IKZF1, a new susceptibility gene for cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe mucosal involvement.

BACKGROUND: Stevens-Johnson syndrome (SJS) and its severe form, toxic epidermal necrolysis (TEN), are acute inflammatory vesiculobullous reactions of the skin and mucous membranes, including the ocular surface, oral cavity, and genitals. These reactions are very rare but are often associated with inciting drugs, infectious agents, or both. OBJECTIVE: We sought to identify susceptibility loci for cold medicine-related SJS/TEN (CM-SJS/TEN) with severe mucosal involvement (SMI). METHODS: A genome-wide association study was performed in 808 Japanese subjects (117 patients with CM-SJS/TEN with SMI and 691 healthy control subjects), and subsequent replication studies were performed in 204 other Japanese subjects (16 cases and 188 control subjects), 117 Korean subjects (27 cases and 90 control subjects), 76 Indian subjects (20 cases and 56 control subjects), and 174 Brazilian subjects (39 cases and 135 control subjects). RESULTS: In addition to the most significant susceptibility region, HLA-A, we identified IKZF1, which encodes Ikaros, as a novel susceptibility gene (meta-analysis, rs4917014 [G vs. T]; odds ratio, 0.5; P = 8.5 × 10(-11)). Furthermore, quantitative ratios of the IKZF1 alternative splicing isoforms Ik1 and Ik2 were significantly associated with rs4917014 genotypes. CONCLUSION: We identified IKZF1 as a susceptibility gene for CM-SJS/TEN with SMI not only in Japanese subjects but also in Korean and Indian subjects and showed that the Ik2/Ik1 ratio might be influenced by IKZF1 single nucleotide polymorphisms, which were significantly associated with susceptibility to CM-SJS/TEN with SMI.

Survival prediction for pancreatic cancer patients receiving gemcitabine treatment.

Although gemcitabine monotherapy is the standard treatment for advanced pancreatic cancer, patient outcome varies significantly, and a considerable number do not benefit adequately. We therefore searched for new biomarkers predictive of overall patient survival. Using LC-MS, we compared the base-line plasma proteome between 29 representative patients with advanced pancreatic cancer who died within 100 days and 31 patients who survived for more than 400 days after receiving at least two cycles of the same gemcitabine monotherapy. Identified biomarker candidates were then challenged in a larger cohort of 304 patients treated with the same protocol using reverse-phase protein microarray. Among a total of 45,277 peptide peaks, we identified 637 peaks whose intensities differed significantly between the two groups (p < 0.001, Welch's t test). Two MS peaks with the highest statistical significance (p = 2.6 x 10(-4) and p = 5.0 x 10(-4)) were revealed to be derived from alpha(1)-antitrypsin and alpha(1)-antichymotrypsin, respectively. The levels of alpha(1)-antitrypsin (p = 8.9 x 10(-8)) and alpha(1)-antichymotrypsin (p = 0.001) were significantly correlated with the overall survival of the 304 patients. We selected alpha(1)-antitrypsin (p = 0.0001), leukocyte count (p = 0.066), alkaline phosphatase (p = 8.3 x 10(-8)), and performance status (p = 0.003) using multivariate Cox regression analysis and constructed a scoring system (nomogram) that was able to identify a group of high risk patients having a short median survival time of 150 days (95% confidence interval, 123-187 days; p = 2.0 x 10(-15), log rank test). The accuracy of this model for prognostication was internally validated and showed good calibration and discrimination with a bootstrap-corrected concordance index of 0.672. In conclusion, an increased level of alpha(1)-antitrypsin is a biomarker that predicts short overall survival of patients with advanced pancreatic cancer receiving gemcitabine monotherapy. Although an external validation study will be necessary, the current model may be useful for identifying patients unsuitable for the standardized therapy.

Substrate-dependent functional alterations of seven CYP2C9 variants found in Japanese subjects.

