The effect of teriparatide compared with risedronate on reduction of back pain in postmenopausal women with osteoporotic vertebral fractures.

UNLABELLED: The effect of teriparatide and risedronate on back pain was tested, and there was no difference in the proportion of patients experiencing a reduction in back pain between groups after 6 or 18 months. Patients receiving teriparatide had greater increases in bone mineral density and had fewer vertebral fractures. INTRODUCTION: This study aimed to understand the effect of teriparatide in reducing back pain in patients with prevalent back pain and vertebral fracture compared to risedronate. METHODS: In an 18-month randomized, double-blind, double-dummy trial, we investigated the effects of teriparatide (20 µg/day) vs. risedronate (35 mg/week) in postmenopausal women with back pain likely due to vertebral fracture. The primary objective was to compare the proportion of subjects reporting ≥30% reduction in worst back pain severity from baseline to 6 months as assessed by a numeric rating scale in each treatment group. Pre-specified secondary and exploratory outcomes included assessments of average and worst back pain at additional time points, disability and quality of life, bone mineral density, incidence of fractures, and safety. RESULTS: At 6 months, 59% of teriparatide and 57% of risedronate patients reported ≥30% reduction in worst back pain and there were no differences between groups in the proportion of patients experiencing reduction in worst or average back pain at any time point, disability, or quality of life. There was a greater increase from baseline in bone mineral density at the lumbar spine (p = 0.001) and femoral neck (p = 0.02) with teriparatide compared to risedronate and a lower incidence of vertebral fractures at 18 months (4% teriparatide and 9% risedronate; p = 0.01). Vertebral fractures were less severe (p = 0.04) in the teriparatide group. There was no difference in the overall incidence of adverse events. CONCLUSIONS: Although there were no differences in back pain-related endpoints, patients receiving teriparatide had greater skeletal benefit than those receiving risedronate.

Collagen-induced arthritis is reduced in 5-lipoxygenase-activating protein-deficient mice.

Collagen-induced arthritis in the DBA/1 mouse is an experimental model of human rheumatoid arthritis. To examine the role of leukotrienes in the pathogenesis of this disease, we have developed embryonic stem (ES) cells from this mouse strain. Here, we report that DBA/1 mice made deficient in 5-lipoxygenase-activating protein (FLAP) by gene targeting in ES cells develop and grow normally. Zymosan-stimulated leukotriene production in the peritoneal cavity of these mice is undetectable, whereas they produce substantial amounts of prostaglandins. The inflammatory response to zymosan is reduced in FLAP-deficient mice. The severity of collagen-induced arthritis in the FLAP-deficient mice was substantially reduced when compared with wild-type or heterozygous animals. This was not due to an immunosuppressive effect, because anti-collagen antibody levels were similar in wild-type and FLAP-deficient mice. These data demonstrate that leukotrienes play an essential role in both the acute and chronic inflammatory response in mice.

Reduced incidence and severity of experimental autoimmune arthritis in mice expressing catalytically inactive A disintegrin and metalloproteinase 8 (ADAM8).

A disintegrin and metalloproteinase 8 (ADAM8), a catalytically active member of the ADAMs family of enzymes, is expressed primarily on immune cells and thus probably involved in inflammatory responses. ADAM8 is also produced by chondrocytes, and recombinant ADAM8 can induce cartilage catabolism. We therefore decided to test the role of ADAM8 in autoimmune inflammatory arthritis using transgenic mice expressing catalytically inactive ADAM8. Transgenic DBA/1J mice expressing an inactivating point mutation in the ADAM8 gene to change Glu330 to Gln330 (ADAM8(EQ)) were generated to evaluate the proteolytic function of ADAM8 in an lipopolysaccharide-synchronized collagen-induced arthritis (LPS-CIA) model of autoimmune arthritis. The systemic inflammatory reaction to LPS was also evaluated in these mice. Expression profiling of paw joints from wild-type mice revealed that ADAM8 mRNA levels increased at the onset of clinical arthritis and correlated well with cellular macrophage markers. When subjected to LPS-CIA, ADAM8(EQ) mice demonstrated decreased incidence and severity of clinical arthritis compared to wild-type mice. Histological examination of paw joints from ADAM8(EQ) mice confirmed marked attenuation of synovial inflammation, cartilage degradation and bone resorption when compared to wild-type mice. However, transgenic mice and wild-type mice responded similarly to LPS-induced systemic inflammation with regard to mortality, organ weights, neutrophil sequestration and serum cytokine/chemokine production. We conclude that ADAM8 proteolytic activity plays a key role in the development of experimental arthritis and may thus be an attractive target for the treatment of arthritic disorders while minimizing risk of immunocompromise.

