RESUMO
BACKGROUND: We evaluated a new chemoimmunotherapy combination based on the anti-PD1 monoclonal antibody pembrolizumab and the pyrimidine antimetabolite gemcitabine in HER2- advanced breast cancer (ABC) patients previously treated in the advanced setting, in order to explore a potential synergism that could eventually obtain long term benefit in these patients. METHODS: HER2-negative ABC patients received 21-day cycles of pembrolizumab 200 mg (day 1) and gemcitabine (days 1 and 8). A run-in-phase (6 + 6 design) was planned with two dose levels (DL) of gemcitabine (1,250 mg/m2 [DL0]; 1,000 mg/m2 [DL1]) to determine the recommended phase II dose (RP2D). The primary objective was objective response rate (ORR). Tumor infiltrating lymphocytes (TILs) density and PD-L1 expression in tumors and myeloid-derived suppressor cells (MDSCs) levels in peripheral blood were analyzed. RESULTS: Fourteen patients were treated with DL0, resulting in RP2D. Thirty-six patients were evaluated during the first stage of Simon's design. Recruitment was stopped as statistical assumptions were not met. The median age was 52; 21 (58%) patients had triple-negative disease, 28 (78%) visceral involvement, and 27 (75%) ≥ 2 metastatic locations. Progression disease was observed in 29 patients. ORR was 15% (95% CI, 5-32). Eight patients were treated ≥ 6 months before progression. Fourteen patients reported grade ≥ 3 treatment-related adverse events. Due to the small sample size, we did not find any clear association between immune tumor biomarkers and treatment efficacy that could identify a subgroup with higher probability of response or better survival. However, patients that experienced a clinical benefit showed decreased MDSCs levels in peripheral blood along the treatment. CONCLUSION: Pembrolizumab 200 mg and gemcitabine 1,250 mg/m2 were considered as RP2D. The objective of ORR was not met; however, 22% patients were on treatment for ≥ 6 months. ABC patients that could benefit of chemoimmunotherapy strategies must be carefully selected by robust and validated biomarkers. In our heavily pretreated population, TILs, PD-L1 expression and MDSCs levels could not identify a subgroup of patients for whom the combination of gemcitabine and pembrolizumab would induce long term benefit. TRIAL REGISTRATION: ClinicalTrials.gov and EudraCT (NCT03025880 and 2016-001,779-54, respectively). Registration dates: 20/01/2017 and 18/11/2016, respectively.
Assuntos
Neoplasias da Mama , Feminino , Humanos , Pessoa de Meia-Idade , Antígeno B7-H1 , Mama , Neoplasias da Mama/tratamento farmacológico , GencitabinaRESUMO
BACKGROUND: COVID-19 pandemic causes high global morbidity and mortality and better medical treatments to reduce mortality are needed. OBJECTIVE: To determine the added benefit of cyclosporine A (CsA), to low-dose steroid treatment, in patients with COVID-19. METHODS: Open-label, non randomized pilot study of patients with confirmed infection of SARS-CoV-2 hospitalized from April to May 2020 at a single centre in Puebla, Mexico. Patients were assigned to receive either steroids or CsA plus steroids. Pneumonia severity was assessed by clinical, laboratory, and lung tomography. The death rate was evaluated at 28 days. RESULTS: A total of 209 adult patients were studied, 105 received CsA plus steroids (age 55.3 ± 13.3; 69% men), and 104 steroids alone (age 54.06 ± 13.8; 61% men). All patients received clarithromycin, enoxaparin and methylprednisolone or prednisone up to 10 days. Patient's death was associated with hypertension (RR = 3.5) and diabetes (RR = 2.3). Mortality was 22 and 35% for CsA and control groups (P = 0.02), respectively, for all patients, and 24 and 48.5% for patients with moderate to severe disease (P = 0.001). Higher cumulative clinical improvement was seen for the CsA group (Nelson Aalen curve, P = 0.001, log-rank test) in moderate to severe patients. The Cox proportional hazard analysis showed the highest HR improvement value of 2.15 (1.39-3.34, 95%CI, P = 0.0005) for CsA treatment in moderate to severe patients, and HR = 1.95 (1.35-2.83, 95%CI, P = 0.0003) for all patients. CONCLUSION: CsA used as an adjuvant to steroid treatment for COVID-19 patients showed to improve outcomes and reduce mortality, mainly in those with moderate to severe disease. Further investigation through controlled clinical trials is warranted.
