Folhas de Planta/virologia , Fenômenos Fisiológicos Vegetais , Raízes de Plantas/virologia , Vírus de Plantas/fisiologia , Plantas/genética , Solo , ÁguaRESUMO
Phylogeography of Rice yellow mottle virus (RYMV) was reconstructed from the coat protein gene sequences of a selection of 173 isolates from the 14 countries of mainland Africa where the disease occurred and from the full sequences of 16 representative isolates. Genetic variation was linked to geographical distribution and not to host species as isolates from wild rice always clustered with isolates from cultivated rice of the same region. Genetic variation was not associated to agro-ecology, viral interference and insect vector species. Distinct RYMV lineages occurred in East, Central and West Africa, although the Central African lineage included isolates from Benin, Togo and Niger at the west, adjacent to countries of the West African lineage. Genetic subdivision at finer geographical scales was apparent within lineages of Central and West Africa, although less pronounced than in East Africa. Physical obstacles, but also habitat fragmentation, as exemplified by the small low-lying island of Pemba offshore Tanzania mainland, explained strain localization. Three new highly divergent strains were found in eastern Tanzania. By contrast, intensive surveys in Cote d'Ivoire and Guinea at the west of Africa did not reveal any new variant. Altogether, this supported the view that the Eastern Arc Mountains biodiversity hotspot was the centre of origin of RYMV and that the virus spread subsequently from east to west across Africa. In West Africa, specific strains occurred in the Inner Niger Delta and suggested it was a secondary centre of diversification. Processes for diversification and dispersion of RYMV are proposed.
Assuntos
Demografia , Meio Ambiente , Variação Genética , Genoma Viral , Oryza/virologia , Filogenia , Vírus de RNA/genética , África , Sequência de Bases , Proteínas do Capsídeo/genética , Análise por Conglomerados , Geografia , Funções Verossimilhança , Modelos Genéticos , Dados de Sequência Molecular , Dinâmica Populacional , Análise de Sequência de DNARESUMO
The coat protein gene (ORF4) and the 3' untranslated region of a sample of 40 isolates of Rice yellow mottle virus (RYMV), 32 from West Africa and 8 from East Africa, have been sequenced. Five major strains were differentiated, three from West Africa (S1, S2, S3) and two from East Africa (S4, S5), with a spatial overlap of the strains within each of these two regions. Nucleotide and amino-acid divergence between strains was up to 11%. Although more isolates from West African were sequenced, variability was twofold lower than among East African isolates. Variability in ORF4 and in ORF2 coincided. Within strain and within isolate variations in nucleotide sequences were low. Bipartite nuclear targeting motif, Ca2+ binding sites and at least two stretches of amino-acids were conserved among the 40 RYMV isolates and the other sobemoviruses. Variants associating sequence motifs characteristic of different strains have been found, possibly resulting from recombination events. Differences in pathogenicity among isolates were associated with changes of amino-acids in the bipartite nuclear targeting motif of the R domain of the capsid protein, and around conserved positions 151-154 of the S domain. We hypothesise that the observed pattern of variation of RYMV reflects the effect of spatial isolation between East and West Africa coupled with adaptive changes associated to the original virus reservoirs of the different strains.
Assuntos
Capsídeo/genética , Genoma Viral , Vírus do Mosaico/genética , Oryza/virologia , Regiões 3' não Traduzidas/genética , África , Sequência de Aminoácidos , Clonagem Molecular , Sequência Consenso , Dados de Sequência Molecular , Fases de Leitura Aberta , Filogenia , Proteínas Recombinantes/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Alinhamento de SequênciaRESUMO
Ribosomal vaccines prepared from purified bacterial ribosomes induce the production of specific antibodies in female OF1 mice when administered to the animals both with incomplete Freund's adjuvant or purified Klebsiella pneumoniae cell wall proteoglycans. The study of these fractions concerned purified ribosomes extracted from the following bacteria: Klebsiella pneumoniae, Haemophilius influenzae, Steptococcus pneumoniae, Streptococcus pyogenes A12. Specific antibodies determination by immunoelectro diffusion (IED) and passive hemagglutination (PHA) were used to study the immune response.
Assuntos
Vacinas Bacterianas/imunologia , Ribossomos/imunologia , Adjuvantes Imunológicos , Animais , Anticorpos Antibacterianos/análise , Cricetinae , Feminino , Testes de Hemaglutinação , Imunodifusão , Imunoeletroforese , Masculino , Mesocricetus , Camundongos , Coelhos , Ovinos , VacinaçãoRESUMO
Upon testing the individual fractions of a composite bacterial vaccine for biological activities, a potent immuno-stimulatory capacity could be demonstrated within a crude membrane proteoglycan preparation from Klebsiella pneumoniae. One of its characteristic features was the capacity to induce alpha-type interferon and increased NK activity in vivo in mice, following intraperitoneal or oral administration. A highly purified fraction from the crude preparation was obtained using alkaline hydrolysis, delipidation and size fractionation. This fraction was shown to be a very potent inducer of NK cells in vivo or in vitro, where in the latter systems concentrations as low as 0.1 microgramme per ml were highly efficient.
