RESUMO
INTRODUCTION: Assessing the cumulative degree of bowel injury in ileal Crohn's disease (CD) is difficult. We aimed to develop machine learning (ML) methodologies for automated estimation of cumulative ileal injury on computed tomography-enterography (CTE) to help predict future bowel surgery. METHODS: Adults with ileal CD using biologic therapy at a tertiary care center underwent ML analysis of CTE scans. Two fellowship-trained radiologists graded bowel injury severity at granular spatial increments along the ileum (1 cm), called mini-segments. ML segmentation methods were trained on radiologist grading with predicted severity and then spatially mapped to the ileum. Cumulative injury was calculated as the sum (S-CIDSS) and mean of severity grades along the ileum. Multivariate models of future small bowel resection were compared with cumulative ileum injury metrics and traditional bowel measures, adjusting for laboratory values, medications, and prior surgery at the time of CTE. RESULTS: In 229 CTE scans, 8,424 mini-segments underwent analysis. Agreement between ML and radiologists injury grading was strong (κ = 0.80, 95% confidence interval 0.79-0.81) and similar to inter-radiologist agreement (κ = 0.87, 95% confidence interval 0.85-0.88). S-CIDSS (46.6 vs 30.4, P = 0.0007) and mean cumulative injury grade scores (1.80 vs 1.42, P < 0.0001) were greater in CD biologic users that went to future surgery. Models using cumulative spatial metrics (area under the curve = 0.76) outperformed models using conventional bowel measures, laboratory values, and medical history (area under the curve = 0.62) for predicting future surgery in biologic users. DISCUSSION: Automated cumulative ileal injury scores show promise for improving prediction of outcomes in small bowel CD. Beyond replicating expert judgment, spatial enterography analysis can augment the personalization of bowel assessment in CD.
RESUMO
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Assuntos
Regulação da Expressão Gênica de Plantas , Plantas Geneticamente Modificadas , Populus , Regiões Promotoras Genéticas , Populus/genética , Populus/metabolismo , Regiões Promotoras Genéticas/genética , Plantas Geneticamente Modificadas/genética , Desidratação/genética , Estresse Fisiológico/genética , Especificidade de Órgãos/genética , Folhas de Planta/genética , Folhas de Planta/metabolismoRESUMO
INTRODUCTION: There is a growing body of literature that shows geographic social vulnerability, which seeks to measure the resiliency of a community to withstand unforeseen disasters, may be associated with negative outcomes after traumatic injury. For motor vehicle collisions (MVCs) specifically, it is unknown how the resources of a patient's home environment may interact with resources of the environment where the crash occurred. METHODS: We merged publicly available crash data from the state of Michigan with the Michigan Trauma Quality Improvement dataset. A social vulnerability index (SVI) score was calculated for each ZIP code and was then cross-referenced between the location of the MVC (Crash-SVI) and the patient's home address (Home-SVI). SVI was divided into quintiles, with higher numbers indicating greater vulnerability. Adjusted logistic regression models using least absolute shrinkage and selection operator for feature selection and regularization were performed sequentially using patient, vehicular, and environmental variables to identify associations between Home-SVI and Crash-SVI, with mortality and injury severity score (ISS) greater than 15 (ISS15). RESULTS: Between January 2020 and December 2022, a total of 14,706 patients were identified. Most MVCs (75.3% of all patients) occurred in the second through fourth quintiles of SVI. In all cases, Crash-SVI occurred most frequently within the same quintile as the patient's Home-SVI. Average crash speed limits showed a significant negative association with increasing SVI. On adjusted logistic regression, there were significantly increased odds of mortality for the fifth quintile of Home-SVI in comparison to the first quintile when adjusted for patient factors; but this lost significance after the addition of vehicular or environmental variables. In contrast, there were decreased odds of ISS15 for the highest quintiles of Crash-SVI in all logistic regression models. CONCLUSIONS: Geographic social vulnerability markers were associated with lower MVC-associated injury severity, perhaps in part because of the association with lower speed limit in these areas.