Assuntos
Tratamento Farmacológico da COVID-19 , Ciclosporina/uso terapêutico , Glucocorticoides/uso terapêutico , Metilprednisolona/uso terapêutico , Prednisona/uso terapêutico , COVID-19/mortalidade , COVID-19/patologia , Ciclosporina/efeitos adversos , Quimioterapia Combinada , Feminino , Glucocorticoides/administração & dosagem , Humanos , Pulmão/patologia , Masculino , Metilprednisolona/administração & dosagem , Pessoa de Meia-Idade , Projetos Piloto , Prednisona/administração & dosagem , Resultado do TratamentoRESUMO
Objective (a) to assess the prevalence of functional gastrointestinal disorders (FGIDs) in female Mexican systemic lupus erythematosus (SLE) patients using the Rome III criteria and (b) to examine the effect of disease duration on FGID prevalence. Methods Female SLE outpatients aged ≥18 years with no organic gastrointestinal disorder were included. Participants were invited to upper gastrointestinal endoscopy screening and a faecal immunochemical test. FGID symptoms were evaluated using the Rome III questionnaire. Results Eighty-six SLE patients with median age of 45 (interquartile range 34-54) years were included. At least one FGID was found in 76.7% (66/88) of patients with SLE. The most prevalent domains of FGID diagnosed were functional oesophageal, gastroduodenal disorders and bowel disorders, of which functional dyspepsia (72.7%), functional heartburn (68.1%) and bloating (63.8%) were the most frequent. Fifty-nine per cent of patients had overlapping FGIDs. The most prevalent overlap was the combination of functional dyspepsia and functional heartburn. Patients with longer disease duration had a higher prevalence of FGID than those with shorter disease duration. Conclusions There was a high prevalence of FGIDs in Mexican SLE women with low disease activity. Overlapping FGIDs were frequent. Longer disease duration may be associated with FGIDs in SLE patients.
Assuntos
Gastroenteropatias/epidemiologia , Lúpus Eritematoso Sistêmico/epidemiologia , Adolescente , Adulto , Estudos Transversais , Dispepsia/diagnóstico , Dispepsia/epidemiologia , Endoscopia Gastrointestinal , Fezes/química , Feminino , Gastroenteropatias/diagnóstico , Azia/diagnóstico , Azia/epidemiologia , Humanos , Imuno-Histoquímica , Lúpus Eritematoso Sistêmico/diagnóstico , México/epidemiologia , Pessoa de Meia-Idade , Prevalência , Inquéritos e Questionários , Fatores de Tempo , Adulto JovemRESUMO
The importance of the immunomodulatory effects of vitamin D has recently been associated with autoimmune and chronic inflammatory diseases. Vitamin D deficiency has been linked to the development of autoimmune conditions. Antiphospholipid syndrome is an autoimmune disease characterized by thrombotic events and obstetric complications in patients with antiphospholipid antibodies. Current data show that patients with antiphospholipid syndrome have a high prevalence of vitamin D deficiency even without classic risk factors. Several studies have suggested vitamin D may have anti-thrombotic functions. In antiphospholipid syndrome, low vitamin D serum levels have been associated with thrombotic manifestations, suggesting a possible protective role of vitamin D in antiphospholipid syndrome. This literature review presents current evidence on the haemostatic functions of vitamin D and their possible relationship with the clinical manifestations of antiphospholipid syndrome.
Assuntos
Síndrome Antifosfolipídica/complicações , Deficiência de Vitamina D/complicações , Vitamina D/metabolismo , Anticorpos Antifosfolipídeos/sangue , Anticoagulantes/uso terapêutico , Feminino , Humanos , Gravidez , Complicações Hematológicas na Gravidez/etiologia , Trombose/tratamento farmacológico , Trombose/etiologia , Deficiência de Vitamina D/tratamento farmacológicoRESUMO
We studied the epidemiologic triad-related factors influencing human papilloma virus (HPV) persistence in Mexican women with systemic lupus erythematosus (SLE). Patients aged ≥18 years with SLE (American College of Rheumatology criteria), with and without HPV persistence, were selected. Groups were analyzed by (1) host: clinical disease characteristics; (2) agent: (I) infectious (prevalence, incidence, HPV genotype and co-infections (≥2 HPV genotypes or mycoplasmas)), (II) chemical (contraceptives and immunosuppressive drugs) and (III) physical (vitamin D deficiency) and (3) environment. A total of 121 SLE patients were selected over a two-year period. (1) Host: mean age 45.8 years and disease duration 12.7 years. (2) Agent: (I) infectious. HPV infection prevalence in the second sample was 26.4%, high-risk HPV genotypes 21.5% and co-infections 7.4%. HPV infection incidence was 13.2%, persistence 13.2% and clearance 15.7%. (II) Chemical: use of oral hormonal contraceptives 5% and immunosuppressive treatment 97.5%. (III) Physical: Vitamin D levels were similar in both groups. (3) Environment: (I) natural. A total of 60.6% of patients were residents of Puebla City. (II) Social: The mean education level was 10.9. Poverty levels were: III degree 52.4%, IV degree 28% and II degree 17%. (III) Cultural behavioral: Onset of sexual life was 20.5 years, 10% had ≥3 sexual partners and 51.2% were postmenopausal. In conclusion, no factor of the epidemiologic triad was associated with HPV infection prevalence.
