Design of a sorbitol-activated nitrogen metabolism-dependent regulatory system for redirection of carbon metabolism flow in Bacillus licheniformis.

Synthetic regulation of metabolic fluxes has emerged as a common strategy to improve the performance of microbial cell factories. The present regulatory toolboxes predominantly rely on the control and manipulation of carbon pathways. Nitrogen is an essential nutrient that plays a vital role in growth and metabolism. However, the availability of broadly applicable tools based on nitrogen pathways for metabolic regulation remains limited. In this work, we present a novel regulatory system that harnesses signals associated with nitrogen metabolism to redirect excess carbon flux in Bacillus licheniformis. By engineering the native transcription factor GlnR and incorporating a sorbitol-responsive element, we achieved a remarkable 99% inhibition of the expression of the green fluorescent protein reporter gene. Leveraging this system, we identified the optimal redirection point for the overflow carbon flux, resulting in a substantial 79.5% reduction in acetoin accumulation and a 2.6-fold increase in acetate production. This work highlight the significance of nitrogen metabolism in synthetic biology and its valuable contribution to metabolic engineering. Furthermore, our work paves the way for multidimensional metabolic regulation in future synthetic biology endeavors.

Insight into the Cold Adaptation Mechanism of an Aerobic Denitrifying Bacterium: Bacillus simplex H-b.

Psychrophilic bacteria with aerobic denitrification ability have promising potential for application in nitrogen-contaminated wastewater treatment, especially under cold conditions. A better understanding of the cold adaptation mechanism during aerobic denitrification would be beneficial for the practical application of this type of functional bacterium. In this study, Bacillus simplex H-b with good denitrification performance at 5°C was used to investigate the corresponding cold tolerance mechanism. Transcriptomics and nitrogen removal characterization experiments were conducted at different temperatures (5°C, 20°C, and 30°C). At low temperatures, more nitrogen was utilized for assimilation, accompanied by the accumulation of ATP and extracellular polymeric substances (EPS), rather than transforming inorganic nitrogen in the dissimilation pathway. In addition, the proportion of unsaturated fatty acids was higher in strains cultured at low temperatures. At the molecular level, the adjustment of membrane transport, synthesis of cofactors and vitamins, and transcriptional regulators might contribute to the survival of the strain under cold conditions. Moreover, nucleotide precursor synthesis, translation, and oxidative and temperature stress response mechanisms also enhanced the resistance of strain H-b to low temperatures. The results suggest that combining multiple regulatory mechanisms and synergistic adaptation to cold stress enabled the growth and relatively high nitrogen removal rate (27.22%) of strain H-b at 5°C. By clarifying the mechanism of regulation and cold resistance of strain H-b, a theoretical foundation for enhancing the application potential of this functional bacterium for nitrogen-contaminated wastewater treatment was provided. IMPORTANCE The newly isolated aerobic denitrifying bacterium Bacillus simplex H-b removed various forms of inorganic nitrogen (nitrate, nitrite, and ammonium) from wastewater, even when the temperature was as low as 5°C. Although this environmentally functional bacterium has been suggested as a promising candidate for nitrogen-contaminated water treatment at low temperatures, understanding its cold adaptation mechanism during aerobic denitrification is limited. In this study, the cold tolerance mechanism of this strain was comprehensively explained. Furthermore, a theoretical basis for the practical application of this type of functional bacterium for nitrogen removal in cold regions is provided. The study expands our understanding of the survival strategy of psychrophilic bacteria and hence supports their further utilization in wastewater treatment applications.

Synergism of Photo-Induced Electron Transfer and Aggregation-Induced Quenching Mechanisms for Highly Sensitive Detection of Silver Ion and Captopril.

Carbon-based nanoprobes, with excellent physicochemical performance and biocompatibility, are a kind of ideal nanomaterial for biosensing. Herein, we designed and prepared novel oxygen-doped nitrogen-enrichment carbon nanoribbons (ONCNs) with an excellent optical performance and uniform morphology, which could be used as a dual-mode fluorescence probe for the detection of Ag+ ion and captopril (Ctl) based on the synergism of photo-induced electron transfer and aggregation-induced quenching mechanisms. By recording the changes in fluorescent intensities of ONCNs, the Ag+ ion and Ctl concentrations can be easily tested in real samples. The results displayed that two good linear relationships existed between the change in fluorescent intensity of ONCNs and the concentrations of Ag+ ion and Ctl in the ranges of 3 µM to 30 µM and 1 µM to 30 µM, with the detection limit of 0.78 µM and 74 nM, respectively. The proposed sensing platform has also been successfully applied for the Ctl analysis in commercial tablet samples based on its high selectivity, proving its value in practical applications.

