RESUMO
OBJECTIVE: To study the effects of staple food on the glycemic responses through a controlled feeding trial. METHODS: In November 2020, two groups of volunteers with different staple food habits(the rice group, n=35, and the wheat group, n=35), were recruited from Changzhi Medical College in Shanxi Province. They were subjected to a two-stage feeding trial, in which their staple food habits were maintained in the first stage(staple food fortification period, 4 weeks) and then swapped in the second stage(staple food swap period, 4 weeks), while keeping the rest of the dietary components same. A continuous glucose monitoring system was used to monitor the glycemic response of glucose, steamed buns and steamed rice, equivalent to 50 g of available carbohydrate(CHO). Blood glucose level up to 120 minutes postprandial, incremental area under the curve(iAUC) and glycemic index(GI) were analyzed. RESULTS: During the staple food fortification period, the glycemic response to steamed buns at 15 min(5.43±0.69 vs.5.14±0.50 mmol/L, P=0.047), 30 min(6.63±0.98 vs.6.10±0.70 mmol/L, P=0.012), 45 min(6.81±1.15 vs.6.21±0.67 mmol/L, P=0.011) and 60 min postprandial(6.03±0.96 vs.5.56±0.59 mmol/L, P=0.017) in the rice group were higher than the wheat group, and the trends for blood glucose fluctuation during the 120 minutes after consuming steamed buns were different between the two groups. During the staple food swap period, the 120 min iAUC(83.24±30.15 vs.69.32±26.25 mmol·min/L, P=0.032) and GI(88±24 vs.75±33, P=0.041) of the rice group to steamed buns were higher than the wheat group. Comparing the differences between the two groups in the staple food exchange period and the staple food intensification period, the rice group had an increased glycemic response to steamed buns(P=0.007), while the wheat group had an increased glycemic response to glucose(P<0.001), steamed buns(P<0.001) and steamed rice(P=0.018). The 120 min iAUC of steamed buns in the rice group increased(83.24±30.15 vs.70.12±26.02 mmol·min/L, P=0.029), and the 120 min iAUC of rice in the wheat group(69.75±32.32 vs.54.87±20.43 mmol·min/L, P=0.040) increased. CONCLUSION: Even to the same food, there are significant differences in the glycemic responses of people with different staple food habits, and short-term changes in the intake of staple food will lead to differences in the glycemic response.
Assuntos
Automonitorização da Glicemia , Glicemia , Humanos , Estudos Cross-Over , Comportamento Alimentar , Glucose , Índice Glicêmico , Período Pós-PrandialRESUMO
Neonatal transport scoring systems can assess severity before and after transport, improve transport efficiency, and predict the occurrence of critical illness. The aim of this study was to compare four neonatal transport scoring methods to predict mortality risk and clinical utility within the first week after transportation. This was a single-center retrospective cohort study. All patients were full-term, out-born neonates. Each patient was assessed by the Transport Risk Index of Physiologic Stability (TRIPS), Mortality Index for Neonatal Transportation (MINT), Transport-Related Mortality Score (TREMS), and Neonatal Critical Illness Score (NCIS) scoring methods. Receiver operating characteristic (ROC) curves and decision curve analysis (DCA) for each method were compared for their utility in predicting mortality risk within the 1st week after admission. In total, 368 full-term infants were included (368/770, 47.8% of all transported infants). Within the 1st week after admission, five infants (1.36%, 5/368) died while receiving advanced life support and full treatment, and 24 infants (6.52%, 24/368) died soon after they were discharged against medical advice. The areas under the curve (AUCs) for the MINT, TRIPS, TREMS, and NCIS for the prediction of mortality were 0.822, 0.827, 0.643, and 0.731, respectively (all p < 0.05). However, the clinical net benefits for the MINT and TRIPS were far superior than those for the NCIS and TREMS. CONCLUSION: It was concluded that the TRIPS and MINT might be more suitable for the prediction of mortality in full-term, out-born neonates in the neonatal intensive care unit (NICU) within the 1st week after transportation. WHAT IS KNOWN: ⢠Neonatal transport scores can assess not only the mortality risk during transportation but also the mortality risk of critically ill newborns after admission to the NICU. ⢠The effectiveness of neonatal transport scores in predicting mortality risk is different. WHAT IS NEW: ⢠Our data indicate that the diagnostic efficacy of the MINT, TRIPS, and NCIS in the prediction of full-term infant mortality was high. ⢠The TRIPS and MINT scores had better clinical utility and could be used to predict mortality within the 1st week after transportation in full-term out-born neonates.