CYP2C9 is a polymorphic enzyme that metabolizes a number of clinically important drugs. In this study, catalytic activities of seven alleles found in Japanese individuals, CYP2C9*3 (I359L), *13 (L90P), *26 (T130R), *28 (Q214L), *30 (A477T), *33 (R132Q), and *34 (R335Q), were assessed using three substrates (diclofenac, losartan, and glimepiride). When expressed in a baculovirus-insect cell system, the holo and total (apo and holo) CYP2C9 protein expression levels were similar among the wild type (CYP2C9.1) and six variants except for CYP2C9.13. A large part of CYP2C9.13 was present in the apo form P420. Compared with CYP2C9.1, all variants except for CYP2C9.34 exhibited substrate-dependent changes in K(m), V(max), and intrinsic clearance (V(max)/K(m)). For diclofenac 4'-hydroxylation, the intrinsic clearance was decreased markedly (by >80%) in CYP2C9.13, CYP2C9.30, and CYP2C9.33 and variably (63-76%) in CYP2C9.3, CYP2C9.26, and CYP2C9.28 due to increased K(m) and/or decreased V(max) values. For losartan oxidation, CYP2C9.13 and CYP2C9.28 showed 2.5- and 1.8-fold higher K(m) values, respectively, and all variants except for CYP2C9.34 showed >77% lower V(max) and intrinsic clearance values. For glimepiride hydroxylation, the K(m) of CYP2C9.13 was increased 7-fold, and the V(max) values of all variants significantly decreased, resulting in reductions in the intrinsic clearance by >80% in CYP2C9.3, CYP2C9.13, CYP2C9.26, and CYP2C9.33 and by 56 to 75% in CYP2C9.28 and CYP2C9.30. These findings suggest the necessity for careful administration of losartan and glimepiride to patients bearing these six alleles.

Structural significance of residues 158-160 in the H3N2 hemagglutnin globular head: A computational study with implications in viral evolution and infection.

Influenza A H3N2 has been linked to annual outbreaks within the human population attributable to continuous structural changes. H3N2 HA contains well identified antigenic sites and receptor-binding sites (RBS) that are possibly correlated to viral evolution and infection. However, the structural significance of amino acid residues associated with both viral evolution and infection were not fully demonstrated. Throughout this study, we generated and analyzed H3N2 HA models that represented the clade 3C.2 population (comprised of clades 3C.2, 3C.2a, and 3C.21 from the transitioning 2014-2018 H3N2 strains) and 3C.3a (from the 2016 H3N2 strain). Model quality estimation, structural analyses and superimposition, and network analytics of H3N2 HA1 evolution were performed. We found that the structural properties of residues 158-160 could influence the overall HA backbone. More specifically, amino acid substitutions at residues 159-160 affected the amino acid orientation at residue 158, thereby, causing the overall HA backbone structure to vary. Our results were consistent with 1968-2018 HA1 evolution. Taken together, we propose that our results would highlight the structural significance of residues 158-160 in HA1 for both antigenic drift and RBS.

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

Severe drug toxicity associated with a single-nucleotide polymorphism of the cytidine deaminase gene in a Japanese cancer patient treated with gemcitabine plus cisplatin.

PURPOSE: We investigated single-nucleotide polymorphisms of the cytidine deaminase gene (CDA), which encodes an enzyme that metabolizes gemcitabine, to clarify the relationship between the single-nucleotide polymorphism 208G>A and the pharmacokinetics and toxicity of gemcitabine in cancer patients treated with gemcitabine plus cisplatin. EXPERIMENTAL DESIGN: Six Japanese cancer patients treated with gemcitabine plus cisplatin were examined. Plasma gemcitabine and its metabolite 2',2'-difluorodeoxyuridine were measured using an high-performance liquid chromatography method, and the CDA genotypes were determined with DNA sequencing. RESULTS: One patient, a 45-year-old man with pancreatic carcinoma, showed severe hematologic and nonhematologic toxicities during the first course of chemotherapy with gemcitabine and cisplatin. The area under the concentration-time curve value of gemcitabine in this patient (54.54 microg hour/mL) was five times higher than the average value for five other patients (10.88 microg hour/mL) treated with gemcitabine plus cisplatin. The area under the concentration-time curve of 2',2'-difluorodeoxyuridine in this patient (41.58 microg hour/mL) was less than the half of the average value of the five patients (106.13 microg hour/mL). This patient was found to be homozygous for 208A (Thr70) in the CDA gene, whereas the other patients were homozygous for 208G (Ala70). CONCLUSION: Homozygous 208G>A alteration in CDA might have caused the severe drug toxicity experienced by a Japanese cancer patient treated with gemcitabine plus cisplatin.