Engineering of Bacillus Promoters Based on Interacting Motifs between UP Elements and RNA Polymerase (RNAP) α-Subunit.

Bacillus genetics need more versatile promoters for gene circuit engineering. UP elements are widely distributed in noncoding regions and interact with the α-subunit of RNA polymerase (RNAP). They can be applied as a standard element for synthetic biology. Characterization of the binding motif between UP elements and RNAP may assist with rational and effective engineering. In this study, 11 Bacillus constitutive promoters were screened for strength in Bacillus licheniformis. The motif in UP elements from a strong native promoter, PLan, was characterized. The influence of specific sequences on RNAP binding and expression strength was investigated both in vitro and in vivo. It was found that sequences up to 50 base pairs upstream of the consensus motif significantly contributed to α-CTD (the alpha subunit carboxy-terminal domain) association. Meanwhile, two repeats of a proximal subsite were able to more strongly activate the expression (by 8.2-fold) through strengthening interactions between UP elements and RNAP. Based the above molecular basis, a synthetic UP element, UP5-2P, was constructed and applied to nine wild-type promoters. Fluorescence polarization results demonstrated that it had an apparent effect on promoter-α-CTD interactions, and elevated expression strength was observed for all the engineered promoters. The highest improved core promoter, Pacpp, was more strongly activated by 7.4-fold. This work thus develops a novel strategy for Bacillus promoter engineering.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Recombinant Human Arresten and Canstatin Inhibit Angiogenic Behaviors of HUVECs via Inhibiting the PI3K/Akt Signaling Pathway.

Angiogenetic inhibitors are crucial in tumor therapy, and endogenous angiogenesis inhibitors have attracted considerable attention due to their effectiveness, safety, and multi-targeting ability. Arresten and canstatin, which have anti-angiogenesis effects, are the c-terminal fragments of the α1 and α2 chains of type IV collagen, respectively. In this study, human arresten and canstatin were recombinantly expressed in Escherichia coli (E. coli), and their effects on the proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs) were evaluated. Regarding the cell cycle distribution test and 5-ethynyl-2'-deoxyuridine (EdU) assays, arresten and canstatin could repress the proliferation of HUVECs at a range of concentrations. Transwell assay indicated that the migration of HUVECs was significantly decreased in the presence of arresten and canstatin, while tube formation assays suggested that the total tube length and junction number of HUVECs were significantly inhibited by these two proteins; moreover, they could also reduce the expression of vascular endothelial growth factor (VEGF) and the phosphorylation levels of PI3K and Akt, which indicated that the activation of the 3-kinase/serine/threonine-kinase (PI3K/Akt) signaling pathway was inhibited. These findings may have important implications for the soluble recombinant expression of human arresten and canstatin, and for the related therapy of cancer.

Comparative transcriptomics and transcriptional regulation analysis of enhanced laccase production induced by co-culture of Pleurotus eryngii var. ferulae with Rhodotorula mucilaginosa.

The co-culturing of Pleurotus eryngii var. ferulae and Rhodotorula mucilaginosa was confirmed in our previous studies to be an efficient strategy to improve laccase production by submerged fermentation. To determine the possible regulation principles underlying this behaviour, comparative transcriptomic analysis was performed on P. eryngii var. ferulae to investigate the differential expression of genes in co-culture. RNA-seq analysis showed that genes concerning xenobiotic biodegradation and expenditure of energy were upregulated. However, genes related to oxidative stress were downregulated. In addition, the transcription levels of laccase isoenzymes were not consistent in the co-culture system: 3 laccase genes (lacc1, lacc2, lacc12) were upregulated, and 3 laccase genes (lacc4, lacc6, lacc9) were downregulated. The enhancement in laccase activity can be due to upregulation of a laccase heterodimer encoded by the genes lacc2 and ssPOXA3a (or ssPOXA3b), whose expression levels were increased by 459% and 769% (or 585% for ssPOXA3b) compared with those of a control, respectively. ß-Carotene produced by R. mucilaginosa upregulated the transcription of lacc2 only. Combining these results with an analysis of cis-acting responsive elements indicated that four transcription factors (TFs) had potential regulatory effects on the transcription of laccase genes. It was supposed that TFa regulated lacc transcription by binding with methyl jasmonate and heat shock response elements. The expression of TFb, TFc, and TFd was regulated by ß-carotene. However, ß-carotene had no effect on TFa expression. These results provide a possible mechanism for the regulation of laccase gene transcription in the co-culture system and are also beneficial for the future intensification of fungal laccase production.

Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis.

Bacillus licheniformis is an important industrial microorganism that can utilize a wide range of biomass. However, the lack of expression elements in B. licheniformis, especially regulated promoters, significantly restricts its applications. In this study, two promoters involved in the sugar alcohol uptake pathway, PmtlA and PmtlR, were characterized and developed as regulated promoters for expression. The results showed that mannitol, mannose, sorbitol, sorbose, and arabinose can act as inducers to activate expression from PmtlA at different levels. The induction by sorbitol was the strongest, and the optimal induction conditions were 15 g/L sorbitol during mid-logarithmic growth at 28 °C. In this work, the palindrome-like sequence 'TTGTCA-cacggctcc-TGCCAA' in PmtlA was identified as the binding site of the MtlR protein. This study helps to enrich the known inducible expression systems in B. licheniformis.

Unraveling the specific regulation of the shikimate pathway for tyrosine accumulation in Bacillus licheniformis.

L-Tyrosine serves as a common precursor for multiple valuable secondary metabolites. Synthesis of this aromatic amino acid in Bacillus licheniformis occurs via the shikimate pathway, but the underlying mechanisms involving metabolic regulation remain unclear. In this work, improved L-tyrosine accumulation was achieved in B. licheniformis via co-overexpression of aroGfbr and tyrAfbr from Escherichia coli to yield strain 45A12, and the L-tyrosine titer increased to 1005 mg/L with controlled glucose feeding. Quantitative RT-PCR results indicated that aroA, encoding DAHP synthase, and aroK, encoding shikimate kinase, were feedback-repressed by the end product L-tyrosine in the modified strain. Therefore, the native aroK was first expressed with multiple copies to yield strain 45A13, which could accumulate 1201 mg/L L-tyrosine. Compared with strain 45A12, the expression of aroB and aroF in strain 45A13 was upregulated by 21% and 27%, respectively, which may also have resulted in the improvement of L-tyrosine production. Furthermore, supplementation with 5 g/L shikimate enhanced the L-tyrosine titers of 45A12 and 45A13 by 29.1% and 24.0%, respectively. However, the yield of L-tyrosine per unit of shikimate decreased from 0.365 to 0.198 mol/mol after aroK overexpression in strain 45A12, which suggested that the gene product was also involved in uncharacterized pathways. This study provides a good starting point for further modification to achieve industrial-scale production of L-tyrosine using B. licheniformis, a generally recognized as safe workhorse.

Transcriptional Changes in the Xylose Operon in Bacillus licheniformis and Their Use in Fermentation Optimization.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25-42 °C) and was optimal at a neutral pH (pH 6.5-7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.

Substrate inactivation of bacterial L-aspartate α-decarboxylase from Corynebacterium jeikeium K411 and improvement of molecular stability by saturation mutagenesis.

Bacterial L-aspartate α-decarboxylase (PanD) is a potential biocatalyst for the green production of ß-alanine, an important block chemical for manufacturing nitrogen-containing chemicals in bio-refinery field. It was reported that the poor catalytic stability caused by substrate inactivation limited the large-scale application. Here, we investigated the characters of inactivation by L-aspartate of PanD from Corynebacterium jeikeium (PDCjei), and found that L-aspartate induced a time-, and concentration-dependent inactivation of PDCjei with the values of KI and kinact being 288.4 mM and 0.235/min, respectively. To improve the catalytic stability of PDCjei, conserved amino acid residues essential to catalytic stability were analyzed by comparing the discrepancy in the observed inactivation rate of various sources. By an efficient colorimetric high-throughput screening method, four mutants with 3.18-24.69% higher activity were obtained from mutant libraries. Among them, the best mutation (R3K) also performed 66.38% higher catalytic stability than the wild type, showing great potential for industrial bio-production of ß-alanine.