RESUMO
INTRODUCTION: Abdominal aortic calcifications (AAC) are incidentally found on medical imaging and useful cardiovascular burden approximations. The Morphomic Aortic Calcification Score (MAC) leverages automated deep learning methods to quantify and score AACs. While associations of AAC and non-alcoholic fatty liver disease (NAFLD) have been described, relationships of AAC with other liver diseases and clinical outcome are sparse. This study's purpose was to evaluate AAC and liver-related death in a cohort of Veterans with chronic liver disease (CLD). METHODS: We utilized the VISN 10 CLD cohort, a regional cohort of Veterans with the three forms of CLD: NAFLD, hepatitis C (HCV), alcohol-associated (ETOH), seen between 2008 and 2014, with abdominal CT scans (n = 3604). Associations between MAC and cirrhosis development, liver decompensation, liver-related death, and overall death were evaluated with Cox proportional hazard models. RESULTS: The full cohort demonstrated strong associations of MAC and cirrhosis after adjustment: HR 2.13 (95% CI 1.63, 2.78), decompensation HR 2.19 (95% CI 1.60, 3.02), liver-related death HR 2.13 (95% CI 1.46, 3.11), and overall death HR 1.47 (95% CI 1.27, 1.71). These associations seemed to be driven by the non-NAFLD groups for decompensation and liver-related death [HR 2.80 (95% CI 1.52, 5.17; HR 2.34 (95% CI 1.14, 4.83), respectively]. DISCUSSION: MAC was strongly and independently associated with cirrhosis, liver decompensation, liver-related death, and overall death. Surprisingly, stratification results demonstrated comparable or stronger associations among those with non-NAFLD etiology. These findings suggest abdominal aortic calcification may predict liver disease severity and clinical outcomes in patients with CLD.
Assuntos
Doenças da Aorta , Cirrose Hepática , Calcificação Vascular , Veteranos , Humanos , Masculino , Feminino , Calcificação Vascular/diagnóstico por imagem , Calcificação Vascular/mortalidade , Cirrose Hepática/mortalidade , Cirrose Hepática/complicações , Cirrose Hepática/diagnóstico por imagem , Pessoa de Meia-Idade , Idoso , Veteranos/estatística & dados numéricos , Doenças da Aorta/mortalidade , Doenças da Aorta/diagnóstico por imagem , Doenças da Aorta/complicações , Hepatopatia Gordurosa não Alcoólica/complicações , Hepatopatia Gordurosa não Alcoólica/mortalidade , Hepatopatia Gordurosa não Alcoólica/diagnóstico por imagem , Aorta Abdominal/diagnóstico por imagem , Aorta Abdominal/patologia , Hepatopatias/mortalidade , Hepatopatias/diagnóstico por imagem , Hepatopatias/epidemiologia , Hepatopatias Alcoólicas/complicações , Hepatopatias Alcoólicas/mortalidade , Hepatopatias Alcoólicas/diagnóstico por imagem , Fatores de Risco , Estudos de CoortesRESUMO
The aim of this research was to describe the epidemiology, presentation and healthcare use in primary care for foot and ankle problems in children and young people (CYP) across England. We undertook a population-based cohort study using data from the Clinical Practice Research Datalink Aurum database, a database of anonymised electronic health records from general practices across England. Data was accessed for all CYP aged 0-18 years presenting to their general practitioner between January 2015 and December 2021 with a foot and/or ankle problem. Consultation rates were calculated and used to estimate numbers of consultations in an average practice. Hierarchical Poisson regression estimated relative rates of consultations across sociodemographic groups and logistic regression evaluated factors associated with repeat consultations. A total of 416,137 patients had 687,753 foot and ankle events, of which the majority were categorised as "musculoskeletal" (34%) and "unspecified pain" (21%). Rates peaked at 601 consultations per 10,000 patient-years among males aged 10-14 years in 2018. An average practice might observe 132 (95% CI 110 to 155) consultations annually. Odds for repeat consultations were higher among those with pre-existing diagnoses including juvenile arthritis (OR 1.73, 95% CI 1.48 to 2.03). Conclusions: Consultations for foot and ankle problems were high among CYP, particularly males aged 10 to 14 years. These data can inform service provision to ensure CYP access appropriate health professionals for accurate diagnosis and treatment. What is Known: ⢠Foot and ankle problems can have considerable impact on health-related quality of life in children and young people (CYP). ⢠There is limited data describing the nature and frequency of foot and ankle problems in CYP. What is New: ⢠Foot and ankle consultations were higher in English general practice among CYP aged 10 to 14 years compared to other age groups, and higher among males compared to females. ⢠The high proportion of unspecified diagnoses and repeat consultations suggests there is need for greater integration between general practice and allied health professionals in community-based healthcare settings.