[Predictive genomic markers for severe adverse drug reactions].

Severe adverse drug reactions are an important issue to be considered during proper drug usage in postmarketing period. Most severe adverse reactions are idiosyncratic and unrelated to their pharmacological actions via primary targets. Although these reactions were not predictable, recent developments in the field of genomics have revealed closely associated markers responsible for some severe adverse reactions, including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). This review demonstrates genomic biomarkers for SJS/TEN and drug-induced liver injury (DILI) that were found mainly in Japanese patients and reveal ethnic differences. We and other groups have found the following associations of SJS/TEN with susceptible drugs: 1) HLA-B*58:01 for allopurinol-related cases; 2) HLA-B*15:11 and HLA-A*31:01 for carbamazepine-related cases; 3) HLA-B*51:01 for phenobarbital-related cases; 4) HLA-A*02:07 for zonisamide-related cases; 5) CYP2C9*3 for phenytoin-related cases; and 6) HLA-A*02:06 for cold medicine-related cases. The allele frequencies of these related HLA types vary among Asian populations. In addition, direct (noncovalent) binding of carbamazepine or an allopurinol metabolite, oxypurinol, to the associated HLA-type proteins was suggested. Associated genomic biomarkers are also summarized for DILI in Japanese and Caucasian populations. The application of these genomic biomarkers to prevent the onset of a reaction has been utilized in a few countries. However, in Japan, the package inserts only contain precautions that cite the research findings. To overcome this limitation, the following points should be addressed: 1) factors responsible for the development of SJS/TEN should be identified in addition to the above-mentioned HLA alleles; and 2) an inexpensive genotyping strategy and assay methods should be developed to provide a pharmacoeconomical viewpoint. Further research on severe adverse reactions is warranted.

Development of a simple genotyping method for the HLA-A*31:01-tagging SNP in Japanese.

AIM: To construct a simple, low-cost typing method for the surrogate marker of HLA-A*31:01, a risk factor for carbamazepine (CBZ) related Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN). MATERIALS & METHODS: DNAs from Japanese SJS/TEN patients were used for genotyping and developing the assay. RESULTS: HLA-A*31:01 was confirmed to be significantly associated with definite/probable cases of CBZ-related SJS/TEN (p = 0.0040). Three single nucleotide polymorphisms, rs1150738, rs3869066 and rs259945, were in absolute linkage disequilibrium with HLA-A*31:01 in 210 Japanese SJS/TEN patients. Robust genotyping of rs3869066 in ZNRD1-AS1 was developed using polymerase chain reaction-restriction fragment length polymorphism assays. CONCLUSION: Single nucleotide polymorphism genotyping is less time consuming and cheaper than conventional HLA typing, and would be useful for identifying Japanese patients at risk of CBZ-related SJS/TEN.

Independent strong association of HLA-A*02:06 and HLA-B*44:03 with cold medicine-related Stevens-Johnson syndrome with severe mucosal involvement.

Stevens-Johnson syndrome (SJS) and its severe variant, toxic epidermal necrolysis (TEN), are acute inflammatory vesiculobullous reactions of the skin and mucous membranes. Cold medicines including non-steroidal anti-inflammatory drugs (NSAIDs) and multi-ingredient cold medications are reported to be important inciting drugs. We used two sample sets of Japanese patients to investigate the association between HLA genotypes and cold medicine-related SJS/TEN (CM-SJS/TEN), including acetaminophen-related SJS/TEN (AR-SJS/TEN) with severe mucosal involvement such as severe ocular surface complications (SOC). HLA-A*02:06 was strongly associated with CM-SJS/TEN with SOC and AR-SJS/TEN with SOC. HLA-B*44:03 was also detected as an independent risk allele for CM-, including AR-SJS/TEN with SOC. Analyses using data obtained from CM-SJS/TEN patients without SOC and patients with CM-unrelated SJS/TEN with SOC suggested that these two susceptibility alleles are involved in the development of only CM-SJS/TEN with SOC patients.