Identification of mutations restricting autocatalytic activation of bacterial L-aspartate α-decarboxylase.

Bacterial L-aspartate α-decarboxylase (PanD) specifically catalyzes the decarboxylation of L-aspartic acid to ß-alanine. It is translated as an inactive pro-protein, then processed by self-cleavage to form two small subunits with catalytic activity. There is a significant difference in the efficiency of this process among the reported PanDs, while the structural basis remains unclear. More PanDs with known sequences and characterized properties are needed to shed light on the molecular basis of the self-cleavage process. In this study, PanD genes from 33 selected origins were synthesized and expressed; using purified recombinant enzymes, their self-processing properties were characterized and classified. Three classes of PanDs were acquired based on their self-cleavage efficiency. Combined with the phylogenetic analysis and structure comparison, sited-directed mutagenesis was performed to investigate the effects of four mutants on self-processing. In comparison with the wild-type (96.4%), the self-cleavage efficiencies of mutants V23E, I26C, T27A, and E56S were decreased to 90.5, 83.6, 74.4 and 81.2%, respectively. The results indicated that residues of V23, I26, T27 and E56 were critical to the self-cleavage processing of PanDs. This work provided further understanding to the self-cleavage processing of PanDs, which may contribute to protein engineering of the enzyme.

Inducible expression of trehalose synthase in Bacillus licheniformis.

Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production.

Pellet-dispersion strategy to simplify the seed cultivation of Aspergillus niger and optimize citric acid production.

Citric acid (CA) as an extremely important platform compound has attracted intense attention due to wide applications and huge markets. Here, we proposed a novel method, using pellet inoculation to replace spores, and constructed the seed recycling cultivation process, effectively avoided the longtime (spore preparation 30 days) of seed culture (including spores germination 12 h) in the traditional batch-fermentation. On this basis, using pellet-dispersion strategy, the bottleneck caused by the mycelium structure was overcome, with the seed restoring high cell-viability with CA titer (11.0 g/L) even in the eighth batch compared to that in the control (4.6 g/L). The optimum morphology of these recycling cultured seeds for CA production was dispersed pattern rather than pellets. And the CA production was 130.5 g/L on average in 5 L five-conjoined-fermenters recycling eight batches, especially increasing 3.1 g/L compared with the control. To our knowledge, this is the first that reported the application of these strategies in effective production of CA. Our fermentation strategies not only significantly enhanced CA productivity, but also severed as a promising stepping-stone for other fermentations dominated with the filamentous fungi.

High-efficient production of citric acid by Aspergillus niger from high concentration of substrate based on the staged-addition glucoamylase strategy.

Citric acid (CA), an important platform-compound, has attracted much attention because of its broad applications and huge market demand. To solve high residual sugar at the fermentation end, we put forwarded strategy of pre-saccharification and then fermentation. Results showed that the residual total sugar decreased by 10.4% and the productivity increased by 4.0% and initially high glucose inhibited cell growth. Furthermore, commercial glucoamylase with high low-pH stability was proposed to staged-add in the fermentation process, which timely compensated enzyme loss, ensuring the glucose supply rate. The fermentation productivity was evidently enhanced by 13.3% with residual total sugar decreasing by 31.3%, simplifying the subsequent product separation and extraction process. Our results confirmed that staged-addition glucoamylase strategy was feasible to effective production of CA.

Engineering of isoamylase: improvement of protein stability and catalytic efficiency through semi-rational design.

Isoamylase catalyzes the hydrolysis of α-1,6-glycosidic linkages in glycogen, amylopectin and α/ß-limit dextrins. A semi-rational design strategy was performed to improve catalytic properties of isoamylase from Bacillus lentus. Three residues in vicinity of the essential residues, Arg505, Asn513, and Gly608, were chosen as the mutation sites and were substituted by Ala, Pro, Glu, and Lys, respectively. Thermal stability of the mutant R505P and acidic stability of the mutant R505E were enhanced. The k cat /K m values of the mutant G608V have been promoted by 49%, and the specific activity increased by 33%. This work provides an effective strategy for improving the catalytic activity and stability of isoamylase, and the results obtained here may be useful for the improvement of catalytic properties of other α/ß barrel enzymes.

Genetic dissection of acetic acid tolerance in Saccharomyces cerevisiae.