Assuntos
Atenção Primária à Saúde , Humanos , Adolescente , Criança , Masculino , Feminino , Pré-Escolar , Lactente , Inglaterra/epidemiologia , Recém-Nascido , Estudos de Coortes , Atenção Primária à Saúde/estatística & dados numéricos , Doenças do Pé/epidemiologia , Doenças do Pé/diagnóstico , Encaminhamento e Consulta/estatística & dados numéricosRESUMO
KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.
Assuntos
Oryza , Oryza/genética , Secas , Plantas Geneticamente Modificadas/genética , Regiões Promotoras Genéticas/genética , Regulação da Expressão Gênica de PlantasRESUMO
KEY MESSAGE: A robust agroinfiltration-mediated transient gene expression method for soybean leaves was developed. Plant genotype, developmental stage and leaf age, surfactant, and Agrobacterium culture conditions are important for successful agroinfiltration. Agroinfiltration of Nicotiana benthamiana has emerged as a workhorse transient assay for plant biotechnology and synthetic biology to test the performance of gene constructs in dicot leaves. While effective, it is nonetheless often desirable to assay transgene constructs directly in crop species. To that end, we innovated a substantially robust agroinfiltration method for Glycine max (soybean), the most widely grown dicot crop plant in the world. Several factors were found to be relevant to successful soybean leaf agroinfiltration, including genotype, surfactant, developmental stage, and Agrobacterium strain and culture medium. Our optimized protocol involved a multi-step Agrobacterium culturing process with appropriate expression vectors, Silwet L-77 as the surfactant, selection of fully expanded leaves in the VC or V1 stage of growth, and 5 min of vacuum at - 85 kPa followed by a dark incubation period before plants were returned to normal growth conditions. Using this method, young soybean leaves of two lines-V17-0799DT, and TN16-5004-were high expressors for GUS, two co-expressed fluorescent protein genes, and the RUBY reporter product, betalain. This work not only represents a new research tool for soybean biotechnology, but also indicates critical parameters for guiding agroinfiltration optimization for other crop species. We speculate that leaf developmental stage might be the most critical factor for successful agroinfiltration.
Assuntos
Agrobacterium , Glycine max , Folhas de Planta , Plantas Geneticamente Modificadas , Glycine max/genética , Glycine max/microbiologia , Glycine max/crescimento & desenvolvimento , Folhas de Planta/genética , Folhas de Planta/metabolismo , Agrobacterium/genética , Regulação da Expressão Gênica de Plantas , Nicotiana/genética , Vetores Genéticos/genéticaRESUMO
INTRODUCTION: Footcare is an important component of wellbeing in older adults and the promotion of appropriate footcare interventions is imperative for health professionals working with this population. In this scoping review, we describe the health promotion models informing footcare interventions for older adults. The objectives were to (i) understand the context(s) where health promotion models have informed footcare interventions; (ii) identify the health promotion models informing interventions; and (iii) document the effectiveness of theoretically informed health promotion interventions for improving footcare in older adults. METHODS: Footcare interventions developed using health promotion models worldwide and published in English before July 2023 were searched using MEDLINE, Embase, CINAHL, Cochrane Library, and Google Scholar. RESULTS: A total of 2,078 articles were identified, of which 31 were retrieved and assessed for eligibility. Eight articles met the eligibility criteria, with most interventions delivered in Asia (n = 5) and using self-efficacy theory as their theoretical framework (n = 6). Most of the studies included people with diabetes (n = 6) and outcomes were measured using foot health outcomes, knowledge of foot health, and footcare behaviors and self-efficacy. CONCLUSION: This scoping review has identified a range of footcare interventions, with evidence of promising outcomes on improving footcare in older adults. Approaches toward methods and dosage of intervention varied across the studies and more broadly, we identified that few studies report the health promotion model informing the design of intervention(s). Further research is required to ascertain which health promotion model, modality of promotion, and implementation approach are the most effective for improving footcare in older adults.