Assuntos
Estado Terminal , Projetos de Pesquisa , Humanos , Lactente , Recém-Nascido , Unidades de Terapia Intensiva Neonatal , Curva ROC , Estudos RetrospectivosRESUMO
OBJECTIVE: To research the effect of sodium alginate intervention on the nutritional intake of healthy young men. METHODS: Recruited 20 healthy university students as research subjects. The experiment was divided into two periods: the dietary balance period and the sodium alginate intervening period, and each period was expected to be 28 days. During the dietary balance period, all meals in every day of experiment are provided by the research team; during the sodium alginate intervening period, based on the diet during the balanced diet period, sodium alginate was added to the staple food steamed buns(10 g sodium alginate per person per day). The experiment compares the food intake types, main nutrient intake levels and serum amino acid changes of subjects before and after intervention. RESULTS: Adding sodium alginate can significantly reduce the intake of energy(-242.4 kcal), protein(-11 g)and carbohydrates(-47.3 g, P<0.05)in healthy subjects, but there was no significant effect on the intake of fat(-2.9 g, P=0.496)and cholesterol(-14.9 mg, P=0.070), and because of the addition of alginate, the whole dietary fibers obtained a significant increase(+7.8 g, P<0.05). After the intervention of sodium alginate, there was no significant change in the intake of rice, soy products, poultry products and vegetable oil, while the intake of wheat products(-49.6 g), egg foods(-2.6 g), dark-colored vegetables(-29.1 g), light-colored vegetables(-63.8 g)and fruits(-37 g)decreased significantly(P<0.05). Most of the essential amino acids in the subjects' serum increased significantly after the intervention, especially the valine in serum rise from 226.9 µmol/L to 466.4 µmol/L(P<0.05). CONCLUSION: Sodium alginate can play a dietary fiber-like effect, produce satiety, reduce nutrient intake of subjects, especially carbohydrates, so sodium alginate has the potential to limit energy intake and control postprandial blood sugar. And sodium alginate also has a potential positive effect on the metabolism of amino acids in healthy people, especially the metabolism of essential amino acids.
Assuntos
Alginatos , Ingestão de Energia , Adolescente , Aminoácidos , Dieta , Gorduras na Dieta , Humanos , Nutrientes , VerdurasRESUMO
Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.
Assuntos
Fusarium , China , Filogenia , Doenças das Plantas , VirulênciaRESUMO
BACKGROUND: There is an increasing public interest in the use of TM internationally, yet there is a paucity of research on the use of TM by the public in the dental setting. This study aimed to explore the views, use of and access to TM in dentistry among different ethnic groups residing in New Zealand. METHODS: Qualitative study and in-depth interviews were used. An individual semi-structured questionnaire was used to collect data. Interviews were recorded, transcribed, and analysed using an inductive approach to identify the main themes. RESULTS: Three main themes were extracted from interviews with 14 participants from diverse cultural backgrounds: [1] the perspectives of TM varied among different ethnic groups and included the involvement of spirituality, the environment, knowledge and usage of TM. [2] The TM that was used by different ethnic groups included plants, herbs, massage, and other forms of healing. Reasons for choosing traditional or western medicines generally included family tradition, access to TM, and finding a competent traditional healer. [3] The barriers in accessing TM included the paucity of traditional healers, difficulty accessing plants and cost, therefore most would look for a substitution or alternative treatment. CONCLUSION: Even though the access to these TM in New Zealand was a challenge for the majority of the participants, they are still considered the first-line treatment for the majority. This study provided dental practitioners an insight into the different sort of TM used by the population. By understanding and acknowledging the use of TM, dental practitioners could create a supportive environment for patients to disclose their use of TM and allow them to educate patients on the use of TM.
Assuntos
Odontólogos , Etnicidade , Assistência Odontológica , Humanos , Medicina Tradicional , Nova Zelândia , Papel ProfissionalRESUMO
Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.