Assuntos
Lúpus Eritematoso Sistêmico/complicações , Lúpus Eritematoso Sistêmico/epidemiologia , Infecções por Papillomavirus/epidemiologia , Adulto , Idoso , Estudos de Coortes , Meio Ambiente , Feminino , Humanos , México/epidemiologia , Pessoa de Meia-Idade , Infecções por Papillomavirus/complicações , Infecções por Papillomavirus/virologia , Adulto JovemRESUMO
BACKGROUND: With the availability of high-quality asthma guidelines worldwide, one possible approach of developing a valid guideline, without re-working the evidence, already analysed by major guidelines, is the ADAPTE approach, as was used for the development of National Guidelines on asthma. METHODS: The guidelines development group (GDG) covered a broad range of experts from medical specialities, primary care physicians and methodologists. The core group of the GDG searched the literature for asthma guidelines 2005 onward, and analysed the 11 best guidelines with AGREE-II to select three mother guidelines. Key clinical questions were formulated covering each step of the asthma management. RESULTS: The selected mother guidelines are British Thoracic Society (BTS), GINA and GEMA 2015. Responses to the questions were formulated according to the evidence in the mother guidelines. Recommendations or suggestions were made for asthma treatment in Mexico by the core group, and adjusted during several rounds of a Delphi process, taking into account: 1. Evidence; 2. Safety; 3. Cost; 4. Patient preference - all these set against the background of the local reality. Here the detailed analysis of the evidence present in BTS/GINA/GEMA sections on prevention and diagnosis in paediatric asthma are presented for three age-groups: children with asthma ≤5 years, 6-11 years and ≥12 years. CONCLUSIONS: For the prevention and diagnosis sections, applying the AGREE-II method is useful to develop a scientifically-sustained document, adjusted to the local reality per country, as is the Mexican Guideline on Asthma.
Assuntos
Asma/diagnóstico , Asma/prevenção & controle , Criança , Pré-Escolar , Feminino , Humanos , Masculino , MéxicoAssuntos
COVID-19 , SARS-CoV-2 , Antivirais , Inibidores de Calcineurina/farmacologia , Humanos , Replicação ViralRESUMO
Tomato (Solanum lycopersicum L.) is an important vegetable crop in Mexico. The national production in 2009 was 2,043,814 metric tons with a value of $163,560,636 US. Since 2007, abnormal yellow and crispy leaves were observed in commercial tomato fields in Ensenada County, Baja California, Mexico. In affected fields from two localities (San Quintín Valley and Ensenada), symptomatic plants were randomly distributed and symptoms resembled previous descriptions of crinivirus infections in tomato (3). The symptoms and the presence of whiteflies (Bemisia tabaci and Trialeurodes vaporariorum) in the affected fields suggested a viral etiology. Leaf samples of 143 symptomatic tomato plants were collected in the 2007 and 2008 growing seasons. Total RNA was extracted and analyzed by reverse transcription (RT)-PCR assay for simultaneous detection of Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV). Degenerate primers (HS-11/HS-12) were used in combination with specific primers (TIC-3/TIC-4 and ToC-5/ToC-6) for detection of these viruses by nested-PCR (2). A PCR fragment of the expected size for TICV (223 bp) was amplified in 26 of 143 samples. None of the samples tested positive for ToCV. In addition, considering that whiteflies are vectors of begomoviruses, samples were also tested for presence of viral DNA. Results showed 30 positive samples and one with mixed infection. It is therefore possible that the viral disease symptoms observed could be caused in part by viruses other than TICV. Three amplicons from RT-PCR of tomato samples were cloned into the pGEM-T easy vector system II (Promega Corporation, Madison, WI) and sequenced. The sequence of one amplicon (GenBank Accession No. FJ609651) was compared with the sequences of other criniviruses reported in the NCBI/GenBank database using the Clustal V alignment method of the sequence analysis software suite Lasergene (MegAling, DNASTAR Inc., Madison, WI). Sequence analysis of the 223-bp PCR fragment corresponding to TICV showed 99.1% identity with a TICV isolate from Japan (GenBank Accession No. AB085602) and 100% identity with TICV isolates from the United States (GenBank Accession No. TIU67449). Although the presence of another crinivirus, ToCV, was reported previously in Mexico associated with tomato crops and two native weeds, S. nigrescens and Datura stramonium (1), this virus was not detected in Baja California during the present work. To our knowledge, this is the first report of TICV associated with tomato diseases in Mexico. The emerging of a previously unreported virus disease in tomato production areas of Mexico complicates disease management efforts. References: (1) P. Álvarez-Ruíz et al. Plant Pathol. 56:1043, 2007. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) G. C. Wisler et al. Plant Dis. 82:270, 1998.