Urinary calcium excretion in familial hypocalciuric hypercalcemia. Persistence of relative hypocalciuria after induction of hypoparathyroidism.

Familial hypocalciuric hypercalcemia (FHH) is an autosomal dominant trait comprising hypercalcemia, hypophosphatemia, parathyroid hyperplasia, and unusually low renal clearance of calcium. We evaluated the role of parathyroid hormone in the relative hypocalciuria of FHH and characterized the renal transport of calcium in this disorder using three previously hypercalcemic FHH patients with surgical hypoparathyroidism and three controls with surgical hypoparathyroidism. Intravenous infusion of calcium chloride in two patients with FHH and in three controls increased serum calcium from a mean basal of 5.0 to a mean peak of 6.8 meq/liter in two FHH patients and from 4.2 to 5.7 in three control subjects. Urinary calcium in a third FHH patient was studied without calcium infusion during recovery from hypercalcemia of vitamin D intoxication. At all serum concentrations of calcium, calcium clearance was lower in FHH than in controls; at base-line serum calcium, the ratio of calcium clearance to inulin clearance (C(Ca)/C(IN)) in FHH subjects was 32% of that in controls and decreased to 19% during hypercalcemia. Calcium infusion increased the ratio of sodium clearance to inulin clearance in controls from a base line of 0.020 to 0.053 at peak concentrations of calcium in serum, but did not affect this parameter in FHH (0.017 at base-line serum calcium vs. 0.019 at peak). When calcium infusion studies were performed (in two patients with FHH and one control) during administration of acetazolamide, a drug whose principal renal action causes inhibition of proximal transport of solute, C(Ca)/C(IN) in the patients with FHH was 29 and 7% of that of the control at base-line and peak serum calcium, respectively. In contrast, ethacrynic acid, a diuretic that acts in the ascending limb of the loop of Henle, increased C(Ca)/C(IN) more in the FHH patients than in the control subject; C(Ca)/C(IN) was 65% at base-line and 47% at peak serum calcium, compared with that of the control subject. The greater calciuric response to ethacrynic acid than to acetazolamide or calcium infusion alone in FHH indicates that a major renal locus of abnormal calcium transport in this disorder may be the ascending limb of the loop of Henle.Decreased clearance of calcium in patients with FHH and hypoparathyroidism when compared with hypoparathyroid controls indicates that relative hypocalciuria in FHH is not dependent on hyperparathyroidism. Since the parathyroid glands in FHH are not appropriately suppressed by calcium, this implies that FHH represents a disorder of abnormal transport of, and/or response to, extracellular calcium in at least two organs, parathyroid gland and kidney.

The prostaglandin E2 EP1 receptor mediates pain perception and regulates blood pressure.

The lipid mediator prostaglandin E2 (PGE2) has diverse biological activity in a variety of tissues. Four different receptor subtypes (EP1-4) mediate these wide-ranging effects. The EP-receptor subtypes differ in tissue distribution, ligand-binding affinity, and coupling to intracellular signaling pathways. To identify the physiological roles for one of these receptors, the EP1 receptor, we generated EP1-deficient (EP1-/-) mice using homologous recombination in embryonic stem cells derived from the DBA/1lacJ strain of mice. The EP1-/- mice are healthy and fertile, without any overt physical defects. However, their pain-sensitivity responses, tested in two acute prostaglandin-dependent models, were reduced by approximately 50%. This reduction in the perception of pain was virtually identical to that achieved through pharmacological inhibition of prostaglandin synthesis in wild-type mice using a cyclooxygenase inhibitor. In addition, systolic blood pressure is significantly reduced in EP1 receptor-deficient mice and accompanied by increased renin-angiotensin activity, especially in males, suggesting a role for this receptor in cardiovascular homeostasis. Thus, the EP1 receptor for PGE2 plays a direct role in mediating algesia and in regulation of blood pressure.

