Self-Assembled Chiral Film Based on Melanin Polymers.

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA. Spectroscopic analysis reveals chiral transfer from DOPA enantiomers to porphyrin hetero-aggregates, followed by the disruption of these latter and subsequent generation of chiral melanin structures in solution. Quartz substrates inserted into these solutions spontaneously accumulate homogeneous melanin-like films over days, demonstrating the feasibility of self-assembly. The resulting films exhibit characteristic UV/Vis and CD spectra, with distinct signals indicating successful chiral induction. Interestingly, the AFM characterizations reveal a distinct surface morphology, and in addition, some thermal and mechanical properties have been taken into account. Overall, this study sheds light on the formation, stability, and chiroptical properties of melanin-based films, paving the way for their application in various fields.

Enantiomeric Resolution and Enantiomer Isolation of H2 TPPS4†J-Aggregate from Aqueous Solution Is Enabled by Vortexes.

Protonated achiral H2 TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment. Indeed, herein it is shown that vortices enable the resolution of this racemic solution exploiting the tendency to deposit, onto the quartz cuvette walls, of the enantiomer favored by the stirring sense. Simultaneously, over time, it was found that the opposite chiral conformation becomes prevalent in solution realizing a significant enantiomeric resolution. Therefore, after removing all stirring-favored chiral J-aggregate from the solution, the recovering and isolating of the desired enantiomers from the cuvette walls was successfully obtained without complex procedures. In this sense, it has been demonstrated that the stirring forces are executively able to fulfil the chiral separation in H2 TPPS4 J-aggregates, employed as model of a self-assembled system in aqueous solution.

Self-Assembly of Discrete Porphyrin/Calix[4]tube Complexes Promoted by Potassium Ion Encapsulation.

The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The flattened-cone conformation adopted by the two cavities of octa-cationic calix[4]tube C4T was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin CuTPPS. Conversely, preorganization of C4T into a C4v-symmetrical scaffold, triggered by potassium ion encapsulation (C4T@K+), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures. The stepwise formation of discrete CuTPPS/C4T@K+ noncovalent assemblies, containing up to 33 molecular elements, was conveniently monitored by UV/vis spectroscopy by following the absorbance of the porphyrin Soret band.

Long-Range Chiral Induction by a Fully Noncovalent Approach in Supramolecular Porphyrin-Calixarene Assemblies.

The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.

Photodegradation of Antibiotics by Noncovalent Porphyrin-Functionalized TiO2 in Water for the Bacterial Antibiotic Resistance Risk Management.

Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance. Consequently, innovative strategies for successfully removing antibiotic contaminants have to be advanced to protect human health. Among them, photodegradation TiO2-driven under solar irradiation appears not only as a promising method, but also a sustainable pathway. Hence, we evaluated several composite TiO2 powders with H2TCPP, CuTCPP, ZnTCPP, and SnT4 porphyrin for this scope in order to explore the effect of porphyrins sensitization on titanium dioxide. The synthesis was realized through a fully non-covalent functionalization in water at room conditions. The efficacy of obtained composite materials was also tested in photodegrading oxolinic acid and oxytetracycline in aqueous solution at micromolar concentrations. Under simulated solar irradiation, TiO2 functionalized with CuTCPP has shown encouraging results in the removal of oxytetracycline from water, by opening the way as new approaches to struggle against antibiotic's pollution and, finally, to represent a new valuable tool of public health.

Cooperative Binding of the Cationic Porphyrin Tris-T4 Enhances Catalytic Activity of 20S Proteasome Unveiling a Complex Distribution of Functional States.