Assuntos
Proteínas de Plantas/metabolismo , Sementes/metabolismo , Sesamum/metabolismo , Éxons/genética , Regulação da Expressão Gênica de Plantas/genética , Pleiotropia Genética/genética , Pleiotropia Genética/fisiologia , Ácidos Indolacéticos/metabolismo , Íntrons/genética , Mutação , Proteínas de Plantas/genética , Polimorfismo de Nucleotídeo Único/genética , Sementes/genética , Sesamum/genéticaRESUMO
BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.
Assuntos
Frutas/genética , Genes de Plantas , Folhas de Planta/genética , Sesamum/genética , Alelos , Mapeamento Cromossômico , Cromossomos de Plantas , Clonagem Molecular , DNA de Plantas , Frutas/crescimento & desenvolvimento , Genes Recessivos , Variação Genética , Padrões de Herança , Mutação , Folhas de Planta/crescimento & desenvolvimento , Proteínas de Plantas/genética , Proteínas Repressoras/genética , Análise de Sequência de DNA , TranscriptomaRESUMO
We demonstrate a low-cost and facile photochemical solution method to prepare the ZrO2 resistive switching arrays as memristive units on flexible PET/ITO substrates. ZrO2 solution sensitive to UV light of 337 nm was synthesized using zirconium n-butyl alcohol as the precursor, and benzoylacetone as the complexing agent. After the dip-coated ZrO2 gel films were irradiated through a mask under the UV lamp (with wavelength of 325-365 nm) at room temperature and rinsed in ethanol, the ZrO2 gel arrays were obtained on PET/ITO substrates. Subsequently, the ZrO2 gel arrays were irradiated by deep UV light of 254 and 185 nm at 150 °C, resulting in the amorphous ZrO2 memristive micro-arrays. The ZrO2 units on flexible PET/ITO substrates exhibited excellent memristive properties. A high ratio of 104 of on-state and off-state resistance was obtained. The resistive switching behavior of the flexible device remained stable after being bent for 103 times. The device showed stable flexibility up to a minimum bending diameter of 1.25 cm.
RESUMO
INTRODUCTION: Enamel demineralization and gingival inflammation are the most prevalent consequences of biofilm formation in orthodontics. Our hypothesis was that educating patients about the severe consequences of biofilm accumulation could enhance their oral hygiene while wearing fixed appliances. METHODS: This study was designed as a randomized controlled 4-arm parallel trial. A total of 148 participants in Chengdu, China, matching the eligibility criteria of 11 to 25 years of age, at least 20 natural teeth, and a treatment plan that included conventional stainless steel brackets, were randomly assigned to 4 intervention groups based on computer-generated random sequencing using simple randomization without blocking. In group A (n = 37), the subjects were shown images illustrating the severe consequences of biofilm formation, including enamel demineralization and gingival inflammation; subjects in group B (n = 40) were given biofilm disclosing tablets; those in group C (n = 38) received a combination of A and B; the subjects in group D (n = 33) served as the controls. The investigators were blinded to the allocations, and the researcher managing the random sequence did not participate in allocation or measurement. All groups received routine oral hygiene instructions. Plaque index and gingival index scores were recorded at each appointment during a 6-month follow-up. RESULTS: Eighteen participants were lost during follow-up, resulting in a total of 130 participants after the trial (group A, 35; group B, 32; group C, 34; group D, 29). No adverse events were recorded. Groups A and C exhibited a significantly lower plaque index scores (parameter-estimate [95% confidence interval] = -1.20 [-1.76 to -0.63] for group A, and -1.12 [-1.69 to -0.56] for group C) and gingival index scores (-0.13 [-0.21 to -0.04], and -0.19 [-0.28 to -0.10]), respectively, compared with group D (P <0.001 for all), whereas no significant difference was found between groups B and D, or between groups A and C (P >0.05). The adults had significantly lower plaque index (0.48 [0.13-0.84], P <0.001) and gingival index (0.06 [0.01-0.11], P = 0.018) scores than did the teenagers, and the female subjects had significantly higher gingival index (-0.06 [-0.11 to -0.01], P = 0.040) scores than did the male subjects. CONCLUSIONS: The use of images showing the severe consequences of biofilm accumulation enhanced the oral hygiene of patients treated with fixed appliances.