RESUMO
INTRODUCTION: the tibial slope has been identified as one of the factors associated with graft failure after anterior cruciate ligament (ACL) reconstruction; however, its relationship with functional results has been little studied. The main purpose of this study is to determine the effect of the tibial slope on functional recovery in patients undergoing reconstruction of the anterior cruciate ligament. MATERIAL AND METHODS: we included patients with a diagnosis of anterior cruciate ligament injury undergoing primary reconstruction, from May 2018 to May 2019, who had a complete radiographic and clinical record; also, the scores from questionnaires of the International Knee Documentation Committee (IKDC) and Lysholm scores were collected pre surgical procedures and throughout the one-year follow-up. The measurement of the tibial slope was performed in lateral knee X-rays from the electronic clinical record. A descriptive analysis of first intention was done, and to achieve the objectives, we compared 25 patients who had normal tibial slope that were selected randomly with 25 patients who had increased tibial slope. RESULTS: a total of 98 patients were included, 73 had a normal tibial slope (equal to or less than 12 degrees) and 25 with an increased tibial slope (greater than 12 degrees), the average age in both groups was 28.43 years for the group with normal tibial slope and 28.26 for patients with increased tibial slope. Regarding the functional assessment, the IKDC and Lysholm scores at the end of the follow-up were better for patients with normal tibial slope. Graft failure was only identified in the group with increased tibial slope. On the other hand, the comparative analysis with the control group randomly selected who had normal tibial slope, showed a better functional result assessed by IKDC score at the end of the follow-up for the group with normal tibial slope. CONCLUSION: patients undergoing ACL reconstruction and increased Tibial Slope have an inferior functional result at one year of follow-up assessed by IKDC, when compared with patients with normal tibial slope.
INTRODUCCIÓN: el slope tibial (inclinación) se ha identificado como uno de los factores asociados a la falla del injerto tras una reconstrucción de ligamento cruzado anterior (LCA); sin embargo, su relación con los resultados funcionales ha sido poco estudiada. El objetivo de este estudio es determinar el efecto del slope tibial en la recuperación funcional, en pacientes sometidos a reconstrucción de LCA. MATERIAL Y MÉTODOS: se incluyeron los pacientes con lesión de LCA sometidos a reconstrucción primaria, de Mayo de 2018 a Mayo de 2019, midiendo el slope tibial y recabando los puntajes de IKDC y Lysholm. Se elaboró un análisis descriptivo de primera intención y para alcanzar los objetivos se realizó una comparativa de 25 pacientes con slope tibial normal seleccionados aleatoriamente contra 25 pacientes con slope tibial aumentado. RESULTADOS: se incluyeron 98 pacientes, 73 contaban con un slope tibial normal y 25 con un slope tibial aumentado. Los puntajes de IKDC y Lysholm al final del seguimiento fueron mejores en los pacientes con slope tibial normal. La falla del injerto sólo se identificó en el grupo con slope tibial aumentado. Por otro lado, al análisis comparativo con el grupo control demostró un mejor resultado funcional al final del seguimiento valorado por IKDC en el grupo con slope tibial normal. CONCLUSIÓN: los pacientes sometidos a reconstrucción de LCA y slope tibial aumentado tienen un resultado funcional inferior al año de seguimiento evaluado por IKDC en comparación con pacientes con slope tibial dentro de parámetros normales.
