Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Use of molecular markers to study the effects of environmental impacts on genetic diversity in brown bullhead (Ameirus nebulosus) populations.

Conservation biology needs sound biological information in order to maintain biological diversity in the face of the current rate of loss. An important component of the information needed is the level of genetic diversity within and between populations, especially for those species faced with exposure to environmental stressors. We applied multilocus DNA profile analysis (highly variable number tandem repeats [HVNTR] and randomly amplified polymorphic DNA [RAPD] techniques) and allozyme analysis to test whether individuals from historically degraded sites display levels of genetic diversity different from individuals taken from reference sites. Four Lake Erie tributaries, two impacted and two reference sites, were the sources of brown bullhead (Ameiurus nebulosus) samples. Pairwise comparison of the sampled populations demonstrated an association of decreased genetic diversity with exposure of brown bullhead to stressors using both RAPD and HVNTR analysis.

Quality of assurance considerations for use of the Fluorlmager SI and fragmeNT analysis software.

The Fluorlmager SI (FSI) from Molecular Dynamics is one of several scanning instruments available for the detection of fluorescent emissions associated with DNA samples in a variety of matrices (agarose and polyacrylamide gels, membranes and microplates). In our laboratory, we measured the electrophoretic mobility of randomly amplified polymorphic DNA (RAPD) fragments stained with ethidium bromide in agarose using the FSI to scan gels and the associated Molecular Dynamics software (ImageQuaNT, and FragmeNT Analysis) for analysis. Initial scans and analyses resulted in inconsistent band detection across the same gel and across several scans of the same gel. To determine the best types of calibration for the instrument, several factors were considered and then evaluated. Tests of calibration acceptability were also evaluated. Band detection by FragmeNT Analysis was improved following optimization of matrices and parameters used in calibration and experimental scans. In addition, use of software templates for analysis and modifications in the staining procedure, which have resulted in decreased instrument associated variance, are discussed.