Assuntos
Promoção da Saúde , Humanos , Promoção da Saúde/métodos , Idoso , Pé Diabético/terapia , Pé Diabético/prevenção & controle , AutoeficáciaRESUMO
Gender inequity remains an issue in anaesthesia despite increasing numbers of women training and achieving fellowship in the speciality. Women are under-represented in all areas of anaesthetic research, academia and leadership. The Gender Equity Subcommittee of the Australian and New Zealand College of Anaesthetists recently conducted a survey asking "Does gender still matter in the pursuit of a career in anaesthesia in 2022?". The survey was distributed to a randomly selected sample of 1225 anaesthetic consultants and completed by 470 respondents (38% response rate) with 793 free-text comments provided. Three overarching themes were identified: gender effects on the career and family interface; women do not fit the mould; and gender equity changes the status quo. Women respondents described a need to make a choice between career and family, which was not described by men, as well as stigmatisation of part-time work, a lack of access to challenging work and negative impacts of parental leave. Women respondents also described a sense of marginalisation within anaesthesia due to a 'boys' club' mentality, a lack of professional respect and insufficient structural supports for women in leadership. This was compounded for women from ethnically and culturally diverse backgrounds. A need for specific strategies to support anaesthetic careers for women was described as well as normalisation of flexibility in workplaces, combined with a broadening of our definition of success to allow people of all genders to experience fulfilment both at home and at work. This study is the first published qualitative data on factors affecting gender equity for anaesthetists in Australia and Aotearoa New Zealand. It highlights the need for further exploration, as well providing a foundation for changes in attitude and structural changes towards advancing gender equity.
Assuntos
Anestesiologia , Escolha da Profissão , Humanos , Nova Zelândia , Austrália , Feminino , Masculino , Inquéritos e Questionários , Equidade de Gênero , Adulto , Anestesistas/psicologia , Médicas/psicologia , Anestesiologistas/psicologia , Pesquisa Qualitativa , Sexismo , Pessoa de Meia-IdadeRESUMO
BACKGROUND: Primary central nervous system lymphoma (PCNSL) is a rare and distinct entity within diffuse large B-cell lymphoma presenting with variable response rates probably to underlying molecular heterogeneity. PATIENTS AND METHODS: To identify and characterize PCNSL heterogeneity and facilitate clinical translation, we carried out a comprehensive multi-omic analysis [whole-exome sequencing, RNA sequencing (RNA-seq), methylation sequencing, and clinical features] in a discovery cohort of 147 fresh-frozen (FF) immunocompetent PCNSLs and a validation cohort of formalin-fixed, paraffin-embedded (FFPE) 93 PCNSLs with RNA-seq and clinico-radiological data. RESULTS: Consensus clustering of multi-omic data uncovered concordant classification of four robust, non-overlapping, prognostically significant clusters (CS). The CS1 and CS2 groups presented an immune-cold hypermethylated profile but a distinct clinical behavior. The 'immune-hot' CS4 group, enriched with mutations increasing the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) and nuclear factor-κB activity, had the most favorable clinical outcome, while the heterogeneous-immune CS3 group had the worse prognosis probably due to its association with meningeal infiltration and enriched HIST1H1E mutations. CS1 was characterized by high Polycomb repressive complex 2 activity and CDKN2A/B loss leading to higher proliferation activity. Integrated analysis on proposed targets suggests potential use of immune checkpoint inhibitors/JAK1 inhibitors for CS4, cyclin D-Cdk4,6 plus phosphoinositide 3-kinase (PI3K) inhibitors for CS1, lenalidomide/demethylating drugs for CS2, and enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) inhibitors for CS3. We developed an algorithm to identify the PCNSL subtypes using RNA-seq data from either FFPE or FF tissue. CONCLUSIONS: The integration of genome-wide data from multi-omic data revealed four molecular patterns in PCNSL with a distinctive prognostic impact that provides a basis for future clinical stratification and subtype-based targeted interventions.