Assuntos
Reconstrução do Ligamento Cruzado Anterior , Adulto , HumanosRESUMO
BACKGROUND AND OBJECTIVES: We describe the development of Preanestes@s, a web-based application for preoperative assessment, which incorporates PreQuest, a smart computer-based self-assessment questionnaire for the automated management of information. Preanestes@s potentially enables remote non-telephonic preoperative assessment. The main objective of this work was the identification of factors that independently predict adequate completion of PreQuest. As a secondary objective, we assessed patient experience using the application. MATERIAL AND METHODS: To assess the influence of patient conditions on PreQuest completion, our sample included 880 adult patients scheduled to undergo surgery at our institution between February 2020 and February 2021. We evaluated patient satisfaction and acceptability with the use of the application and PreQuest. RESULTS: A total of 573 participants (65.1%) successfully completed the PreQuest. Age below 65 years and higher educational attainment were identified as independent predictors for PreQuest completion (p = 0.04 and p = 0.001, respectively). Most (89.4%) participants agreed that Preanestes@s was intuitive and easy to use, with over 85% showing high levels of acceptance of PreQuest prototype's communication improvement and ease of use. The final version of Preanestes@s and PreQuest was evaluated by 218 participants, many of whom (>74%) affirmed its ease of use. CONCLUSIONS: The use of Preanestes@s for preoperative assessment is supported by high levels of satisfaction with the prototype and by an eQuest completion rate greater than 65% in a non-selective population. In our sample, younger age and higher education attainment predicted higher rates PreQuest completion. Trial registration number NCT04259268.
Assuntos
Eletrônica , Satisfação do Paciente , Adulto , Humanos , Internet , Estudos Prospectivos , Inquéritos e QuestionáriosRESUMO
BACKGROUND AND OBJECTIVES: Little information is available on the use of computerized systems in preanesthetic assessment. Our aim was to evaluate staff acceptance of a computerized system for the structured recording of preoperative assessment data in our hospital. The time taken to complete the assessment was compared to the time usually taken to record the information on paper. MATERIAL AND METHODS: Observational, descriptive cross-sectional survey of user satisfaction 3 months after the system had been launched. We later carried out a prospective observational study of 796 preanesthetic assessment visits, comparing the mean time the users took to record information on paper to the time required to enter the data into the computer, analyzing differences between anesthesiologists and according to American Society of Anesthesiologists (ASA) classification and patient age. RESULTS: A total of 401 paper records and 395 electronic files were included. The users believed that the computerized system improved quality and accessibility of recorded data and clinical decision-making. The time required to enter data into the computer was believed to be the main drawback; the users took a mean (SD) 15.21 (5.41) minutes to enter the electronic data and 13.37 (5.08) minutes to record the information on paper (P < .001). There were also significant differences in the time taken to record data according to ASA classification and between anesthesiologists (P < .001). CONCLUSIONS: In spite of drawbacks such as extra time taken to record electronic data, the users perceived benefits, such as improved quality and accessibility of records. For this reason, the computerized system was well accepted.
Assuntos
Sistemas Computadorizados de Registros Médicos , Satisfação do Paciente , Cuidados Pré-Operatórios , Adulto , Estudos Transversais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estudos ProspectivosRESUMO
OBJECTIVES: To assess the utility of preoperative chest radiographic findings for predicting cardiopulmonary complications in smokers undergoing transurethral resection of urinary bladder tumors under spinal anesthesia. To analyze perioperative changes in attitude in this setting. MATERIAL AND METHODS: Prospective study of 309 smokers with > or = 20 pack-years of cumulative smoking who were candidates for transurethral resection of urinary bladder tumors. The patients were classified in 2 groups according to radiographic findings. Between groups we compared the incidence of cardiopulmonary complications, perioperative changes in attitude to anesthesia and surgery, delays in completing the preanesthesia workup, and differences in the duration of surgery and hospital stay. RESULTS: Patients older than 65 years were 1.92 times more likely to have significant findings on the chest radiograph. Radiographic findings were associated with a higher incidence of perioperative complications (P=.02), need for further preoperative consultations (P<.01), longer delay in completing the preanesthesia study (P<.01), longer mean (SD) hospital stay (3.43 [3.17] days vs 2.50 [1.77] days, P<.001), and longer duration of surgery (P<.001). Attitudes did not change in relation to radiographic findings during or after surgery. Chest radiography correctly classified 3.54% of the patients with complications (predictive value). CONCLUSIONS: The predictive value of chest radiography for cardiopulmonary complications is low and findings do not influence intra- or postoperative attitudes. We therefore find no justification for performing chest x-rays in the population studied.