Glycemic improvement in diabetic db/db mice by overexpression of the human insulin-regulatable glucose transporter (GLUT4).

The effects of increased GLUT4 (insulin-regulatable muscle/fat glucose transporter) expression on glucose homeostasis in a genetic model of non-insulin-dependent diabetes mellitus were determined by expressing a human GLUT4 transgene (hGLUT4) in diabetic C57BL/KsJ-db/db mice. A genomic hGLUT4 construct was microinjected directly into pronuclear murine embryos of db/+ matings to maintain the inbred background. Four lines of hGLUT4 transgenic mice were bred to homozygosity at the db locus and all showed a marked reduction of both fasted and fed plasma glucose levels (to approximately 50 and 360 mg/dl, respectively) compared with age-matched nontransgenic db/db mice (approximately 215 and 550 mg/dl, respectively), as well as an enhanced disposal of an oral glucose challenge. In situ immunocytochemical localization of GLUT4 protein in muscle from hGLUT4 db/db mice showed elevated plasma membrane-associated GLUT4 protein in the basal state, which markedly increased after an insulin/glucose injection. In contrast, nontransgenic db/db mice had low levels of plasma membrane-associated GLUT4 protein in the basal state with a relatively small increase after an insulin/glucose challenge. Since the intracellular GLUT4 levels in db/db mice were similar to nontransgenic db/+ mice, the glucose transport defect in db/db mice is at the level of glucose transporter translocation. Together, these data demonstrate that GLUT4 upregulation overcomes the glucose transporter translocation defect and alleviates insulin resistance in genetically diabetic mice, thus resulting in markedly improved glycemic control.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Ectopic expression of Hox-2.3 induces craniofacial and skeletal malformations in transgenic mice.

To better understand the role of the Hox-2.3 murine homeobox gene during development, a dominant gain-of-function mutation was generated. The developmental malformations that resulted when the chicken beta-actin promoter was used to direct widespread expression of the Hox-2.3 gene in transgenic mice included early postnatal death as well as craniofacial abnormalities, including open eyes and cleft palate. Ventricular septal defects were also observed in the hearts of three transgenic mice. Skeletal malformations were seen in the bones of the craniocervical transition, with the occipital, basisphenoid, and atlas bones deficient or misshapen. Interestingly, one mutant exhibited an extra pair of ribs as well as alterations in cervical vertebrae identities. Some of the malformations observed in Hox-2.3 gain-of-function mutants overlap with those seen in Hox-1.1 and Hox-2.2 misexpression mutants which suggests functional similarities between paralogous homeobox genes. The results of these experiments are consistent with a role for Hox-2.3 in specifying positional information during development.

Pertussis toxin blocks the inhibitory effects of calcitonin on cyclic AMP accumulation in stimulated cultured human monocytes.

Surface stimulation of fresh or cultured human mononuclear cells by latex particles causes an increase in the accumulation of cyclic AMP that is inhibited by preincubation with calcitonin (CT). Preincubation of cultured monocytes with 500 ng/ml pertussis toxin totally blocks the inhibitory effects of CT at low concentrations of this hormone. The effects of pertussis toxin are dose-related and eliminated by boiling the toxin. Similar preincubations with cholera toxin have no significant effects on subsequent inhibition of surface-stimulated cyclic AMP by CT. Membranes prepared from cultured human monocytes contain a 41,000-dalton protein that is ADP-ribosylated by pertussis toxin and may be the inhibitory guanine nucleotide regulatory protein (Ni) mediating this inhibition.

Multiple endocrine neoplasia, type I. Association with marfanoid habitus, optic atrophy, and other abnormalities.

A patient had a parathyroid adenoma and prolactin-secreting pituitary tumor, suggestive of the multiple endocrine neoplasia (MEN) I syndrome. The presence of a marfanoid habitus--found more typically in MEN III syndrome--as well as mitral valve prolapse, mental retardation, and bilateral optic atrophy suggests a new variant of the MEN syndrome, possibly representing widespread dysplasia of endocrine and other tissues.

Radiation-associated recurrent parathyroid adenoma.