Assuntos
Neoplasias do Sistema Nervoso Central , Linfoma Difuso de Grandes Células B , Humanos , Fosfatidilinositol 3-Quinases/genética , Linfoma Difuso de Grandes Células B/patologia , Mutação , Complexo Repressor Polycomb 2/genética , Sistema Nervoso Central/patologia , Neoplasias do Sistema Nervoso Central/genética , Neoplasias do Sistema Nervoso Central/patologiaRESUMO
Nuclear energy, already a practical solution for supplying energy on a scale similar to fossil fuels, will likely increase its footprint over the next several decades to meet current climate goals. Gamma radiation is produced during fission in existing nuclear reactors and thus the need to detect leakage from nuclear plants, and effects of such leakage on ecosystems will likely also increase. At present, gamma radiation is detected using mechanical sensors that have several drawbacks, including: (i) limited availability; (ii) reliance on power supply; and (iii) requirement of human presence in dangerous areas. To overcome these limitations, we have developed a plant biosensor (phytosensor) to detect low-dose ionizing radiation. The system utilizes synthetic biology to engineer a dosimetric switch into potato utilizing the plant's native DNA damage response (DDR) machinery to produce a fluorescent output. In this work, the radiation phytosensor was shown to respond to a wide range of gamma radiation exposure (10-80 Grey) producing a reporter signal that was detectable at >3 m. Further, a pressure test of the top radiation phytosensor in a complex mesocosm demonstrated full function of the system in a 'real world' scenario.
Assuntos
Ecossistema , Plantas , Humanos , Raios gama , Plantas/genética , Monitoramento AmbientalRESUMO
Air displacement plethysmography (ADP) has been considered as the 'standard' method to determine body fat in children due to superior validity and reliability compared with bioelectrical impedance analysis (BIA). However, ADP and BIA are often used interchangeably despite few studies comparing measures of percentage body fat by ADP (%FMADP) with BIA (%FMBIA) in children with and without obesity. The objective of this study was to measure concurrent validity and reliability of %FMADP and %FMBIA in 6-to-12-year-old boys with and without obesity. Seventy-one boys (twenty-five with obesity) underwent body composition assessment. Ten boys participated in intra-day reliability analysis. %FMADP was estimated by Bodpod using sex- and age-specific equations of body density. %FMBIA was estimated by a multi-frequency, hand-to-foot device using child-specific equations based on impedance. Validity was assessed by t tests, correlation coefficients and limits of agreement (LoA); and reliability by technical error of measurement (TEM) and intraclass correlation coefficients (ICC). Compared with %FMADP, %FMBIA was significantly underestimated in the cohort (-3·4 ± 5·6 %; effect size = 0·42) and in both boys with obesity (-5·2 ± 5·5 %; ES = 0·90) and without obesity (-2·4 ± 5·5 %; ES = 0·52). A strong, significant positive correlation was found between %FMADP and %FMBIA (r = 0·80). Across the cohort, LoA were 22·3 %, and no proportional bias was detected. For reliability, TEM were 0·65 % and 0·55 %, and ICC were 0·93 and 0·95 for %FMBIA and %FMADP, respectively. Whilst both %FMADP and %FMBIA are highly reliable methods, considerable differences indicated that the devices cannot be used interchangeably in boys age 6-to-12 years.