Assuntos
Recursos Audiovisuais , Corantes , Placa Dentária/diagnóstico , Higiene Bucal/educação , Educação de Pacientes como Assunto/métodos , Adolescente , Adulto , Biofilmes/classificação , Criança , Esmalte Dentário/patologia , Placa Dentária/complicações , Índice de Placa Dentária , Feminino , Seguimentos , Gengivite/etiologia , Humanos , Masculino , Braquetes Ortodônticos/microbiologia , Índice Periodontal , Estudos Prospectivos , Método Simples-Cego , Desmineralização do Dente/etiologia , Escovação Dentária/instrumentação , Cremes Dentais/uso terapêutico , Adulto JovemRESUMO
Storage batteries with elevated energy density, superior safety and economic costs continues to escalate. Batteries can pose safety hazards due to internal short circuits, open circuits and other malfunctions during usage, hence real-time surveillance and error diagnosis of the battery's operational state is imperative. In this paper, a three-dimensional model of electrochemical-magnetic field-thermal coupling is formulated with lithium-ion pouch cells as the research focus, and the spatial distribution pattern of the physical field such as magnetic field and temperature when the battery is operational is acquired. Furthermore, this manuscript also investigates the diagnostic methodology for defective batteries with internal short circuits and fissures, that is, the operational state of the battery is evaluated and diagnosed by the distribution of the magnetic field surrounding the battery. To substantiate the method's practical viability, the present study extends its examination to the 18650-battery pack. We obtained the magnetic field images of the normal operation of the battery pack and the failure state of some batteries and analyzed the relationship between the magnetic field distribution characteristics and the performance of the battery pack, providing a new method for the health monitoring and fault diagnosis of the battery pack. This non-contact method incurs no damage to the battery, concurrently exhibiting elevated sensitivity and extremely rapid response time. Meanwhile, it provides an effective means for non-destructive research on the batteries and can be applied to areas such as battery safety screening and non-destructive testing. This research not only helps to facilitate our understanding of the battery's operating mechanism, but also provides robust support for safe operation and optimal battery design.
RESUMO
The process parameters of one step preparation of ZnO/Activated Carbon (AC) composite materials, from vinyl acetate synthesis spent catalyst were optimized using response surface methodology (RSM) and the central composite rotatable design (CCD). Regeneration temperature, time and flow rate of CO2 were the process variables, while the iodine number and the yield were the response variables. All the three process variables were found to significantly influence the yield of the regenerated carbon, while only the regeneration temperature and CO2 flow rate were found to significantly affect the iodine number. The optimized process conditions that maximize the yield and iodine adsorption capacity were identified to be a regeneration temperature of 950 degrees C, time of 120 min and flow rate of CO2 of 600 ml/min, with the corresponding yield and iodine number to be in excess of 50% and 1100 mg/g. The BET surface area of the regenerated composite was estimated to be 1263 m2/g, with micropore to mesopore ratio of 0.75. The pore volume was found to have increased 6 times as compared to the spent catalyst. The composite material (AC/ZnO) with high surface area and pore volume coupled with high yield augur economic feasibility of the process. EDS and XRD spectrum indicate presence of ZnO in the regenerated samples.
RESUMO
Objective: To assess the incidence, risk factors, and clinical characteristics of perinatal stroke in Beijing. Methods: This multicenter prospective study included all the live births from 17 representative maternal delivery hospitals in Beijing from March 1, 2019 to February 29, 2020. Neonates with a stroke were assigned to the study group. Clinical data, including general information, clinical manifestations, and risk factors, were collected. Up until 18 months after birth, neonates were routinely assessed according to the Ages and Stages Questionnaire (ASQ) and/or the Bayley scale. Statistical analysis was done using the chi-squared, t-tests, and logistic regression analysis using SPSS version 26.0. Outcomes: In total, 27 cases were identified and the incidence of perinatal stroke in Beijing was 1/2,660 live births, including 1/5,985 for ischemic stroke and 1/4,788 for hemorrhagic stroke. Seventeen cases (62.96%) of acute symptomatic stroke and convulsions within 72 h (10 cases, 37.04%) were the most common presentations. Ten patients showed no neurological symptoms and were found to have had a stroke through routine cranial ultrasonography after being hospitalized for non-neurological diseases. The risk factors include primiparity, placental or uterine abruption/acute chorioamnionitis, intrauterine distress, asphyxia, and severe infection. In the study group, 11.1% (3/27) of patients had adverse neurodevelopmental outcomes. The patients in the study group had lower scores for the ASQ than those in the control group in the communication, gross, and fine motor dimensions. Conclusion: The incidence of perinatal stroke in Beijing was consistent with that in other countries. Routine neuroimaging of infants with risk factors may enable identification of asymptomatic strokes in more patients. Patients who have suffered from a stroke may have neurological sequelae; therefore, early detection, treatment, and regular follow-ups are beneficial for improving their recovery outcomes.