The present study provides new evidence that cationic porphyrins may be considered as tunable platforms to interfere with the structural "key code" present on the 20S proteasome α-rings and, by consequence, with its catalytic activity. Here, we describe the functional and conformational effects on the 20S proteasome induced by the cooperative binding of the tri-cationic 5-(phenyl)-10,15,20-(tri N-methyl-4-pyridyl) porphyrin (Tris-T4). Our integrated kinetic, NMR, and in silico analysis allowed us to disclose a complex effect on the 20S catalytic activity depending on substrate/porphyrin concentration. The analysis of the kinetic data shows that Tris-T4 shifts the relative populations of the multiple interconverting 20S proteasome conformations leading to an increase in substrate hydrolysis by an allosteric pathway. Based on our Tris-T4/h20S interaction model, Tris-T4 is able to affect gating dynamics and substrate hydrolysis by binding to an array of negatively charged and hydrophobic residues present on the protein surface involved in the 20S molecular activation by the regulatory proteins (RPs). Accordingly, despite the fact that Tris-T4 also binds to the α3ΔN mutant, allosteric modulation is not observed since the molecular mechanism connecting gate dynamics with substrate hydrolysis is impaired. We envisage that the dynamic view of the 20S conformational equilibria, activated through cooperative Tris-T4 binding, may work as a simplified model for a better understanding of the intricate network of 20S conformational/functional states that may be mobilized by exogenous ligands, paving the way for the development of a new generation of proteasome allosteric modulators.

Polyethersulfone Mats Functionalized with Porphyrin for Removal of Para-nitroaniline from Aqueous Solution.

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water. The functional mats in this study were obtained by two different approaches based on fiber impregnation or doping. In particular, meso-tetraphenyl porphyrin (H2TPP) or zinc(II) meso-tetraphenyl porphyrin (ZnTPP) were immobilized on the surface of PES fiber mats by dip-coating or added to the PES electrospun solution to obtain porphyrin-doped PES mats. The presence of porphyrins on the fiber surfaces was confirmed by UV-Vis spectroscopy, fluorescence measurements, and XPS analysis. p-NA removal from water solutions was spectrophotometrically detected and evaluated.

Chiral Recognition of L- and D- Amino Acid by Porphyrin Supramolecular Aggregates.

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H4TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control. Finally, the chiral porphyrin aggregates obtained exhibit strong chiral inertia.

Chirality Enhancement of Porphyrin Supramolecular Assembly Driven by a Template Preorganization Effect.

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.

Effect of Different Z-Inducers on the Stabilization of Z Portion in BZ-DNA Sequence: Correlation Between Experimental and Simulation Data.

In this study we show the outstanding agreement between simulation and experimental data concerning the efficient stabilization effect by NaCl of Z conformation. We demonstrate by circular dichroism (CD) experiments that Na(+) not only is able to induce a B to Z form transition in a short (GC)3 alternated portion of a sequence having 17 basis, but also is the best stabilizer in comparison with other Z inducers used (spermine and NiCl2). This result was confirmed by free energy calculations.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Interaction of tricationic corroles with single/double helix of homopolymeric nucleic acids and DNA.

In this manuscript a multitechnique approach is proposed to characterize the interaction between new tri-N-methylpyridyl corrole (TMPC) and its germanium(IV) derivative (GeTMPC), with single- and double-stranded nucleic acid homopolymers and calf thymus DNA. The specificity of each spectroscopic technique has been exploited to analyze the different aspects of corrole binding. Noteworthy, this approach allows us to distinguish between H aggregation of TMPC in the presence of polyriboadenilic acid (poly(rA)) and J aggregates in the presence of polyribocytidinic acid (poly(rC)) as well as to identify the formation of GeTMPC dimers in the presence of single-stranded poly(rA) and pseudointercalation with single-stranded poly(rC).

Electronic Circular Dichroism Detects Conformational Changes Associated with Proteasome Gating Confirmed Using AFM Imaging.