Assuntos
Tecido Adiposo , Pletismografia , Masculino , Humanos , Criança , Impedância Elétrica , Reprodutibilidade dos Testes , Pletismografia/métodos , Composição Corporal , Obesidade/diagnóstico , Absorciometria de FótonRESUMO
KEY MESSAGE: A novel plant binary expression system was developed from the compactin biosynthetic pathway 27 of Penicillium citrinum ML-236B. The system achieved >fivefold activation of gene expression in 28 transgenic tobacco. A diverse and well-characterized genetic toolset is fundamental to achieve the overall goals of plant synthetic biology. To properly coordinate expression of a multigene pathway, this toolset should include binary systems that control gene expression at the level of transcription. In plants, few highly functional, orthogonal transcriptional regulators have been identified. Here, we describe the process of developing synthetic plant transcription factors using regulatory elements from the Penicillium citrinum ML-236B (compactin) pathway. This pathway contains several genes including mlcA and mlcC that are transcriptionally regulated in a dose-dependent manner by the activator mlcR. In Nicotiana benthamiana, we first expressed mlcR with several cognate synthetic promoters driving expression of GFP. Synthetic promoters contained operator sequences from the compactin gene cluster. Following identification of the most active synthetic promoter, the DNA-binding domain from mlcR was used to generate chimeric transcription factors containing variable activation domains, including QF from the Neurospora crassa Q-system. Activity was measured at both protein and RNA levels which correlated with an R2 value of 0.94. A synthetic transcription factor with a QF activation domain increased gene expression from its synthetic promoter up to sixfold in N. benthamiana. Two systems were characterized in transgenic tobacco plants. The QF-based plants maintained high expression in tobacco, increasing expression from the cognate synthetic promoter by fivefold. Transgenic plants and non-transgenic plants were morphologically indistinguishable. The framework of this study can easily be adopted for other putative transcription factors to continue improvement of the plant synthetic biology toolbox.
Assuntos
Penicillium , Biologia Sintética , Nicotiana/genética , Plantas Geneticamente Modificadas/genética , Fatores de Transcrição/genéticaRESUMO
BACKGROUND: Perforated peptic ulcer (PPU) remains challenging surgically due to its high mortality, especially in older individuals. Computed tomography (CT)-measured skeletal muscle mass is a effective predictor of the surgical outcomes in older patients with abdominal emergencies. The purpose of this study is to assess whether a low CT-measured skeletal muscle mass can provide extra value in predicting PPU mortality. METHODS: This retrospective study enrolled older (aged ≥ 65 years) patients who underwent PPU surgery. Cross-sectional skeletal muscle areas and densities were measured by CT at L3 and patient-height adjusted to obtain the L3 skeletal muscle gauge (SMG). Thirty-day mortality was determined with univariate, multivariate and Kaplan-Meier analysis. RESULTS: From 2011 to 2016, 141 older patients were included; 54.8% had sarcopenia. They were further categorized into the PULP score ≤ 7 (n=64) or PULP score > 7 group (n=82). In the former, there was no significant difference in 30-day mortality between sarcopenic (2.9%) and nonsarcopenic patients (0%; p=1.000). However, in the PULP score > 7 group, sarcopenic patients had a significantly higher 30-day mortality (25.5% vs. 3.2%, p=0.009) and serious complication rate (37.3% vs. 12.9%, p=0.017) than nonsarcopenic patients. Multivariate analysis showed that sarcopenia was an independent risk factor for 30-day mortality in patients in the PULP score > 7 group (OR: 11.05, CI: 1.03-118.7). CONCLUSION: CT scans can diagnose PPU and provide physiological measurements. Sarcopenia, defined as a low CT-measured SMG, provides extra value in predicting mortality in older PPU patients.