Assuntos
Placenta , Acidente Vascular Cerebral , Feminino , Humanos , Incidência , Lactente , Recém-Nascido , Gravidez , Estudos Prospectivos , Fatores de Risco , Acidente Vascular Cerebral/epidemiologia , Acidente Vascular Cerebral/etiologiaRESUMO
It is proposed that human decidua contains a population of stem cells that are responsible for the proliferation ability during the process of embryo implantation and placenta formation and that factors in the crosstalk between the decidua and chorion may mediate decidual stem cell differentiation. This study analysed the phenotype of side population (SP) cells and investigated the clonogenicity and differentiation ability of SP cells in human decidua of early pregnancy. Serum-free culture-conditioned media of human decidua and chorion were obtained from decidua and chorion explant culture. Decidual SP cells were isolated by fluorescence-activated cell sorting. Different inducing media were added and the functional differentiation of decidual SP cells was examined. Decidual SP cells were negative for the mature decidual cell marker CD13 and prolactin and negative for CD34 and CD45 expression. Decidual SP cells formed clones after culture in colony-forming medium and they could form clones again. Differentiated cells expressing CD13 and prolactin were observed and stroma-like structures expressing CD13 were obtained. These results indicate that decidual SP cells are enriched for stem cell activity. Oestradiol, progesterone and factors in culture-conditioned media of human decidua and chorion induced their proliferation and differentiation.
Assuntos
Diferenciação Celular/fisiologia , Decídua/citologia , Células da Side Population/citologia , Células-Tronco/citologia , Biomarcadores/metabolismo , Técnicas de Cultura de Células/métodos , Diferenciação Celular/efeitos dos fármacos , Córion/fisiologia , Decídua/fisiologia , Estradiol/farmacologia , Feminino , Citometria de Fluxo , Humanos , Imuno-Histoquímica , Imunofenotipagem , Gravidez , Progesterona/farmacologia , Células-Tronco/fisiologiaRESUMO
Semiconductor-based heterojunction photocatalysts with a special active crystal surface act as an essential part in environmental remediation and renewable energy technologies. In this study, an RGO/CdS/TiO2 step-scheme with high energy {001} TiO2 facets was successfully fabricated via a microwave-assisted solvothermal method. The photocatalytic performance of as-prepared samples was assessed by degrading methylene blue under visible light irradiation. We found that the photocatalytic activity of the RGO/CdS/TiO2 step-scheme heterojunction was related to the proportion of TiO2. A ternary sample with a TiO2 content of 10 wt% exhibited superior photocatalytic performance, and approximately 99.7% of methylene blue was degraded during 50 min of visible illumination which was much higher than the percentages found for TiO2, CdS, RGO/TiO2, and RGO/CdS. The greatly improved photocatalytic performance is due to the exposure of the reactive {001} surface of TiO2 and the formation of a CdS/TiO2 heterojunction step-scheme, which effectively inhibits the recombination of charge carriers at the heterogeneous interfaces. Moreover, the incorporation of graphene further enhances the visible light harvesting and serves as an electron transport channel for rapidly separating photogenerated carriers. Based on the PL, XPS, photoelectrochemical properties and the free radical capturing experiment results, a possible photodegradation mechanism was proposed.
