High somatostatin receptor expression and efficacy of somatostatin analogues in patients with metastatic Merkel cell carcinoma.

BACKGROUND: Merkel cell carcinoma (MCC) is an aggressive, high-grade, cutaneous neuroendocrine tumour (NET). Agents blocking programmed death 1/programmed death ligand 1 have efficacy in metastatic MCC (mMCC), but half of patients do not derive durable benefit. Somatostatin analogues (SSAs) are commonly used to treat low- and moderate-grade NETs that express somatostatin receptors (SSTRs). OBJECTIVES: To assess SSTR expression and the efficacy of SSAs in mMCC, a high-grade NET. Methods In this retrospective study of 40 patients with mMCC, SSTR expression was assessed radiologically by somatostatin receptor scintigraphy (SRS; n = 39) and/or immunohistochemically when feasible (n = 9). Nineteen patients (18 had SRS uptake in MCC tumours) were treated with SSA. Disease control was defined as progression-free survival (PFS) of ≥ 120 days after initiation of SSA. RESULTS: Thirty-three of 39 patients (85%) had some degree (low 52%, moderate 23%, high 10%) of SRS uptake. Of 19 patients treated with SSA, seven had a response-evaluable target lesion; three of these seven patients (43%) experienced disease control, with a median PFS of 237 days (range 152-358). Twelve of 19 patients did not have a response-evaluable lesion due to antecedent radiation; five of these 12 (42%) experienced disease control (median PFS of 429 days, range 143-1757). The degree of SSTR expression (determined by SRS and/or immunohistochemistry) did not correlate significantly with the efficacy endpoints. CONCLUSIONS: In contrast to other high-grade NETs, mMCC tumours appear frequently to express SSTRs. SSAs can lead to clinically meaningful disease control with minimal side-effects. Targeting of SSTRs using SSA or other novel approaches should be explored further for mMCC.

Estimation of common location parameter of several heterogeneous exponential populations based on generalized order statistics.

In this article, several independent populations following exponential distribution with common location parameter and unknown and unequal scale parameters are considered. From these populations, several independent samples of generalized order statistics (gos) are drawn. Under the setup of gos, the problem of estimation of common location parameter is discussed and various estimators of common location parameter are derived. The authors obtained maximum likelihood estimator (MLE), modified MLE and uniformly minimum variance unbiased estimator of common location parameter. Furthermore, under scaled-squared error loss function, a general inadmissibility result of invariant estimator is proposed. The derived results are further reduced for upper record values which is a special case of gos. Finally, simulation study and real life example are reported to show the performances of various competing estimators in terms of percentage risk improvement.

A Severe Leaf Curl Disease on Chilies in Pakistan is Associated with Multiple Begomovirus Components.

Chili leaf curl disease is an important limiting factor for chilies in the Indian subcontinent and is associated with begomoviruses (2,3). Field visits of commercially grown chilies in 2007 and 2008 identified a very severe leaf curl disease with 100% incidence and severe yield losses at several locations in Faisalabad District, Punjab, Pakistan. Symptoms of the disease were severe leaf curl with cup-shaped, upward curling, yellowing, and stunted plant growth. To identify the causative agent, symptomatic plant samples were collected from 10 locations and total DNA was extracted with a cetyltrimethylammoniumbromide method. Universal primers that amplify begomovirus DNA A, Begomo F (ACGCGT GCCGTGCTGCTGCCCCCATTGTCC) and Begomo R (ACGCGT ATGGGCTGYCGAAGTTSAGAC), were used in PCR. A PCR product of the expected size (approximately 2.8 kb) was amplified from all symptomatic plants, and no amplification products of the expected size were obtained from healthy or asymptomatic plants, confirming the association of a begomovirus with the disease. When used as a probe in Southern hybridization, a full-length clone of Cotton leaf curl Multan virus detected characteristic viral DNA forms and further confirmed the association of begomovirus with the disease. To identify the begomovirus associated with the disease at the species level, the PCR product obtained with universal primers was cloned into a TA cloning vector and five clones were partially sequenced. Comparison of the DNA sequence of the coat protein gene of clones resulted in identification of two begomovirus species; the first clone (GenBank Accession No. FN179278) showed 94% DNA sequence identity with the bipartite virus Tomato leaf curl New Delhi virus (ToLCNDV), while the second clone (GenBank Accession No. FN252382) showed 97% sequence identity with the monopartite begomovirus Chili leaf curl Multan virus (ChLCMV). Rolling circle amplification was used to clone the DNA B of ToLCNDV from samples showing typical chili leaf curl disease symptoms. Sequence analysis of the DNA B clone (GenBank Accession No. FN179276) in the intergenic region and movement protein gene showed 94% identity with ToLCNDV DNA B. To confirm association of betasatellite with the disease, universal primers (ß-01 and ß-02) were used for the amplification of betasatellite by PCR (1). DNA sequence analysis of betasatellite (GenBank Accession No. FN179279) associated with the disease showed 90% identity with the previously cloned chili leaf curl betasatellite (1). No evidence for the association of alphasatellite with the disease was found. The multiple infection of a begomovirus complex, consisting of a monopartite virus with a bipartite begomovirus where DNA B is maintained in the presence of betasatellite, presents yet another example of rapid changes in begomovirus complexes that infect important crops in the region. The appearance of chili leaf curl disease at a higher incidence and symptom severity may be attributed to the synergistic action of geminivirus disease complex comprising a monopartite and a bipartite begomovirus along with DNA betasatellite. High yield losses resulting from this severe disease threatens chili cultivation in the area and is forcing farmers to grow other crops. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) B. Chattopadhyay et al. Arch Virol. 10:7, 2007. (3) M. Hussain et al. Plant Pathol. 53:794, 2004.

Growth and survival of protozoa isolated from a tannery effluent.

Industrial effluent from a tannery was used for the growth of algae in a medium containing various inorganic salts. Growth of algal cells became visible after 7 d. Two species of protozoa were observed to proliferate in the algal culture containing no organic supplement in the medium. The culture was kept bacteria-free by the use of antibiotics and was perpetuated for at least 150 d with no decline in the protozoan population. Efficient growth of protozoa in a culture of algae elucidated new modes of nutrition in protozoa. Cr(VI) was added to the medium to check the resistance of algae and protozoa against this heavy metal. Protozoa showed different degrees of resistance. The results indicate the importance of algae and protozoa in the process of bioremediation.