Assuntos
Doenças Cardiovasculares/diagnóstico por imagem , Cistectomia/métodos , Pneumopatias/diagnóstico por imagem , Cuidados Pré-Operatórios , Radiografia Torácica , Fumar , Neoplasias da Bexiga Urinária/cirurgia , Fatores Etários , Idoso , Anestesia/efeitos adversos , Anestesia/métodos , Raquianestesia , Doenças Cardiovasculares/complicações , Feminino , Humanos , Complicações Intraoperatórias/prevenção & controle , Pneumopatias/complicações , Masculino , Pessoa de Meia-Idade , Planejamento de Assistência ao Paciente , Fumar/efeitos adversos , Espaço Subaracnóideo , Neoplasias da Bexiga Urinária/complicaçõesRESUMO
INTRODUCTION: Due to its high transmissibility, measures aimed at reducing the spread of SARS CoV2 have become mandatory. Different organizations have recommended performing polymerase chain reaction tests (PCR) as part of the preoperative screening of surgical patients. We aimed to determine the performance of PCR testing to detect asymptomatic carriers. METHODS: Observational study carried out at a tertiary care center. We compared the results of preoperative real-time reverse-transcription-PCR test (RT-PCR) performed on a cohort of patients pending surgery with the results we would have expected assuming the epidemiological data released by government offices. RESULTS: We registered no positives in the 2,722 preoperative RT-PCR tests performed in our health care area between epidemiological Weeks 18 to 21, meaning a cumulative incidence trending to zero. Assuming public epidemiological data, the probabilistic projection of potential asymptomatic individuals ranged from 0.27 × 10e-4 (according to official data of new cases diagnosed by PCR) to 4.69 × 10e-4 if we assumed cases confirmed by IgG test in our province. Assuming a RT-PCR sensitivity of 95%, to obtain a positive result we should perform 38,461 and 2,028 tests respectively. CONCLUSIONS: In scenarios of very low prevalence and despite high sensitivity scores, indiscriminate preoperative RT-PCR screening is of a questionable effectiveness for detecting asymptomatic carriers. Our findings evidence the difficulty of establishing reliable predictive models for the episodic and rapidly evolving incidence of infections such as has characterized the SARS CoV2 pandemic.
Assuntos
Teste de Ácido Nucleico para COVID-19 , COVID-19/diagnóstico , Portador Sadio/diagnóstico , Pandemias , Cuidados Pré-Operatórios , SARS-CoV-2 , COVID-19/epidemiologia , Teste de Ácido Nucleico para COVID-19/estatística & dados numéricos , Portador Sadio/epidemiologia , Humanos , Incidência , Prevalência , Estudos Retrospectivos , Espanha/epidemiologiaRESUMO
INTRODUCTION: Due to its high transmissibility, measures aimed at reducing the spread of SARS CoV2 have become mandatory. Different organizations have recommended performing polymerase chain reaction tests (PCR) as part of the preoperative screening of surgical patients. We aimed to determine the performance of PCR testing to detect asymptomatic carriers. METHODS: Observational study carried out at a tertiary care center. We compared the results of preoperative real-time reverse-transcription-PCR test (RT-PCR) performed on a cohort of patients pending surgery with the results we would have expected assuming the epidemiological data released by government offices. RESULTS: We registered no positives in the 2,722 preoperative RT-PCR tests performed in our health care area between epidemiological Weeks 18 to 21, meaning a cumulative incidence trending to zero. Assuming public epidemiological data, the probabilistic projection of potential asymptomatic individuals ranged from 0.27*10e -4 (according to official data of new cases diagnosed by PCR) to 4.69*10e -4 if we assumed cases confirmed by IgG test in our province. Assuming a RT-PCR sensitivity of 95%, to obtain a positive result we should perform 38,461 and 2,028 tests respectively. CONCLUSIONS: In scenarios of very low prevalence and despite high sensitivity scores, indiscriminate preoperative RT-PCR screening is of a questionable effectiveness for detecting asymptomatic carriers. Our findings evidence the difficulty of establishing reliable predictive models for the episodic and rapidly evolving incidence of infections such as has characterized the SARS CoV2 pandemic.