Dissection of the hereditary architecture underlying Saccharomyces cerevisiae tolerance to acetic acid is essential for ethanol fermentation. In this work, a genomics approach was used to dissect hereditary variations in acetic acid tolerance between two phenotypically different strains. A total of 160 segregants derived from these two strains were obtained. Phenotypic analysis indicated that the acetic acid tolerance displayed a normal distribution in these segregants, and suggested that the acetic acid tolerant traits were controlled by multiple quantitative trait loci (QTLs). Thus, 220 SSR markers covering the whole genome were used to detect QTLs of acetic acid tolerant traits. As a result, three QTLs were located on chromosomes 9, 12, and 16, respectively, which explained 38.8-65.9 % of the range of phenotypic variation. Furthermore, twelve genes of the candidates fell into the three QTL regions by integrating the QTL analysis with candidates of acetic acid tolerant genes. These results provided a novel avenue to obtain more robust strains.

[Physiological and metabolic characteristics of five xylose utilizing yeasts].

OBJECTIVE: It is of great significance to improve the utilization of lignocellulosic material, the most abundant renewable resource on earth. METHODS: We studied the stress tolerance (temperature, ethanol and osmotic tolerance) of five xylose utilizing yeasts, Scheffersomyces stipitis, Candida tenuis, Spathaspora passalidarum, Candida amazonensis and Candida jeffriesii. We also tested their utilization ability of multiple carbon and nitrogen sources. RESULTS: S. passalidarum could tolerate at 44 degrees C and utilize various carbon and nitrogen sources effectively. S. passalidarum could metabolism xylose rapidly to produce ethanol, with an ethanol yield of 0.43 g/g under oxygen limiting condition. C. amazonensis could also torelate at 42 degrees C. Moreover, C. amazonensis could converse xylose to xylitol with ethanol as the main by-product. CONCLUSION: S. passalidarum is a potentially valuable workhorse in industrial utilization of lignocellulosic for its excellent characteristics. In addition, C. amazonensis may be a promising xylitol producer.

Synthesis of ß-alanine from L-aspartate using L-aspartate-α-decarboxylase from Corynebacterium glutamicum.

ß-Alanine is mainly produced by chemical methods in current industrial processes. Here, panD from Corynebacterium glutamicum encoding L-aspartate-α-decarboxylase (ADC) was cloned and expressed in Escherichia coli BL21(DE3). ADC C.g catalyzes the α-decarboxylation of L-aspartate to ß-alanine. The purified ADC C.g was optimal at 55 °C and pH 6 with excellent stability at 16-37 °C and pH 4-7. A pH-stat directed, fed-batch feeding strategy was developed for enzymatic synthesis of ß-alanine to keep the pH value within 6-7.2 and thus attenuate substrate inhibition. A maximum conversion of 97.2 % was obtained with an initial 5 g L-aspartate/l and another three feedings of 0.5 % (w/v) L-aspartate at 8 h intervals. The final ß-alanine concentration was 12.85 g/l after 36 h. This is the first study concerning the enzymatic production of ß-alanine by using ADC.

[Improvements of shikimic acid production in Escherichia coli with ideal metabolic modification in biosynthetic pathway--a review].

Shikimic acid (SA) is an important intermediate in the synthesis of aromatic amino acids and has emerged as a key chiral starting material for the synthesis of antiviral drug oseltamivir phosphate (Tamiflu). Microbial production of SA has a variety of advantages, and E. coli is commonly applied in large-scale fermentation and industrial production. Metabolic engineering is one of the main technical methods to construct the industrialized high-yield shikimic acid producing strains. Phosphoenolpyruvate: carbohydrate phosphotransferase system (PTS) is the major active transport system involved in the glucose internalization and phosphorylation in E. coli in which it affects the use ratio of PEP in cell. Modification and transformation of the PTS system could regulate the flow of intracellular metabolism and reduce the waste of PEP caused by the PTS system, in the same time, a more ideal shikimic acid producing strain can be constructed combined with the specific modifications of metabolic pathways. It was reported that in the 10 L system, shikimic acid yield reached up to 0.36 mol/mol, with concentration up to 84 g/L. This paper takes a brief overview of the metabolic engineering in the shikimic acid pathway and the transformation of the glucose transporter system, summarizes some latest researches and developments in recent years.