Specific HLA types are associated with antiepileptic drug-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in Japanese subjects.

AIM: This preliminary study investigated genomic biomarkers for Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN), related to three antiepileptic drugs, zonisamide, phenobarbital and phenytoin. PATIENTS & METHODS: HLA class I and HLA-DRB1 loci were genotyped for Japanese patients with zonisamide-, phenobarbital- or phenytoin-induced SJS/TEN (n = 12, 8 and 9, respectively) and for healthy Japanese volunteers (n = 2878). RESULTS: Carrier frequencies of HLA-A*02:07 in patients with zonisamide-induced SJS/TEN and in the general Japanese population were 41.7 and 6.81%, respectively. Carrier frequencies of HLA-B*51:01 in patients with phenobarbital- and phenytoin-induced SJS/TEN and in controls were 75.0, 55.6 and 15.2%, respectively. HLA-A*02:07 and HLA-B*51:01, in a dominant model, were significantly associated with zonisamide- and phenobarbital-induced SJS/TEN, respectively (Pc = 0.0176 and 0.0042, respectively). CONCLUSION: Our data suggest that HLA-A*02:07 and HLA-B*51:01 are potential biomarkers for zonisamide- and phenobarbital-induced SJS/TEN, respectively, in Japanese individuals.

Population differences in major functional polymorphisms of pharmacokinetics/pharmacodynamics-related genes in Eastern Asians and Europeans: implications in the clinical trials for novel drug development.

Drug lag, recently discussed extensively in Japan, can be divided into two phases: clinical development time and application review time. The former factor is still an important problem that might be improved by promoting multi-regional clinical trials and considering the results from other similar populations with Japanese, such as Koreans and Chinese. In this review, we compare the allelic or genotype frequencies of 30 relatively common functional alleles mainly between Eastern Asians and Europeans as well as among 3 major populations in Eastern Asian countries, Japan, Korea, and China, in 12 pharmacokinetics (PK)/pharmacodynamics (PD)-related genes; CYP2C9 (*2 and *3), CYP2C19 (*2, *3 and *17), 13 CYP2D6 haplotypes including *4, *5 and *10, CYP3A5 (*3), UGT1A1 (*28 and *6), NAT2 (*5, *6 and *7), GSTM1 and GSTT1 null genotypes, SLCO1B1 521T>C, ABCG2 421C>A, and HLA-A*31:01 and HLA-B*58:01. In this review, differences in allele frequencies (AFs) or genotype frequencies (GFs) less than 0.1 (in the cases of highest AF (GF) ≥0.1) or less than 0.05 (in the cases of lowest AF (GF) <0.1) were regarded as similar. Between Eastern Asians and Europeans, AFs (or GFs) are regarded as being different for many alleles such as CYP2C9 (*2), CYP2C19 (*2, *3 and *17), CYP2D6 (*4 and *10), CYP3A5 (*3), UGT1A1 (*28 and *6), NAT2 (*5*7), GSTT1 null and ABCG2 421C>A. Among the 3 Eastern Asian populations, however, only AFs of CYP2C19*3, CYP2D6*10, HLA-A*31:01 and HLA-B*58:01 are regarded as dissimilar. For CYP2C19*3, the total functional impact on CYP2C19 could be small if the frequencies of the two null alleles CYP2C19*2 and *3 are combined. Regarding CYP2D6*10, frequency difference over 0.1 is observed only between Japanese and Chinese (0.147). Although environmental factors should be considered for PK/PD differences, we could propose that among Japan, Korea, and China, genetic differences are very small for the analyzed common PK-related gene polymorphisms. On the other hand, AFs of the two HLA alleles important for cutaneous adverse drug reactions are diverse even among Eastern Asians and thus should be taken into account.

Development of a rapid and inexpensive assay for detecting a surrogate genetic polymorphism of HLA-B*58:01: a partially predictive but useful biomarker for allopurinol-related Stevens-Johnson syndrome/toxic epidermal necrolysis in Japanese.

Allopurinol-induced Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) is strongly associated with HLA-B*58:01 in various populations including Japanese. We demonstrated that several single nucleotide polymorphisms (SNPs) around the HLA region on chromosome 6 were strongly linked with HLA-B*58:01 in a previous study using Japanese allopurinol-related SJS/TEN patients. Their very strong linkage suggests that these SNPs could be used as surrogate biomarkers to find carriers of HLA-B*58:01 to avoid these serious adverse effects. In the present study, to expedite the application of this pharmacogenomic information to the proper usage of allopurinol in a clinical situation, we developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay for the genotyping of rs9263726 in the psoriasis susceptibility 1 candidate 1 (PSORS1C1) gene, which is in absolute linkage disequilibrium (r(2) = 1, D' = 1) with HLA-B*58:01. The developed PCR-RFLP assay using FokI restriction enzyme was able to detect three different genotypes, GG, GA, and AA of rs9263726 robustly, and thus to find HLA-B*58:01 carriers. This robust and inexpensive assay would be useful for pre-screening the subjects with HLA-B*58:01, a genetically high risk factor for allopurinol-induced SJS/TEN.

Population pharmacokinetics of gemcitabine and its metabolite in Japanese cancer patients: impact of genetic polymorphisms.

BACKGROUND AND OBJECTIVE: Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine. Toxicities of gemcitabine are generally mild, but unpredictable severe toxicities such as myelosuppression and interstitial pneumonia are occasionally encountered. The aim of this study was to determine the factors, including genetic polymorphisms of CDA, DCK and solute carrier family 29A1 (SLC29A1 [hENT1]), that alter the pharmacokinetics of gemcitabine in Japanese cancer patients. PATIENTS AND METHODS: 250 Japanese cancer patients who received 30-minute intravenous infusions of gemcitabine at 800 or 1000 mg/m2 in the period between September 2002 and July 2004 were recruited for this study. However, four patients were excluded from the final model built in this study because they showed bimodal concentration-time curves. Two patients who experienced gemcitabine-derived life-threatening toxicities in October 2006 and January 2008 were added to this analysis. One of these patients received 30-minute intravenous infusions of gemcitabine at 454 mg/m2 instead of the usual dose (1000 mg/m2). Plasma concentrations of gemcitabine and dFdU were measured by high-performance liquid chromatography-photodiode array/mass spectrometry. In total, 1973 and 1975 plasma concentrations of gemcitabine and dFdU, respectively, were used to build population pharmacokinetic models using nonlinear mixed-effects modelling software (NONMEM version V level 1.1). RESULTS AND DISCUSSION: Two-compartment models fitted well to plasma concentration-time curves for both gemcitabine and dFdU. Major contributing factors for gemcitabine clearance were genetic polymorphisms of CDA, including homozygous CDA*3 [208G>A (Ala70Thr)] (64% decrease), heterozygous *3 (17% decrease) and CDA -31delC (an approximate 7% increase per deletion), which has a strong association with CDA*2 [79A>C (Lys27Gln)], and coadministered S-1, an oral, multicomponent anti-cancer drug mixture consisting of tegafur, gimeracil and oteracil (an approximate 19% increase). The estimated contribution of homozygous CDA*3 to gemcitabine clearance provides an explanation for the life-threatening severe adverse reactions, including grade 4 neutropenia observed in three Japanese patients with homozygous CDA*3. Genetic polymorphisms of DCK and SLC29A1 (hENT1) had no significant correlation with gemcitabine pharmacokinetic parameters. Aging and increased serum creatinine levels correlated with decreased dFdU clearance. CONCLUSION: A population pharmacokinetic model that included CDA genotypes as a covariate for gemcitabine and dFdU in Japanese cancer patients was successfully constructed. The model confirms the clinical importance of the CDA*3 genotype.

Ethnic differences of two non-synonymous single nucleotide polymorphisms in CDA gene.

Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences. MAFs of 79A>C (Lys27Gln) were 0.153 in Koreans and 0.327 in Caucasian-Americans, 0.204 in Japanese, 0.155 in Chinese-Americans and 0.087 in African-Americans. MAFs of 208G>A (Ala70Thr) were 0.005 in Koreans and 0.022 in Japanese and the minor allele was not detected in Chinese-Americans, Caucasian-Americans or African-Americans. Thus possibly, MAF of 208G>A in Japanese is likely to be somewhat higher than in Koreans and Chinese-Americans. These data would provide fundamental and useful information for pharmacogenetic studies on cytidine deaminase-catalyzing drugs.

Identification of a predictive biomarker for hematologic toxicities of gemcitabine.

PURPOSE: Gemcitabine monotherapy is the current standard for patients with advanced pancreatic cancer, but the occurrence of severe neutropenia and thrombocytopenia can sometimes be life threatening. This study aimed to discover a new diagnostic method for predicting the hematologic toxicities of gemcitabine. PATIENTS AND METHODS: Using quantitative mass spectrometry (MS), we compared the baseline plasma proteomes of 25 patients who had developed severe hematologic adverse events (grade 3 to 4 neutropenia and/or grade 2 to 4 thrombocytopenia) within the first two cycles of gemcitabine with those of 22 patients who had not (grade 0). RESULTS: We identified 757 peptide peaks whose intensities were significantly different (P < .001, Welch t test) among a total of 60,888. The MS peak with the highest statistical significance (P = .0000282) was revealed to be derived from haptoglobin by tandem MS. A scoring system (nomogram) based on the values of haptoglobin, haptoglobin phenotype, neutrophil count, platelet count, and body-surface area was constructed to estimate the risk of hematologic adverse events (grade 3 to 4 neutropenia and/or grade 2 to 4 thrombocytopenia) with an area under curve value of 0.782 in a cohort of 166 patients with pancreatic cancer. Predictive ability of the system was confirmed in two independent validation cohorts consisting of 87 and 52 patients with area under the curve values of 0.655 and 0.747, respectively. CONCLUSION: Although the precise mechanism responsible for the correlation of haptoglobin with the future onset of hematologic toxicities remains to be clarified, our prediction model seems to have high practical utility for tailoring the treatment of patients receiving gemcitabine.

Genetic polymorphisms of copper- and platinum drug-efflux transporters ATP7A and ATP7B in Japanese cancer patients.

ATP7A and ATP7B are involved in cellular resistance to platinum compounds such as cisplatin. By sequencing ATP7A, 38 genetic variations, including 30 novel ones were detected from 203 Japanese cancer patients. Of these, seven nonsynonymous variations were found: novel 1030A>G (R344G), 2111A>G (Q704R), 2200C>A (Q734K), 2948C>T (T983M) and 3112G>A (V1038I) at 0.004 frequencies and known 2299G>C (V767L) and 4390A>G (I1464V) at 0.351 and 0.075 frequencies, respectively. Regarding ATP7B, 28 novel and 33 known genetic variations were detected including 13 nonsynonymous ones: novel 1258A>G (M420V), 1426G>A (A476T), and 2401A>C (T801P) were found at 0.002, 0.005, and 0.002, respectively and known 1216G>T (A406S), 1366G>C (V456L), 2495A>G (K832R), 2785A>G (I929V), 2855G>A (R952K), 2871delC (P957PfsX9), 3419T>C (V1140A), 3836A>G (D1279G), 3886G>A (D1296N) and 3889G>A (V1297I) at 0.483, 0.463, 0.387, 0.005, 0.384, 0.005, 0.387, 0.002, 0.012, and 0.015 frequencies, respectively. Linkage disequilibrium between detected variations was also analyzed. Our results would provide fundamental and useful information for genotyping ATP7A and ATP7B in the Japanese and probably other Asian populations.

Twenty novel genetic variations and haplotype structures of the DCK gene encoding human deoxycytidine kinase (dCK).

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78_+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78_ +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.