Assuntos
Infecções Assintomáticas/epidemiologia , Teste de Ácido Nucleico para COVID-19/métodos , COVID-19/diagnóstico , COVID-19/epidemiologia , Pandemias , Cuidados Pré-Operatórios , Teste de Ácido Nucleico para COVID-19/estatística & dados numéricos , Humanos , Incidência , Estudos Retrospectivos , Sensibilidade e EspecificidadeRESUMO
INTRODUCTION: Total knee arthroplasty (TKA) is one of the most successful orthopedic treatments, however, it has been associated with severe postsurgical pain in 30-60% of patients. We propose that infiltration of the articular capsule of the knee during surgery will decrease postsurgical pain. MATERIAL AND METHODS: Experimental, randomized, double-blind study in patients undergoing unilateral TKA between April 2018 and January 2019. Patients were divided into two groups, the first infiltration with placebo and the second with anesthetic solution and adjuvants (fentanyl, epinephrine and ketorolac). Pain was measured with the visual analog scale (VAS) at 4, 6, 8, 12, 18, 24, 36 and 48 hours postsurgical, as well as the consumption of opioid analgesics and antiemetics. RESULTS: 20 patients in each group, with a follow-up of 4 weeks. There were no significant differences in demographic characteristics between the two groups. Better control of postsurgical pain was observed in the group that received infiltration with anesthetic and adjuvant, as well as a decrease in the consumption of opioid analgesics and antiemetics. There was no difference in bleeding or in the incidence of infections between the two groups. CONCLUSION: Peri-capsular infiltration is a safe and effective method, as part of multimodal analgesia in total knee arthroplasty, as it decreases postsurgical pain, opioid and antiemetic use and does not increase postsurgical bleeding.
INTRODUCCIÓN: La artroplastía total de rodilla (ATR) es uno de los tratamientos ortopédicos más exitosos; sin embargo, se ha asociado a dolor postquirúrgico intenso en 30-60% de los pacientes. Nosotros planteamos que la infiltración de la cápsula articular de la rodilla durante la cirugía disminuirá el dolor postquirúrgico. MATERIAL Y MÉTODOS: Estudio experimental, aleatorio, doble ciego, en pacientes sometidos a ATR unilateral entre Abril de 2018 a Enero de 2019. Los pacientes fueron divididos en dos grupos, el primero infiltración con placebo y el segundo con solución anestésica y adyuvantes (fentanilo, epinefrina y ketorolaco). Se cuantificó mediante escala visual análoga (EVA) del dolor a las cuatro, seis, ocho, 12, 18, 24, 36 y 48 horas postquirúrgicas, así como del consumo de analgésicos opioides y antieméticos. RESULTADOS: Veinte pacientes en cada grupo, con un seguimiento de cuatro semanas. No hubo diferencias significativas en las características demográficas entre ambos grupos. Se observó un mejor control del dolor postquirúrgico en el grupo que recibió infiltración con anestésico y adyuvante, además de una disminución en el consumo de analgésicos opioides y antieméticos. No hubo diferencia en sangrado ni en la incidencia de infecciones entre ambos grupos. CONCLUSIÓN: La infiltración pericapsular es un método seguro y eficaz, como parte de la analgesia multimodal en la artroplastía total de rodilla, ya que disminuye el dolor postquirúrgico, el consumo de opioides y antieméticos y no incrementa el sangrado postquirúrgico.
Assuntos
Analgesia , Artroplastia do Joelho , Analgésicos Opioides/uso terapêutico , Anestésicos Locais , Método Duplo-Cego , Humanos , Manejo da Dor , Dor Pós-Operatória/tratamento farmacológico , Dor Pós-Operatória/prevenção & controleRESUMO
Transoral endoscopic thyroidectomy vestibular approach (TOETVA) is a novel and minimally invasive procedure, free of visible scars and showing encouraging results in terms of rapid recovery and less postoperative pain. It consists of performing the thyroidectomy through its natural orifice, using three ports in the oral vestibular area and carrying out a careful dissection to the sternal notch and the edges of both sternocleidomastoid muscles. The objective of this article is to describe the different anesthetic implications that this surgical technique entails, given that the evidence published to date in the literature is very limited. It is considered essential to control the recurrent laryngeal nerve using an endotracheal tube with electromyography to ensure its identification and integrity, as well as the use of other monitors such as the TOF watch or the bispectral index to ensure adequate anesthetic depth and an optimal level of muscle relaxation.