RESUMO
OBJECTIVE: The aim of this study was to examine the awareness level among general dental practitioners and medical practitioners with regard to common oral mucosal diseases and orofacial pain, investigate their orofacial screening and oral medicine referral practices, assess the information to be included in the referral, and evaluate the perceived need for supplementary resources and guidelines for referral. STUDY DESIGN: In total, 51 general dental practitioners and medical practitioners were recruited to investigate their orofacial screening and oral medicine referral practices. Three oral medicine specialists were interviewed to understand the referrals received from dentists and physicians. RESULTS: Of the participants, 87.5% dentists and 52.6% physicians considered orofacial screening as treatment priority. However, 71.9% dentists performed orofacial screening routinely, whereas none of the physicians did. Of the dentists, 50% referred relevant patients to oral medicine specialists every time they encountered such cases, and 31.6% of the physicians did so. Referrals should include the patient's background and medical history, full descriptions of the lesions, and results and photos from special tests. Of the participants, 65.6% of the dentists and 78.9% of the physicians believed that continuing professional development courses in oral medicine would be beneficial, and 93.8% of the dentists and 89.5% of the physicians agreed that standardized national referral guidelines would be useful. CONCLUSIONS: Standardized national referral guidelines, as well as continuing professional development courses in oral medicine, would be helpful to dental practitioners in the management of patients.
Assuntos
Odontólogos , Especialização , Humanos , Nova Zelândia , Papel Profissional , Encaminhamento e Consulta , Inquéritos e QuestionáriosRESUMO
The exploration of the dielectric properties of waste hydrodesulfurization catalysts has important guiding significance for the development of microwave heat treatment of waste hydrodesulfurization catalysts for the recovery of valuable metals. The resonant cavity perturbation technique was used to measure the dielectric properties of waste catalyst and the mixture of waste catalyst and Na2CO3 during roasting from room temperature to 700 °C at 2450 MHz. The heating properties of the waste catalyst and mixture of waste catalyst and Na2CO3 were determined in the microwave field. The results show that the waste catalyst and the mixture of waste catalyst and Na2CO3 exhibit strong microwave response capability, and the dielectric constant, dielectric loss factor, and dielectric loss tangent increase with increasing temperature; from 20 to 300 °C, the waste catalyst and the mixture of waste catalyst and Na2CO3 heated at a slower rate, while the material heated rapidly from 300 to 700 °C. In addition, the mechanism of microwave action has been proposed based on the study of dielectric properties and heating properties in the microwave field.
RESUMO
OBJECTIVE: To explore the existence of side-population cells (SP cells) in human decidual tissues in early pregnancy, and its biological characteristics. METHODS: Decidual cells were obtained by enzymatic digestion from the decidual tissues of human early pregnancy. The cells then were stained with Hoechst33342 dye either alone or in combination with verapamil. Fluorescence-activated cell sorter (FACS) analysis was used to identify and isolate SP cells. The isolated cells were cultured in conditioned media culture to observe the proliferation and ability to form colony. RESULTS: Stem cells were found in the decidual tissues of early pregnancy with a percentage of 0.78% +/- 0.71% (0% - 3.20%). These cells further proliferated and formed colonies during long-time culture in vitro. No significant statistical difference was found in contents of SP cells among different gestational week (P > 0.05). CONCLUSION: SP cells exist in human decidua that can further proliferate and have the clonogenicity in culture in vitro.
Assuntos
Decídua/citologia , Células-Tronco/citologia , Separação Celular , Células Cultivadas , Feminino , Humanos , Gravidez , Primeiro Trimestre da GravidezRESUMO
Currently, roasting-leaching is the main treatment process of spent hydrodesulfurization (HDS) catalyst, but it will produce impurities, such as nickel molybdate and cobalt molybdate (NiMoO4 or CoMoO4), which is adverse to recover valuable metals. In this paper, a combined ultrasonic-microwave method was developed to remove oil and recover molybdenum (Mo) from the spent HDS catalyst. Firstly, ethanol was used to extract the surface oil of the spent MoNiCo/Al2O3 catalyst with ultrasonic assistance. Effects of temperature, ultrasonic time, liquid-solid ratio and ultrasonic power on the oil removal rate were investigated systematically and the process conditions were optimized using response surface methodology (RSM). The results showed that the oil removal rate was over 99% under the optimum conditions of temperature 55⯰C, ultrasonic time 2â¯h, liquid to solid ratio 5:1, and ultrasonic power 600â¯W. After oil removal, the sample was roasted in microwave field at 500⯰C for 15â¯min. The generation of toxic gas could be effectively avoided and no hardest-to-recycle impurity CoMoO4 was found. At last, the roasted sample was subjected to ultrasonic leaching with sodium carbonate (Na2CO3) solution for recovering Mo. Extraction of Mo of the deoiled sample after microwave roasting reached 94.3%, which is about 7% higher than that of oily sample. Moreover, microwave roasting method resulted in a much higher Mo extraction than traditional method for both the oily and deoiled spent catalyst. It was concluded that the ultrasonic-microwave assisted method could remarkably improve the recovery of Mo and greatly shorten the processing time.
