Molecular motors: the driving force behind mammalian left-right development.

The molecular motors dynein and kinesin are large protein complexes that convert the energy generated by ATP hydrolysis into directional movement along the microtubule cytoskeleton. They are required for a myriad of cellular processes, including mitotic spindle movement, axonal and vesicular transport, and ciliary beating. Recently, it has been shown that, in addition, they have a unique role during embryonic patterning: they are required to orient and establish the left-right axis in early vertebrate development.

Legless, a novel mutation found in PHT1-1 transgenic mice.

In this report it is shown that the PHT1-1 line of transgenic mice exhibited a pattern of developmental abnormalities when the mice were homozygous for the transgene insertion. Hindlimbs were uniformly truncated at the distal end of the femur, resulting in a "legless" appearance. Forelimbs lacked anterior structures including digits and the radius. The brains had many defects, particularly in the anterior structures of the cerebrum, including the olfactory lobes. Craniofacial malformations in the form of facial clefts also commonly occurred. Furthermore, heterozygotes of this line, with only one copy of the DNA insertion, and other transgenic lines carrying the same DNA construct appeared normal, suggesting that in the PHT1-1 line a gene significant in mammalian development has been disrupted.

Multistep control of pituitary organogenesis.

Lhx3 and Lhx4 (Gsh4), two closely related LIM homeobox genes, determine formation of the pituitary gland in mice. Rathke's pouch is formed in two steps-first as a rudiment and later as a definitive pouch. Lhx3 and Lhx4 have redundant control over formation of the definitive pouch. Lhx3 controls a subsequent step of pituitary fate commitment. Thereafter, Lhx3 and Lhx4 together regulate proliferation and differentiation of pituitary-specific cell lineages. Thus, Lhx3 and Lhx4 dictate pituitary organ identity by controlling developmental decisions at multiple stages of organogenesis.

Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences.

Using transgenic mice, we have defined novel gene regulatory elements, termed "facilitators." These elements bilaterally flank, by up to 1 kb, a 200-bp T-cell-specific enhancer domain in the human adenosine deaminase (ADA) gene. Facilitators were essential for gene copy-proportional and integration site-independent reporter expression in transgenic thymocytes, but they had no effect on the enhancer in transfected T cells. Both segments were required. Individual segments had no activity. A lack of facilitator function caused positional susceptibility and prevented DNase I-hypersensitive site formation at the enhancer. The segments were required to be at opposed ends of the enhancer, and they could not be grouped together. Reversing the orientation of a facilitator segment caused a partial loss of function, suggesting involvement of a stereospecific chromatin structure. trans-acting factor access to enhancer elements was modeled by exposing nuclei to a restriction endonuclease. The enhancer domain was accessible to the 4-cutter DpnII in a tissue- and cell-type-specific fashion. However, unlike DNase I hypersensitivity and gene expression, accessibility to the endonuclease could occur without the facilitator segments, suggesting that an accessible chromatin domain is an intermediate state in the activational pathway. These results suggest that facilitators (i) are distinct from yet positionally constrained to the enhancer, (ii) participate in a chromatin structure transition that is necessary for the DNase I hypersensitivity and the transcriptional activating function of the enhancer, and (iii) act after cell-type-specific accessibility to the enhancer sequences is established by factors that do not require the facilitators to be present.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Two CCAAT boxes in a novel inverted repeat motif are required for Hlx homeobox gene expression.

Hlx is a homeobox transcription factor gene required for normal intestinal and hepatic growth in development. We previously found high sequence identity and 17 conserved consensus cis-regulatory/transcription factor binding elements in the mouse and human Hlx 5' regions. A 594 bp sequence in the Hlx 5' region possessing the same activity in driving luciferase expression as larger Hlx 5' sequences had three segments each necessary but not sufficient for luciferase expression in NIH 3T3 cells (which express Hlx). Nine of the conserved putative regulatory elements are positioned within these segments, including two CCAAT boxes on opposite strands within a conserved 44 bp inverted repeat sequence. To test the hypothesis that these elements are required for promoter activity, we compared the reporter expression activity of segments containing mutations of these elements with activity of the parent Hlx promoter sequence. We found that mutation of either CCAAT box or a conserved AP-2 site resulted in a significant decrease in promoter activity. Restoration of the inverted repeat with complementary mutations of both CCAAT boxes did not restore activity. Further, mutation of other portions of the inverted repeat did not affect promoter activity. Mutation of other elements had no effect on promoter activity.

Malformations of the heart, kidney, palate, and skeleton in alpha-MHC-Hoxb-7 transgenic mice.