Assuntos
Proteínas da Membrana Bacteriana Externa/imunologia , Células Matadoras Naturais/imunologia , Klebsiella pneumoniae , Proteoglicanas/imunologia , Adjuvantes Imunológicos/imunologia , Animais , Cromatografia em Gel , Citotoxicidade Imunológica/efeitos dos fármacos , Relação Dose-Resposta a Droga , Feminino , Injeções Intraperitoneais , Interferon Tipo I/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos , Baço/imunologia , Fatores de TempoRESUMO
We have studied a new vaccine of ribosomal nature associated with glycoprotein cell walls from Klebsiella pneumoniae which served as an immunoadjuvant. Thus vaccine was administered by the aerosol route to working men free of any important disease, especially of respiratory disease. A total of 104 men working for the Commissariat à l'Energie Atomique, all volunteers, were randomly placed into two groups. During the first period, 51 patients (group I) were vaccinated three times a week during 5 weeks, and the second group was used as control. During the second period, which started on day 225, the control group received the vaccine, and the first group was revaccinated. Results of this experience show a significant difference in the immunity of the two groups. The specific antibodies increased with vaccination as illustrated by chi-square test (Yates correction), which corresponds to an independent probability equal to 0 (P = 0.5 X 10-4).
Assuntos
Adjuvantes Imunológicos , Anticorpos Antibacterianos/biossíntese , Vacinas Bacterianas , Klebsiella pneumoniae/imunologia , Ribossomos/imunologia , Especificidade de Anticorpos , Parede Celular/imunologia , Haemophilus influenzae/imunologia , Humanos , Masculino , Streptococcus pneumoniae/imunologia , Streptococcus pyogenes/imunologia , Fatores de TempoRESUMO
Over the past twenty-five years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of micro-organisms responsible for human and animal diseases. Accurate biochemical characterization of ribosomes always reveals trace amounts of non-ribosomal components such as short polysaccharides strongly linked to ribosomal RNA after phenol extraction even under denaturing conditions. rRNA-antigen complexes have been purified from Klebsiella pneumoniae ribosomes inducing high level of protection against homologous experimental infection in mice. Monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice have been used to study the mechanism of the protection induced by ribosomes and to characterize their "immunogenic principle". These investigations have clearly shown the presence on ribosomes of epitopes corresponding to antigens normally exposed on the membrane of the bacteria. In the original concept of "ribosomal immunotherapy" that we have developed, ribosomes can be considered as natural carriers for cell surface epitopes, presenting them to the immune system in a highly immunogenic configuration.
Assuntos
Antígenos de Bactérias/imunologia , Antígenos de Superfície/imunologia , Artefatos , Vacinas Bacterianas , Klebsiella pneumoniae/imunologia , Polissacarídeos Bacterianos/imunologia , Ribossomos/imunologia , Animais , Anticorpos Antibacterianos/administração & dosagem , Anticorpos Antibacterianos/imunologia , Anticorpos Monoclonais/administração & dosagem , Anticorpos Monoclonais/imunologia , Antígenos de Bactérias/administração & dosagem , Antígenos de Bactérias/isolamento & purificação , Antígenos de Superfície/administração & dosagem , Antígenos de Superfície/isolamento & purificação , Vacinas Bacterianas/imunologia , Fracionamento Celular , Cromatografia de Afinidade , Portadores de Fármacos , Endotoxinas/imunologia , Epitopos/imunologia , Epitopos/isolamento & purificação , Imunização Passiva , Infecções por Klebsiella/prevenção & controle , Klebsiella pneumoniae/química , Lipopolissacarídeos/imunologia , Camundongos , Camundongos Endogâmicos BALB C/imunologia , Polissacarídeos Bacterianos/isolamento & purificação , RNA Ribossômico/imunologia , RNA Ribossômico/metabolismo , Frações Subcelulares/imunologiaRESUMO
The current possibility of measuring at one and the same time serum IgA and sputum SIgA, has led to precision in knowledge of IgA deficits in respiratory pathology. The authors report 21 cases detected in a group of 1000 patients (adults, adolescents and children), suffering from various chronic respiratory disorders and who had either total deficits in serum and sputum IgA (6 cases) or partial deficits (15 cases - mixed [5], serum IgA [5i1, sputum IgA [5]. In 9 cases the assoicated respiratory disorder was bronchiectasis, in 7 recurrent rhino-tracheo-bronchitis and in 5 asthma. In no cases were any extra-respiratory manifestations noted, in particular digestive disturbance or auto-immune disease. In some cases there was an associated deficit in IgE and, much less commonly, in IgG or M. Cellular immunity was not altered. The authors then discuss the place of IgA and SIgA deficitis in the pathogenesis of chronic respiratory pathology as well as their substitutive treatment using natural human immunoglobulins and the results thereof.