RESUMO
Self-labeled inhibitors (SLIs) are promising for creating links, ranging from cancer therapy and metastatic pathways to mechanistic elucidation. In this study, a new category of "two-in-one" fluorescent xanthone inhibitors was developed for the systematic evaluation of anticancer activity and the selective imaging of cytoplasm in vitro. These xanthone inhibitors presented high fluorescent brightness, working over a wide pH range enabled by a "switchable reaction" of the heterocyclic backbone. The strength and nature of fluorescence were probed via spectroscopic methods and density functional theory calculations on the molecular level, respectively. Along with the potent anticancer activity, which was demonstrated using MTT and clonogenic assays with high fluorescent brightness in the cytoplasm, SLI 3fd could be established as a modeled self-monitoring drug in cancer therapy.
RESUMO
Bacterial adhesion is a main problem in many biomedical, domestic, natural and industrial environments and forms the onset of the formation of a biofilm, in which adhering bacteria grow into a multi-layered film while embedding themselves in a matrix of extracellular polymeric substances. It is usually assumed that bacterial adhesion occurs from air or by convective-diffusion from a liquid suspension, but often bacteria adhere by transmission from a bacterially contaminated donor to a receiver surface. Therewith bacterial transmission is mechanistically different from adhesion, as it involves bacterial detachment from a donor surface followed by adhesion to a receiver one. Transmission is further complicated when the donor surface is not covered with a single layer of adhering bacteria but with a multi-layered biofilm, in which case bacteria can be transmitted either by interfacial failure at the biofilm-donor surface or through cohesive failure in the biofilm. Transmission through cohesive failure in a biofilm is more common than interfacial failure. The aim of this review is to oppose surface thermodynamics and adhesion force analyses, as can both be applied towards bacterial adhesion, with their appropriate extensions towards transmission. Opposition of surface thermodynamics and adhesion force analyses, will allow to distinguish between transmission of bacteria from a donor covered with a (sub)monolayer of adhering bacteria or a multi-layered biofilm. Contact angle measurements required for surface thermodynamic analyses of transmission are of an entirely different nature than analyses of adhesion forces, usually measured through atomic force microscopy. Nevertheless, transmission probabilities based on Weibull analyses of adhesion forces between bacteria and donor and receiver surfaces, correspond with the surface thermodynamic preferences of bacteria for either the donor or receiver surface. Surfaces with low adhesion forces such as polymer-brush coated or nanostructured surfaces are thus preferable for use as non-adhesive receiver surfaces, but at the same time should be avoided for use as a donor surface. Since bacterial transmission occurs under a contact pressure between two surfaces, followed by their separation under tensile or shear pressure and ultimately detachment, this will affect biofilm structure. During the compression phase of transmission, biofilms are compacted into a more dense film. After transmission, and depending on the ability of the bacterial strain involved to produce extracellular polymeric substances, biofilm left-behind on a donor or transmitted to a receiver surface will relax to its original, pre-transmission structure owing to the viscoelasticity of the extracellular polymeric substances matrix, when present. Apart from mechanistic differences between bacterial adhesion and transmission, the low numbers of bacteria generally transmitted require careful selection of suitably sensitive enumeration methods, for which culturing and optical coherence tomography are suggested. Opposing adhesion and transmission as done in this review, not only yields a better understanding of bacterial transmission, but may stimulate researchers to more carefully consider whether an adhesion or transmission model is most appropriate in the specific area of application aimed for, rather than routinely relying on adhesion models.