Assuntos
Anestésicos , Traumatismos do Nervo Laríngeo Recorrente , Endoscopia , Humanos , Nervo Laríngeo Recorrente , TireoidectomiaRESUMO
INTRODUCTION: In patients with peritoneal carcinomatosis (PC), the incidence of respiratory complications following cytoreductive surgery (CRS) and hyperthermic intraperitoneal chemotherapy (HIPEC) is not well established. We aimed to describe the center-specific incidence and patient characteristics associated with respiratory complications following CRS and HIPEC in patients receiving treatment for PC. MATERIALS AND METHODS: We used the University Hospital of Arrixaca study database to identify patients who underwent CRS and HIPEC for PC. Patients who experienced a post-operative respiratory complication were categorized according to the National Cancer Institute-Common Terminology Criteria for Adverse Events. Multivariable regression methods were used to identify independent risk factors for developing a respiratory complication following CRS and HIPEC. RESULTS: Between 2008 and 2017, we identified 247 patients who underwent CRS and HIPEC for PC. A total of eight patients (3.2%) were categorized as having a post-operative respiratory complication. A diaphragmatic peritonectomy and a PC index of > 14 were identified as independent risk factors for developing a respiratory complication. Radiographic evidence of a pleural effusion was identified in 72 patients who had CRS of the diaphragmatic peritoneum; however, only 6 (8.3%) of these patients required pleural drainage. CONCLUSIONS: Only 3.2% of patients developed a symptomatic respiratory complication following CRS and HIPEC. A pleural effusion was identified in almost all patients requiring a diaphragmatic peritonectomy as part of their CRS; however, less than one in ten of these patients required pleural drainage. Prophylactic insertion of a pleural drainage tube is, therefore, not indicated following CRS and HIPEC.
Assuntos
Quimioterapia do Câncer por Perfusão Regional/efeitos adversos , Procedimentos Cirúrgicos de Citorredução/efeitos adversos , Complicações Pós-Operatórias/epidemiologia , Doenças Respiratórias/epidemiologia , Adulto , Idoso , Feminino , Humanos , Hipertermia Induzida/efeitos adversos , Incidência , Pessoa de Meia-Idade , Neoplasias Peritoneais/tratamento farmacológico , Neoplasias Peritoneais/cirurgia , Complicações Pós-Operatórias/diagnóstico , Complicações Pós-Operatórias/etiologia , Doenças Respiratórias/diagnóstico , Doenças Respiratórias/etiologiaRESUMO
BACKGROUND: The incidence of incisional hernia in patients with peritoneal surface malignancies treated by cytoreduction plus hyperthermic intraperitoneal chemotherapy (HIPEC) remains unclear, and the criteria commonly used to indicate their repair cannot be applied in these patients. The objective of this work was to analyze the incidence of incisional hernias in these patients, identify the risk factors associated with their appearance, and propose an algorithm for their management. METHODS: We analyzed a series of patients with malignant pathologies of the peritoneal surface treated by cytoreduction with peritonectomy and HIPEC procedures between January 2008 and June 2017. Only patients with a minimum postoperative follow-up period of 12 months were included. RESULTS: Our series included 282 patients, 28 (10%) of whom developed an incisional hernia during the follow-up period. Fifty-one patients, all with ovarian cancer with peritoneal dissemination, did not receive HIPEC after cytoreduction as they were part of the control arm of the CARCINOHIPEC clinical trial (NCT02328716) or because they did not provide specific informed consent. In the multivariate analysis, treatment with HIPEC (OR 2.56, 95% CI [1.57, 4.31], p = 0.032) and the administration of preoperative systemic chemotherapy (OR = 1.59, 95% CI [1.26, 3.58], p = 0.041) were found to be independent factors related to the appearance of an incisional hernia. CONCLUSIONS: The incidence of incisional hernia after cytoreduction and HIPEC is within the ranges described in the literature for other abdominal surgery procedures. The use of systemic chemotherapy and treatment with HIPEC, in particular, were identified as factors related to their occurrence.
Assuntos
Antineoplásicos/efeitos adversos , Procedimentos Cirúrgicos de Citorredução/efeitos adversos , Quimioterapia Intraperitoneal Hipertérmica/efeitos adversos , Hérnia Incisional/epidemiologia , Neoplasias Peritoneais/cirurgia , Adolescente , Adulto , Idoso , Algoritmos , Antineoplásicos/administração & dosagem , Feminino , Herniorrafia , Humanos , Incidência , Hérnia Incisional/etiologia , Hérnia Incisional/cirurgia , Pessoa de Meia-Idade , Neoplasias Ovarianas/tratamento farmacológico , Neoplasias Ovarianas/patologia , Neoplasias Ovarianas/cirurgia , Neoplasias Peritoneais/tratamento farmacológico , Neoplasias Peritoneais/secundário , Peritônio/patologia , Peritônio/cirurgia , Estudos Retrospectivos , Fatores de Risco , Espanha/epidemiologia , Adulto JovemRESUMO
Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.