Assuntos
Úlcera Péptica Perfurada , Sarcopenia , Humanos , Idoso , Estudos Retrospectivos , Sarcopenia/diagnóstico por imagem , Sarcopenia/complicações , Estudos Transversais , Úlcera Péptica Perfurada/diagnóstico por imagem , Úlcera Péptica Perfurada/cirurgia , Fatores de RiscoRESUMO
INTRODUCTION: Small cell lung cancer (SCLC) is an aggressive malignancy with no established biomarkers. Schlafen 11(SLFN11), a DNA/RNA helicase that sensitises cancer cells to DNA-damaging agents, has emerged as a promising predictive biomarker for several drug classes including platinum and PARP inhibitors. Detection of SLFN11 in circulating tumour cells (CTCs) may provide a valuable alternative to tissue sampling. METHODS: SLFN11 expression was evaluated in tumour samples and characterised in circulating tumour cells (CTC) longitudinally to determine its potential role as a biomarker of response. RESULTS: Among 196 SCLC tumours, 51% expressed SLFN11 by IHC. In addition, 20/29 extra-thoracic high-grade neuroendocrine tumours expressed SLFN11 expression. In 64 blood samples from 42 SCLC patients, 83% (53/64) of samples had detectable CTCs, and SLFN11-positive CTCs were detected in 55% (29/53). Patients actively receiving platinum treatment had the lowest number of CTCs and a lower percentage of SLFN11-positive CTCs (p = 0.014). Analysis from patients with longitudinal samples suggest a decrease in CTC number and in SLFN11 expression that correlates with clinical response. CONCLUSIONS: SLFN11 levels can be monitored in CTCs from SCLC patients using non-invasive liquid biopsies. The ability to detect SLFN11 in CTCs from SCLC patients adds a valuable tool for the detection and longitudinal monitoring of this promising biomarker.
Assuntos
Neoplasias Pulmonares , Células Neoplásicas Circulantes , Proteínas Nucleares , Carcinoma de Pequenas Células do Pulmão , Biomarcadores , Biomarcadores Tumorais , Linhagem Celular Tumoral , DNA/uso terapêutico , Humanos , Neoplasias Pulmonares/tratamento farmacológico , Células Neoplásicas Circulantes/patologia , Proteínas Nucleares/genética , Platina/uso terapêutico , Carcinoma de Pequenas Células do Pulmão/tratamento farmacológicoRESUMO
In the age of synthetic biology, plastid engineering requires a nimble platform to introduce novel synthetic circuits in plants. While effective for integrating relatively small constructs into the plastome, plastid engineering via homologous recombination of transgenes is over 30 years old. Here we show the design-build-test of a novel synthetic genome structure that does not disturb the native plastome: the 'mini-synplastome'. The mini-synplastome was inspired by dinoflagellate plastome organization, which is comprised of numerous minicircles residing in the plastid instead of a single organellar genome molecule. The first mini-synplastome in plants was developed in vitro to meet the following criteria: (i) episomal replication in plastids; (ii) facile cloning; (iii) predictable transgene expression in plastids; (iv) non-integration of vector sequences into the endogenous plastome; and (v) autonomous persistence in the plant over generations in the absence of exogenous selection pressure. Mini-synplastomes are anticipated to revolutionize chloroplast biotechnology, enable facile marker-free plastid engineering, and provide an unparalleled platform for one-step metabolic engineering in plants.