To begin to define the genetic network involved in cardiogenesis, we generated mice bearing the alpha-myosin heavy chain (MHC)-Hoxb-7 transgene. We hypothesized that using the cardiac-specific alpha-MHC promoter, we can direct ectopic expression of Hoxb-7 in the heart and perturb its normal development. Both whole mount in situ hybridization and northern analyses showed that this alpha-MHC promoter resulted in transgene expression in the developing heart. Severe ventricular septal defects (VSD) were found in several mutant mice. Interestingly, transgenic mice were observed to have other malformations as well, including cleft palate, renal anomalies, and skeletal abnormalities in the craniocervical and costosternal regions. The kidney defect consisted of double ureter and pelvis. In summary, we have shown that a dominant gain-of-function mutation of Hoxb-7 using the murine alpha-MHC promoter results in perturbation of the genetic circuitry underlying multiple developmental processes, including cardiogenesis. Misexpression of Hoxb-7 during heart development may be involved in the pathogenesis of VSD.

Gsh-2, a murine homeobox gene expressed in the developing brain.

A novel murine dispersed homeobox gene, designated Gsh-2, is described. Analysis of cDNA sequence, including the full open reading frame, reveals an encoded homeodomain that is surprisingly similar to those of the Antennapedia-type clustered Hox genes. In addition, the encoded protein includes polyhistidine and polyalanine tracts, as observed for several other genes of developmental significance. In situ hybridizations showed Gsh-2 expression in the developing central nervous system, including the ganglionic eminences of the forebrain, the diencephalon, which gives rise to the thalamus and hypothalamus, and in the hindbrain. Furthermore, a random oligonucleotide selection and PCR amplification procedure was used to define a target DNA binding sequence, CNAATTAG, as a first step towards the identification of downstream target genes.

Ectopic expression of Hox-2.3 induces craniofacial and skeletal malformations in transgenic mice.

To better understand the role of the Hox-2.3 murine homeobox gene during development, a dominant gain-of-function mutation was generated. The developmental malformations that resulted when the chicken beta-actin promoter was used to direct widespread expression of the Hox-2.3 gene in transgenic mice included early postnatal death as well as craniofacial abnormalities, including open eyes and cleft palate. Ventricular septal defects were also observed in the hearts of three transgenic mice. Skeletal malformations were seen in the bones of the craniocervical transition, with the occipital, basisphenoid, and atlas bones deficient or misshapen. Interestingly, one mutant exhibited an extra pair of ribs as well as alterations in cervical vertebrae identities. Some of the malformations observed in Hox-2.3 gain-of-function mutants overlap with those seen in Hox-1.1 and Hox-2.2 misexpression mutants which suggests functional similarities between paralogous homeobox genes. The results of these experiments are consistent with a role for Hox-2.3 in specifying positional information during development.

Characterization of npas3, a novel basic helix-loop-helix PAS gene expressed in the developing mouse nervous system.

Here we describe the cloning and expression pattern of a new bHLH-PAS domain gene, Npas3. Npas3 shares 50.2% amino acid sequence identity with Npas1 and a lesser similarity with other members of the bHLH-PAS domain family of transcription factors. Northern blot analysis detected Npas3 mRNA between 11.5 and 17.5 d.p.c. in embryonic development and exclusively in the adult brain. Whole-mount and section in situ hybridization assays revealed expression of Npas3 between 9.5 and 11.5 d.p.c. in the developing neural tube. In addition, Npas3 mRNA was expressed throughout the neuroepithelium of the developing central nervous system between 10. 5 and 12.5 d.p.c. Interestingly, at 14.5 d.p.c., the expression of Npas3 mRNA became restricted to the neopallial layer of the cortex. At 12.5 d.p.c., Npas3 mRNA was evident in nonneural tissues such as the developing dermis and mesenchyme surrounding the otic and nasal placodes. Expression was also detected in the developing cardiac valves, limb and developing kidney.

The Evi1 proto-oncogene is required at midgestation for neural, heart, and paraxial mesenchyme development.

The ecotropic viral integration site-1 (Evi1) locus was initially identified as a common site of retroviral integration in myeloid tumors of the AKXD-23 recombinant inbred mouse strain. The full-length Evi1 transcript encodes a putative transcription factor, containing ten zinc finger motifs found within two domains of the protein. To determine the biological function of the Evi1 proto-oncogene, the full-length, but not an alternately spliced, transcript was disrupted using targeted mutagenesis in embryonic stem cells. Evi1 homozygous mutant embryos die at approximately 10.5 days post coitum. Mutants were distinguished at 10.5 days post coitum by widespread hypocellularity, hemorrhaging, and disruption in the development of paraxial mesenchyme. In addition, defects in the heart, somites, and cranial ganglia were detected and the peripheral nervous system failed to develop. These results correlated with whole-mount in situ hybridization analyses of embryos which showed expression of the Evi1 proto-oncogene in embryonic mesoderm and neural crest-derived cells associated with the peripheral nervous system. These data suggest that Evi1 has important roles in general cell proliferation, vascularization, and cell-specific developmental signaling, at midgestation.

Spx1, a novel X-linked homeobox gene expressed during spermatogenesis.

Spx1, a novel mouse homeobox gene, encodes a homeodomain characteristic of the paired-like class of homeobox genes and has been mapped to the distal end of the X chromosome. Northern blot hybridization of adult tissues detected high levels of a single Spx1 transcript in the testis. Further analysis by in situ hybridization revealed predominant Spx1 expression within the spermatogonia/preleptotene spermatocytes and round spermatids of spermatogenic stages IV-VII. These expression data suggest SPX1 may play a role in the regulation of spermatogenesis.

Homeobox genes and heart development.

Genes encoding transcription factors are fundamental to developmental processes because their DNA-binding proteins can control expression of a multitude of genes. Therefore, activation of a single transcription factor gene can act as a genetic switch that controls the developmental destinies of groups of cells. Results of expression studies and mutational analyses in mice and Drosophila suggest an essential role in heart development for the homeobox class of transcription factor genes. Understanding the genetic circuitry of cardiogenesis will facilitate the identification of individuals with inherited cardiac diseases, and the possible prevention of these diseases with drug therapy or lifestyle modification. It may also allow for genetic counseling of affected individuals and family members and enable gene therapy aimed at correcting these defects.

Rearranged sequences of a human Kpn I element.

The complete nucleotide sequence of a human Kpn I element inserted into alpha-satellite DNA is presented. This sequence reveals several features of interest. First, a large block of DNA normally associated with Kpn I elements has been deleted. Second, the order of the remaining sequences is permuted in a manner that cannot be accounted for by simple inversion. Third, a significant open reading frame of 675 bases is detected.

DNA sequence analysis of a Drosophila foldback transposable element rearrangement.

The complete nucleotide sequence of a DNA rearrangement associated with the foldback 4 (FB 4) transposable element is presented. The results demonstrate that the entire loop sequence and almost all of one of the inverted terminal repeats is absent. Moreover, the sequence of the remaining inverted repeat suggests that the FB elements might undergo inversions via recombinations between the two inverted repeats of a single element.

Distinct subfamilies of primate L1Gg retroposons, with some elements carrying tandem repeats in the 5' region.

Two subfamilies of L1 elements, differing dramatically in the first 1.2 kb of sequence at their 5' ends, were identified in the prosimian primate, Galago garnetti. Interesting patterns of sequence similarity were observed between the galago subfamilies, and with the L1s from human and from another prosimian, the slow loris. Furthermore, members of one of the subfamilies have six to eight tandemly repeated units of 73 bp, starting about 730 bp from their 5' ends. Such tandem repeats have not been reported in other primate L1s, but a striking sequence similarity was found between the galago tandem repeats and those previously described at the 5' termini of some mouse L1s [Loeb, D. D. et al. Mol. Cell. Biol. 6, 168-182, 1986]. Although the similar sequence indicates a shared, conserved function, the galago repeats are sub-terminal and therefore cannot serve as portable RNA polymerase II promoters, as has been suggested for the mouse tandem repeats.

Complete foldback transposable elements encode a novel protein found in Drosophila melanogaster.

An apparently complete foldback (FB) transposable element homologous to FB white-crimson (FBwc) was analyzed. A complete FB element could encode one or more proteins required for regulation of FB transposition. The central DNA region (the loop) and the junctions between the loop and the inverted terminal repeats were sequenced. Three open reading frames (ORFs) are present in the loop, and a novel 308 bp inverted repeat is present at the junctions. No significant homologies were found when the DNA sequences of the loop region and the novel inverted repeat were screened against the Gene data bank. Antibodies were prepared in guinea-pigs against a peptide present near the amino terminus of ORF1, the longest ORF. A 71,000 dalton protein was isolated from an extract of Drosophila melanogaster early-stage embryos on an anti-ORF1 peptide-affinity column. Immunohistochemical studies of adult flies demonstrate localization of this protein in egg chambers.

Homeotic transformations and limb defects in Hox A11 mutant mice.

Hox A11 is one of the expanded set of vertebrate homeo box (Hox) genes with similarities to the Drosophila homeotic gene, Abdominal-B (Abd-B). These Abd-B-type Hox genes have been shown to be expressed in the most caudal regions of the developing vertebrate embryo and in overlapping domains within the developing limbs, suggesting that these genes play important roles in pattern formation in both appendicular and axial regions of the body. In this report whole-mount in situ hybridization in mouse embryos gave a precise description of Hox A11 gene expression in the developing limbs and in the axial domain of the developing body. In addition, we generated a targeted mutation in Hox A11 and characterized the resulting phenotype to begin to dissect developmental functions of the Abd-B subfamily of Hox genes. Hox A11 mutant mice exhibited double homeotic transformations, with the thirteenth thoracic segment posteriorized to form an additional first lumbar vertebra and with the sacral region anteriorized, generating yet another lumbar segment. Furthermore, skeletal malformations were observed in both forelimbs and hindlimbs. In mutant forelimbs, the ulna and radius were misshapen, the pisiform and triangular carpal bones were fused, and abnormal sesamoid bone development occurred. In mutant hindlimbs the tibia and fibula were joined incorrectly and malformed at their distal ends. Also, an enlarged sesamoid developed ventral to the tibiale bone. Both heterozygous and homozygous mice displayed mutant phenotypes adding an additional level of complexity to the Hox code hypothesis.