Recurrent parathyroid adenoma occurred in a patient who had received radiation treatments to the lateral aspect of the pharynx for lymphoid hyperplasia at the age of 10 years. The interval between the development of the first and second adenomas was 20 years. Although an association between head and neck irradiation and primary hyperparathyroidism is known, we believe this to be the first report of recurrent hyperparathyroidism in an irradiated patient.

Clodronate. A randomized study in the treatment of cancer-related hypercalcemia.

Malignancy-associated hypercalcemia is a common and recalcitrant problem. Current modes of therapy are often ineffective or prohibitively toxic. Clodronate disodium is a diphosphonate capable of inhibiting bone resorption resulting in a hypocalcemic effect. In this randomized, placebo-controlled study, we investigated the effect of hydration only (Rx-1) vs the effect of hydration plus either intravenously administered clodronate disodium, 4 mg/kg of body weight per day for three days (Rx-2) or intravenously administered clodronate disodium, 12 mg/kg of body weight given once only (Rx-3). By the third day of observation, Rx-2 produced a significant 2.8 mg/dL (0.70 mmol/L) reduction in serum calcium levels, whereas Rx-1 and Rx-3 did not produce a significant hypocalcemic effect when compared with baseline values. There were no toxicities observed. Intravenously administered clodronate appears to be an excellent agent for the acute treatment of malignancy-associated hypercalcemia.

Maintenance etidronate in the prevention of malignancy-associated hypercalcemia.

Normocalcemic patients with cancer who had been successfully treated for an episode of hypercalcemia were enrolled in a randomized, multisite, double-blind, placebo-controlled trial designed to determine the efficacy of maintenance oral etidronate in preventing the recurrence of moderate to severe hypercalcemia (serum calcium level, greater than 11.5 mg/dL [greater than 2.87 mmol/L]). Ten (40%) of 25 etidronate-treated patients and 17 (46%) of 37 placebo-treated patients had recurrence of hypercalcemia within 150 days. Although patients taking etidronate had a longer time to the development of hypercalcemia (median, 55 days vs 28 days), this was not significantly different from the control group. The high attrition rate in this trial from hypercalcemia and other malignancy-related causes represents a major difficulty in conducting studies with agents that may require prolonged administration before producing a therapeutic effect.

Chediak-Higashi syndrome: studies in long-term bone marrow culture.

The granulocyte defects of Chediak-Higashi syndrome (CHS) include neutropenia, characteristic giant lysosomal granule morphology, and functionally abnormal cell motility, degranulation, and bacterial killing. Findings of elevated levels of adenosine 3', 5' cyclic monophosphate nucleotide (cAMP) and of concanavalin A (Con A) capping have suggested a pathogenic role of a cyclic-nucleotide-related defect in microtubule polymerization, but not all patients exhibit these abnormalities. In order to test which defects derive from the cells' genetic program and which from the host environment, we examined granulocytes produced by CHS bone marrow progenitors in long-term in vitro bone marrow cultures. These cells exhibited the characteristic giant-granule morphology and defective cell motility of CHS. However, culture-derived CHS granulocytes had normal cAMP contents and normal spontaneous capping of Con A. Granulopoiesis diminished dramatically after five weeks in culture, with accompanying autophagocytosis by mononuclear phagocytes. In mixing experiments, the phenotype of the mature granulocytes corresponded to the genotype of the hematopoietic component of the culture rather than the stroma. These results indicate that the hallmark giant-granule morphology and cell motility defect of CHS are expressions of the genetic program of the hematopoietic cells. However the abnormalities in resting cyclic nucleotide levels and in Con-A capping may be secondary manifestations of the disease and are not essential to the pathogenesis of the chemotactic defect.

Effects of estrogen in vivo and in vitro on spontaneous interleukin-1 release by monocytes from postmenopausal women.