Assuntos
Engenharia Genética , Plastídeos , Engenharia Metabólica , Plantas/genética , Plastídeos/genética , Biologia Sintética , TransgenesRESUMO
Hemophagocytic lymphohistiocytosis (HLH) and macrophage activation syndrome (MAS) are life-threatening hyperinflammatory syndromes typically associated with underlying hematologic and rheumatic diseases, respectively. Familial HLH is associated with genetic cytotoxic impairment and thereby to excessive antigen presentation. Extreme elevation of serum interleukin-18 (IL-18) has been observed specifically in patients with MAS, making it a promising therapeutic target, but how IL-18 promotes hyperinflammation remains unknown. In an adjuvant-induced MAS model, excess IL-18 promoted immunopathology, whereas perforin deficiency had no effect. To determine the effects of excess IL-18 on virus-induced immunopathology, we infected Il18-transgenic (Il18tg) mice with lymphocytic choriomeningitis virus (LCMV; strain Armstrong). LCMV infection is self-limited in wild-type mice, but Prf1-/- mice develop prolonged viremia and fatal HLH. LCMV-infected Il18-transgenic (Il18tg) mice developed cachexia and hyperinflammation comparable to Prf1-/- mice, albeit with minimal mortality. Like Prf1-/- mice, immunopathology was largely rescued by CD8 depletion or interferon-γ (IFNg) blockade. Unlike Prf1-/- mice, they showed normal target cell killing and normal clearance of viral RNA and antigens. Rather than impairing cytotoxicity, excess IL-18 acted on T lymphocytes to amplify their inflammatory responses. Surprisingly, combined perforin deficiency and transgenic IL-18 production caused spontaneous hyperinflammation specifically characterized by CD8 T-cell expansion and improved by IFNg blockade. Even Il18tg;Prf1-haplosufficient mice demonstrated hyperinflammatory features. Thus, excess IL-18 promotes hyperinflammation via an autoinflammatory mechanism distinct from, and synergistic with, cytotoxic impairment. These data establish IL-18 as a potent, independent, and modifiable driver of life-threatening innate and adaptive hyperinflammation and support the rationale for an IL-18-driven subclass of hyperinflammation.
Assuntos
Linfócitos T CD8-Positivos/imunologia , Inflamação/patologia , Peptídeos e Proteínas de Sinalização Intercelular/fisiologia , Interleucina-18/metabolismo , Coriomeningite Linfocítica/complicações , Vírus da Coriomeningite Linfocítica/patogenicidade , Perforina/fisiologia , Animais , Feminino , Inflamação/etiologia , Inflamação/metabolismo , Interferon gama/metabolismo , Interleucina-18/genética , Ativação Linfocitária , Coriomeningite Linfocítica/virologia , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Camundongos TransgênicosRESUMO
AIMS: Patients with low muscle mass have increased risk of paclitaxel-induced peripheral neuropathy, which is dependent on systemic paclitaxel exposure. Dose optimization may be feasible through the secondary use of radiologic data for body composition. The objective of this study was to interrogate morphomic parameters as predictors of paclitaxel pharmacokinetics to identify alternative dosing strategies that may improve treatment outcomes. METHODS: This was a secondary analysis of female patients with breast cancer scheduled to receive 80 mg/m2 weekly paclitaxel infusions. Paclitaxel was measured at the end of initial infusion to estimate maximum concentration (Cmax ). Computed tomography (CT) scans were used to measure 29 body composition features for inclusion in pharmacokinetic modelling. Monte Carlo simulations were performed to identify infusion durations that limit the probability of exceeding Cmax > 2885 ng/mL, which was selected based on prior work linking this to an unacceptable risk of peripheral neuropathy. RESULTS: Thirty-nine patients were included in the analysis. The optimal model was a two-compartment pharmacokinetic model with T11 skeletal muscle area as a covariate of paclitaxel volume of distribution (Vd). Simulations suggest that extending infusion of the standard paclitaxel dose from 1 hour to 2 and 3 hours in patients who have skeletal muscle area 4907-7080 mm2 and <4907 mm2 , respectively, would limit risk of Cmax > 2885 ng/mL to <50%, consequently reducing neuropathy, while marginally increasing overall systemic paclitaxel exposure. CONCLUSION: Extending paclitaxel infusion duration in ~25% of patients who have low skeletal muscle area is predicted to reduce peripheral neuropathy while maintaining systemic exposure, suggesting that personalizing paclitaxel dosing based on body composition may improve treatment outcomes.
Assuntos
Antineoplásicos Fitogênicos , Neoplasias da Mama , Doenças do Sistema Nervoso Periférico , Neoplasias da Mama/induzido quimicamente , Neoplasias da Mama/tratamento farmacológico , Feminino , Humanos , Imunoterapia , Músculos , Paclitaxel , Doenças do Sistema Nervoso Periférico/induzido quimicamenteRESUMO
Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores.