Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Microglia-Specific Promoter Activities of HEXB Gene.

Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the HEXB gene, which is known to be specifically and stably expressed in the microglia during homeostatic and pathological conditions. Dual reporter and serial deletion assays identified the critical role of the natural 5' untranslated region (-97 bp related to the first ATG) in driving transcriptional activity of the mouse Hexb gene. The native promoter region of mouse, human, and monkey HEXB are located at -135, -134, and -170 bp to the first ATG, respectively. These promoters were highly active and specific in microglia with strong cross-species transcriptional activities, but did not exhibit activity in primary astrocytes. In addition, we identified a 135 bp promoter of CD68 gene that was highly active in microglia but not in astrocytes. Considering that HEXB is specifically expressed in microglia, these data suggest that the newly characterized microglia-specific HEXB minimal/native promoter can be an ideal candidate for microglia-targeting AAV gene therapy in the CNS.

Cultural influences on help-seeking attitudes in Asian American students.

There is considerable evidence indicating that Asian American college students have less favorable attitudes toward and are less likely to use mental health services than other ethnic groups in the United States. Because a person's attitudes are often strongly associated with their voluntary behaviors, understanding what influences help-seeking attitudes may help shed light on why Asian American college students refrain from seeking mental health treatment. Andersen's Sociobehavioral Model is commonly used as a guide to understand help-seeking in the mainstream population. A modified version of this model that includes culture-related variables (i.e., level of acculturation and stigma tolerance) was used to guide this study. Results indicated that stigma tolerance predicted help-seeking attitudes above and beyond traditional variables associated with help-seeking. These findings suggest that reducing societal stigma and increasing individual tolerance to stigma should be a focus for prevention and intervention programs on college campuses.

A conceptual paradigm for understanding culture's impact on mental health: the cultural influences on mental health (CIMH) model.

Understanding culture's impact on mental health and its treatment is extremely important, especially in light of recent reports highlighting the realities of health disparities and unequal treatment. This article provides a conceptual paradigm for understanding how culture influences six mental health domains, including (a) the prevalence of mental illness, (b) etiology of disease, (c) phenomenology of distress, (d) diagnostic and assessment issues, (e) coping styles and help-seeking pathways, and (f) treatment and intervention issues. Systematic interrelationships between each of these domains are highlighted and relevant literature is reviewed. Although no one model can adequately capture the complex facets of culture's influence on mental health, the Cultural Influences on Mental Health (CIMH) model serves as an important framework for understanding the complexities of these interrelationships. Implications for clinical research and practice are discussed.

Disaggregating the effects of acculturation and acculturative stress on the mental health of Asian Americans.

This study examines the impact of level of acculturation and acculturative stress on the mental health of Asian American college students. Hierarchical regression analyses were used to clarify the relation between level of acculturation, acculturative stress, and mental health outcomes (psychological distress and clinical depression). Being less identified with mainstream United States culture was associated with higher psychological distress and clinical depression, but lost significance when acculturative stress was introduced into the model. Retention or relinquishing of identification with one's heritage culture was not associated with mental health outcomes. Although understanding level of acculturation can help us identify those at risk, findings suggest that acculturative stress is a more proximal risk factor and increases risk for mental health problems independently of global perceptions of stress.

Basic and clinical aspects of gene therapy for retinopathy induced by diabetes.

Diabetes mellitus invariably induces retinopathy which causes a loss of vision that is the major cause of blindness in people of working age across most ethnic groups. Although there have been major advances in gene therapy technologies, there is still no effective cure-all gene therapy for diabetes mellitus. This may be due to (i) involvement of multiple genes that may have different influences on diabetes across different ethnic groups, (ii) immune response to viral vectors, (iii) local, specific transfection only and not into systemic circulation, (iv) lack of stable long-term expression, and (v) lack of control of gene expression. Hence, a separate approach to gene therapy of diabetic retinopathy is necessary due to the difficulties in treating the underlying diabetes. Diabetic retinopathy is the inevitable microvascular complication in the retina from diabetes mellitus. There are possible genetic bases in several pathophysiological pathways for diabetic retinopathy, including oxidation of retinal cells, polyol accumulation pathways, increased non-enzymatic glycation in retinal cells and the release of growth factors by endothelial cells. We review the candidate genes in these putative pathways for diabetic retinopathy and discuss the challenges for gene therapy. The eye is an isolated system with a strong blood-retinal barrier and therefore provides a challenge for delivery of drugs and vectors from the systemic circulation using traditional approaches. Newer delivery approaches include the use of nanoparticles, liposomes, and iontophoresis. We also consider the social and health economic dimension of diabetic retinopathy gene therapy. Diabetic retinopathy is the most common cause of blindness for people of working age. The loss of visual acuity caused by diabetic retinopathy creates a detrimental impact on the patient's quality of life. This results in quality-of-life costs to the individual, the health care system and to society. Significant progress has been made in gene therapy approaches for diabetic retinopathy, and it appears that this is an important area for continued research in order to improve visual outcomes and reduce the healthcare costs of diabetic retinopathy in our communities.

High level estradiol impairs and low level estradiol facilitates non-spatial working memory.

The present study investigated the effect of different doses of estradiol treatment on performance in the non-spatial delayed alternation T-maze a task in which performance is mediated by the integrity of the prefrontal cortex (PFC). Ovariectomized (OVX) female rats were injected with estradiol benzoate (0.3 microg/0.1 ml sesame oil (EB0.3), 5 microg/0.1 ml sesame oil (EB5) or 10 microg/0.1 ml sesame oil (EB 10)) or vehicle (sesame oil, 0.1 ml). Approximately 2 h after each injection, animals were trained daily on the T-maze with an initial delay of 10 s (short delay). Following a month with no treatment animals were re-trained at a 40 s delay (long delay). Days to reach criterion (one error per day for three consecutive days), mean total errors, errors across days, change in performance across training (short subtracted from long delay), and latency to reach goal arm, were scored. At the short delay, there was a weak effect for the low dose of estradiol (EB0.3 low-to-medium physiological) to significantly decrease the number of working memory errors compared to controls. However at the longer delay the higher doses of estradiol EB5 (high physiological) and to a lesser extent EB10 (suupraphysiological) significantly increased the number of working memory errors compared to controls. These data demonstrate the differential effect of estradiol during short and long delays on prefrontal cortex dependent working memory. High levels of estradiol impair PFC-dependent working memory at longer delays, while low level estradiol weakly facilitates PFC-dependent working memory at a shorter delay. These data suggest that estradiol's facilitatory effects on working memory may not be mediated through the PFC, while estradiols inhibitory effects on working memory may be mediated at least in part through the PFC.