Estrogen (E) inhibits bone resorption, but the mechanism of this effect is unknown. Interleukin-1 (IL-1) stimulates bone resorption in vitro and may be produced in bone by mononuclear phagocytes. Recently, the spontaneous release of IL-1 from peripheral monocytes was found to reflect bone formation in a subset of patients with idiopathic osteoporosis. We suspected that the action of E on bone is mediated indirectly by its effect on monocyte IL-1 activity. Eleven normal postmenopausal women taking no medications were given conjugated E (0.625 mg daily) for 3-9 weeks. Supernatants from cultured peripheral monocytes were analyzed for IL-1 production by stimulation of a cloned murine helper T-cell line. IL-1 release was expressed as a percentage of maximum release corrected for monocyte number. IL-1 release before E treatment was 11.0 +/- 0.2% (+/- SE), it was 7.8 +/- 1.6% after E treatment (P = NS). IL-1 release fell in each of the three women with the highest initial values (46% to 5%, 25% to 17%, and 18% to 12%). IL-1 release did not correlate with serum osteocalcin or fasting urinary calcium either before or after E treatment. Addition of 10(-7)-10(-10) mol/L 17 beta-estradiol to cultured monocytes obtained before E treatment caused an increase in IL-1 release that did not follow a dose-response relationship. Treatment of postmenopausal women with E did not affect spontaneous IL-1 release by peripheral monocytes in vitro. The addition of E in vitro did not produce consistent changes in IL-1 release by these cells. This does not exclude the possibility that E may affect monocyte IL-1 release in subsets of women with high spontaneous monocyte IL-1 release with or without osteoporosis.

Effects of a short course of estrogen on mineral metabolism in postmenopausal women.

Previous studies suggested that estrogen administration leads to an increase in circulating immunoreactive PTH (iPTH), thought to be secondary to a slight decrease in serum calcium resulting from inhibition of bone resorption. Using three different RIAs, we measured iPTH in serum from 10 postmenopausal women before and after 14 days of ethinyl estradiol administration. In 2 sensitive RIAs directed at the midregion of the PTH molecule, iPTH values fell or remained unchanged in each subject, with average decreases of 23% (P less than 0.001) and 28% (P less than 0.005) in the two assays. Total urinary cAMP, the tubular maximum for urinary phosphate excretion, and serum iPTH measured with the third RIA did not change after estrogen treatment. Fasting urinary calcium and hydroxyproline and serum calcium, phosphorus, albumin, alkaline phosphatase, and osteocalcin all decreased after treatment, and serum 1,25-dihydroxyvitamin D increased in each subject. In a second cohort of 5 women given ethinyl estradiol for 8 weeks, similar changes were found at 2 weeks, but there was a trend toward increasing serum iPTH, increasing total urinary cAMP excretion, and decreasing the tubular maximum for urinary phosphate excretion by 8 weeks. The increase in serum 1,25-dihydroxyvitamin D and the decrease in serum osteocalcin were again found after 2 weeks of estrogen and did not change further despite continued treatment. These results indicate multiple effects of a 2-week course of estrogen treatment on mineral metabolism in the absence of an increase in serum iPTH or several biological indices of PTH activity.

Effects of calcium-regulating hormones and drugs on human monocyte chemiluminescence.

Chemiluminescence (CL) associated with phagocytosing monocytes has been used as an index of the oxygen dependent metabolic activity of these cells. Because of the relationships between monocytes and cells involved in bone resorption, we studied the effects on human monocyte CL of hormones and drugs active in mineral metabolism. Two-hour preincubations of monocytes with human PTH-(1-34), bovine PTH, or prostaglandin E2 caused significant decreases in peak CL during phagocytosis stimulated by the addition of latex particles. Similar studies with dichloromethylene diphosphonate, ethane hydroxydiphosphonate, or salmon calcitonin (sCT) caused significant increases in CL, whereas preincubation with human CT at the same molar concentration did not. CL was also decreased after preincubations with methylprednisolone or bacterial endotoxin. The effect of bovine PTH was dose dependent to concentrations as low as 10 ng/ml, was not fully present after a shorter 1-min preincubation with the hormone, and differed in an otherwise identical system using polymorphonuclear leukocytes instead of monocytes. The production of hydrogen peroxide by phagocytosing monocytes was also significantly affected by each of the drugs and hormones. The direction and magnitude of these changes were similar to those in CL experiments, except for the effects of sCT. These studies relate the oxygen-dependent function of phagocytes to mediators of bone resorption and provide a new system for studying the effects of hormones and drugs on the cellular elements of bone and blood.

Maximal urine-concentrating ability: familial hypocalciuric hypercalcemia versus typical primary hyperparathyroidism.