Many chronic diseases, including cancer and neurodegeneration, are linked to proteasome dysregulation. Proteasome activity, essential for maintaining proteostasis in a cell, is controlled by the gating mechanism and its underlying conformational transitions. Thus, developing effective methods to detect gate-related specific proteasome conformations could be a significant contribution to rational drug design. Since the structural analysis suggests that gate opening is associated with a decrease in the content of α-helices and ß-sheets and an increase in random coil structures, we decided to explore the application of electronic circular dichroism (ECD) in the UV region to monitor the proteasome gating. A comparison of ECD spectra of wild type yeast 20S proteasome (predominantly closed) and an open-gate mutant (α3ΔN) revealed an increased intensity in the ECD band at 220 nm, which suggests increased contents of random coil and ß-turn structures. This observation was further supported by evaluating ECD spectra of human 20S treated with low concentration of SDS, known as a gate-opening reagent. Next, to evaluate the power of ECD to probe a ligand-induced gate status, we treated the proteasome with H2T4, a tetracationic porphyrin that we showed previously to induce large-scale protein conformational changes upon binding to h20S. H2T4 caused a significant increase in the ECD band at 220 nm, interpreted as an induced opening of the 20S gate. In parallel, we imaged the gate-harboring alpha ring of the 20S with AFM, a technique that we used previously to visualize the predominantly closed gate in latent human or yeast 20S and the open gate in α3ΔN mutant. The results were convergent with the ECD data and showed a marked decrease in the content of closed-gate conformation in the H2T4-treated h20S. Our findings provide compelling support for the use of ECD measurements to conveniently monitor proteasome conformational changes related to gating phenomena. We predict that the observed association of spectroscopic and structural results will help with efficient design and characterization of exogenous proteasome regulators.

Cationic porphyrins are reversible proteasome inhibitors.

The aim of this study is to verify if water-soluble porphyrins can be used as proteasome inhibitors. We have found that cationic porphyrins inhibit proteasome peptidase activities much more effectively than the corresponding anionic derivatives. The relevance of electrostatics in driving porphyin-proteasome interactions has been confirmed by the observation that the inhibitory efficiency of the cationic macrocycles decreases with the number of positive substituents. We have also investigated various metalloporphyrins, which differ due to the different propension of the central metal ion toward axial coordination. Our experimental results indicate that the naked cationic porphyrins are the most active in reversibly inhibiting the three main protease activities of the proteasome in the micromolar range. A spectroscopic characterization of porphyrin-proteasome interactions by UV-vis spectra parallels the results of inhibition assays: the higher the inhibitory effect the stronger the spectroscopic variations are. To interpret the action of porphyrins at a molecular level, we have performed calculations evidencing that cationic porphyrins may hinder the access to the canonical proteolytic site on the proteasome ß5 subunit. In particular, an inspection of the top-scoring docking modes shows that the tetracationic porphyrin blocks the catalytic pocket, close to the N termini of the ß5 proteasome subunit, more efficiently than its anionic counterpart. Proteasome inhibition activity of porphyrins unites their known anticancer properties making them suitable as a scaffold for the design of novel multitargeted molecules.

Modulation of the 20S Proteasome Activity by Porphyrin Derivatives Is Steered through Their Charge Distribution.

Cationic porphyrins exhibit an amazing variety of binding modes and inhibition mechanisms of 20S proteasome. Depending on the spatial distribution of their electrostatic charges, they can occupy different sites on α rings of 20S proteasome by exploiting the structural code responsible for the interaction with regulatory proteins. Indeed, they can act as competitive or allosteric inhibitors by binding at the substrate gate or at the grooves between the α subunits, respectively. Moreover, the substitution of a charged moiety in the peripheral arm with a hydrophobic moiety revealed a "new" 20S functional state with higher substrate affinity and catalytic efficiency. In the present study, we expand our structure-activity relationship (SAR) analysis in order to further explore the potential of this versatile class of 20S modulators. Therefore, we have extended the study to additional macrocyclic compounds, displaying different structural features, comparing their interaction behavior on the 20S proteasome with previously investigated compounds. In particular, in order to evaluate how the introduction of a peptidic chain can affect the affinity and the interacting mechanism of porphyrins, we investigate the MTPyApi, a porphyrin derivatized with an Arg-Pro-rich antimicrobial peptide. Moreover, to unveil the role played by the porphyrin core, this was replaced with a corrole scaffold, a "contracted" version of the tetrapyrrolic ring due to the lack of a methine bridge. The analysis has been undertaken by means of integrated kinetic, Nuclear Magnetic Resonance, and computational studies. Finally, in order to assess a potential pharmacological significance of this type of investigation, a preliminary attempt has been performed to evaluate the biological effect of these molecules on MCF7 breast cancer cells in dark conditions, envisaging that porphyrins may indeed represent a powerful tool for the modulation of cellular proteostasis.

Transfer of chirality for memory and separation.

Transfer of chirality is an intriguing issue worth studying to understand better the origin of life and for possible technological applications. In the last few years we have been working in this area studying the chain of events that begins with induction, reaches a permanent transfer (chiral memory) and extends in some cases to a (quasi-)reversible situation in which induced and permanently memorized chirality coexists. This can happen thanks to a designed blend of thermodynamics and kinetics.

Recognition of left-handed Z-DNA of short unmodified oligonucleotides under physiological ionic strength conditions.

The left-handed Z-DNA form of the short unmodified alternating guanine-cytosine oligonucleotides, 5'-(dGdC)(24) and 5'-(dGdC)(18), was selectively detected under physiological ionic strength and pH conditions using the anionic nickel(II) porphyrin, NiTPPS. No spectroscopic signal was observed for NiTPPS with any right-handed oligonucleotides under identical conditions. The 48mer 5'-(dGdC)(24) Z-form was detected at concentrations as low as 100nM. The binding of NiTPPS to the B- and Z-oligonucleotides was studied quantitatively by UV-vis absorption and circular dichroism spectroscopies. NiTPPS was found to be a universal DNA binder, with binding affinity and geometry depending on the ionic composition of the solution, rather than on the DNA helical twist. This is the first example of a successful spectroscopic detection of the Z-DNA of short unmodified oligonucleotides under physiological pH and ionic strength conditions.

Sequence, stoichiometry, and dimensionality control in porphyrin/bis-calix[4]arene self-assemblies in aqueous solution.

The use of a water-soluble octacationic bis-calix[4]arene with divergent cavities (BC(4)) as a templating agent for the assembly of a tetraanionic porphyrin (CuTPPS) has allowed the noncovalent synthesis of 2D or 3D multiporphyrin assemblies. Self-assembly of CuTPPS and BC(4) molecules proceeded under hierarchical control in a stepwise fashion to yield discrete and isolable supramolecular nanostructures containing up to 33 molecular elements (i.e., the CuTPPS/BC(4) 17:16 assembly, obtained in less than three hours). The formation of these species could be conveniently monitored by means of UV/Vis spectroscopy by following the absorbance of the Soret band at 412 nm. In particular, the attainment of the pivotal CuTPPS/BC(4) 5:4 species with a cruciform structure, as the key fork-point intermediate for the subsequent formation of the higher 2D and 3D assemblies, has been demonstrated by light-scattering studies and by an unequivocal synthesis of mixed-porphyrin/calixarene 5:4 species involving the use of two different types of metallated porphyrins, namely CuTPPS and MnTPPS. The remarkable stability of these assemblies permits a stepwise synthesis that makes it possible to choose the desired porphyrin sequence.

Supramolecular aggregation/deaggregation in amphiphilic dipolar Schiff-base zinc(II) complexes.

The synthesis, characterization, optical, and fluorescent properties of an amphiphilic Schiff-base bis(salicylaldiminato)zinc(II) complex are reported. Detailed (1)H nuclear magnetic resonance (NMR), diffusion-ordered spectroscopy (DOSY) NMR, optical absorption, and fluorescence spectroscopy studies indicate the existence of aggregate species in noncoordinating solvents. The degree and type of aggregation are related to the concentration and the polarity of the noncoordinating solvent. Dilute solutions are likely characterized by the presence of defined dimers, whereas larger oligomeric aggregates are conceivably formed at higher concentrations. The concentration needed to observe the formation of larger species depends upon solvent polarity. In coordinating solvents or in the presence of coordinating species, a complete deaggregation of the system occurs, because of the axial coordination to the Zn(II) ion, accompanied by considerable changes of (1)H NMR and optical absorption spectra. A dramatic enhancement of fluorescence emission is observed in dichloromethane solutions upon deaggregation with a coordinating agent. The formation of a defined 2:1 supramolecular structure is demonstrated in the case of a ditopic ligand as coordinating species. Overall, these complexes are promising systems for the development of new supramolecular architectures and supramolecular fluorescent probes.