Impairment of urine-concentrating ability is common in persons with chronic hypercalcemia. We assessed urine-concentrating ability in 40 patients with typical primary hyperparathyroidism and 10 patients with familial hypocalciuric hypercalcemia, a disorder resembling typical primary hyperparathyroidism but lacking some of its clinical complications. Urine-concentrating ability was determined during a dehydration test of 18-22 h. The two patient groups were comparable with respect to serum calcium concentration and creatinine clearance. In the group with familial hypocalciuric hypercalcemia, the duration of hypercalcemia was probably greater, because it commences during infancy; the urinary excretion rate for calcium was lower [6.6 +/- 5.4 (mean +/- 1 SD) vs. 14.8 +/- 7.5 meq/day; P less than 0.005]. Patients with familial hypocalciuric hypercalcemia showed higher maximal urinary osmolality (800 +/- 150 vs. 664 +/- 130 mosmol/kg; P less than 0.0005). Among the patients with typical primary hyperparathyroidism, there was a negative association between maximal urinary osmolality and urinary cAMP (r = -0.40; P less than 0.05), but there was no significant relation between maximal urinary osmolality and the urinary excretion rate for calcium. Among 18 patients retested within 1 month after surgical correction of typical primary hyperparathyroidism, urine-concentrating ability did not improve. In patients with typical primary hyperparathyroidism, impairment in urine-concentrating ability reflects features of the chronic disease state, as it is not rapidly reversible by correction of that state. However, in patients with familial hypocalciuric hypercalcemia, longstanding hypercalcemia is not associated with obvious impairment of urine-concentrating ability. Complete or partial freedom from impairment of urine-concentrating ability and from calcareous renal disease are expressions of the generally mild course in familial hypocalciuric hypercalcemia.

Human chorionic gonadotropin subunit measurement in primary hyperparathyroidism.

The concentration of subunits of hCG (hCG alpha and hCG beta) was determined in plasma or serum from 70 patients with primary hyperparathyroidism (1 degrees HPT). Two of three patients with parathyroid carcinoma showed elevation in plasma concentrations of both subunits, which fell after surgical removal of the tumor. An extract prepared from the tumor of 1 of these patients contained the subunits in high concentrations, whereas in extracts similarly prepared from tissues removed from 7 patients with benign 1 degrees HPT, the subunits were not detectable or were present in much lower concentrations. In 42 cases of benign 1 degrees HPT, samples from veins containing a 10-fold gradient of parathyroid hormone obtained during selective venous catheterization and peripheral samples from the same patients were analyzed for hCG subunits. Only 1 patient demonstrated a mild elevation of hCG alpha in parathyroid venous effluent alone that may have represented subunit release by apparently benign parathyroid tissue. Thirty patients with multiple endocrine neoplasia type I were tested; 8 evidenced clinically active islet cell tumors, and 6 of these 8 showed high circulating concentrations of hCG alpha (and hCG beta in 1 case). Patients in the multiple endocrine neoplasia type I group with 1 degrees HPT or pituitary tumors, but no evident pancreatic islet disease, did not show elevations in subunit concentrations. Thus, in patients with 1 degrees HPT, determination of subunits of hCG may be helpful in making the diagnosis of parathyroid carcinoma or in screening for associated (and probably malignant) pancreatic islet disease.

Weight training decreases vertebral bone density in premenopausal women: a prospective study.

The effect of exercise on bone mass is unclear. To determine the skeletal effect of weight-bearing exercise in premenopausal women, we prospectively evaluated the effects of a weight-training program on lumbar spine bone mass in 10 women (mean +/- SEM, 36.2 +/- 1.3 yr) and compared the results with those in 7 sedentary women (40.4 +/- 1.6 yr). None of the women had previously participated in a weight-training program, and all ingested a 500-mg calcium supplement each day throughout the study. Axial loading and balance of large muscle groups were emphasized. Individual strength increased by 57 +/- 8% over 9 months. Despite the increase in muscle strength, lumbar spine bone density in the exercising women decreased by 2.90% at 4.5 months and 3.96% at 9 months (P = 0.01). In contrast, there was no change in lumbar density in the controls over the 9-month period. We conclude that short term weight training at this frequency and intensity decreases vertebral bone mass in premenopausal women.