Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 68
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Eur J Clin Microbiol Infect Dis ; 39(6): 1129-1136, 2020 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-32006178

RESUMO

Biofilm in endoscopes is a major problem that can result in failure of disinfection. We studied the survival of K. pneumoniae in a biofilm formed on endoscope tubes subjected to combined chemical and physical stresses. We monitored bacterial survival in the biofilm after the action of 1% and 2% GTA either immediately or after 15 days of desiccation and described the ability of surviving bacteria to recolonize endoscope tubing in a dynamic model. There were surviving bacteria after 5-min exposure to 2% and 1% GTA. The percentage of survivors after 2% and 1% GTA was greater when the GTA treatment was performed after 15 days of prior desiccation of the biofilm. The survivors were able to recolonize and reform biofilm on abiotic surfaces probably because of the survival of persisters in a viable but non-culturable state in the biofilm. Our findings emphasize that the current guidelines on endoscope reprocessing should be strictly followed but that once constituted the biofilm in endoscope tubing will be very difficult to eradicate with present practices.


Assuntos
Biofilmes/crescimento & desenvolvimento , Dessecação , Endoscópios/microbiologia , Glutaral/farmacologia , Klebsiella pneumoniae/fisiologia , Biofilmes/efeitos dos fármacos , Contagem de Colônia Microbiana , Desinfecção , Humanos , Klebsiella pneumoniae/efeitos dos fármacos , Klebsiella pneumoniae/crescimento & desenvolvimento , Viabilidade Microbiana , Estresse Fisiológico
2.
Ann Pharm Fr ; 74(2): 154-64, 2016 Mar.
Artigo em Francês | MEDLINE | ID: mdl-26294272

RESUMO

OBJECTIVES: Infusion in care units, and all the more in intensive care units, is a complex process which can be the source of many risks for the patient. Under cover of an institutional approach for the improvement of the quality and safety of patient healthcare, a risk mapping infusion practices was performed. METHODS: The analysis was focused on intravenous infusion situations in adults, the a priori risk assessment methodology was applied and a multidisciplinary work group established. RESULTS: Forty-three risks were identified for the infusion process (prescription, preparation and administration). The risks' assessment and the existing means of control showed that 48% of them would have a highly critical patient security impact. Recommendations were developed for 20 risks considered to be most critical, to limit their occurrence and severity, and improve their control level. An institutional action plan was developed and validated in the Drug and Sterile Medical Devices Commission. CONCLUSION: This mapping allowed the realization of an exhaustive inventory of potential risks associated with the infusion. At the end of this work, multidisciplinary groups were set up to work on different themes and regular quarterly meetings were established to follow the progress of various projects. Risk mapping will be performed in pediatric and oncology unit where the risks associated with the handling of toxic products is omnipresent.


Assuntos
Infusões Intravenosas/normas , Infusões Parenterais/normas , Serviço de Farmácia Hospitalar/organização & administração , Humanos , Unidades de Terapia Intensiva/organização & administração , Segurança do Paciente , Qualidade da Assistência à Saúde , Medição de Risco
3.
Plant Dis ; 98(1): 162, 2014 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-30708577

RESUMO

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.

4.
Eur J Clin Microbiol Infect Dis ; 32(2): 199-206, 2013 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-23079900

RESUMO

Vancomycin lock solution (LS) is recommended for the conservative treatment of subcutaneous injection port (SIP)-related infections, but may be associated with failure. We used an in vitro dynamic model of biofilm formation in an SIP, based on a continuous flow circulating via a real SIP, to assess the effectiveness of vancomycin (5 mg/ml), daptomycin (5 mg/ml) and ethanol 40 % LS in eradicating a pre-established Staphylococcus epidermidis biofilm. Heparin, Ringer's lactate and enoxaparin sodium LS were used as controls. The logarithmic reductions of colony-forming units (CFU) were compared by Student's t-test. After 24 h of exposure, the vancomycin LS did not exert a greater bactericidal effect than the heparin LS control (mean logarithmic reduction: 2.27 ± 0.58 vs. 1.34 ± 0.22, respectively, p = 0.3). The mean logarithmic reduction was greater with daptomycin LS (5.45 ± 0.14 vs. 0.39 ± 0.12, p < 0.01) and ethanol LS (6.79 ± 1.03 vs. 1.43 ± 0.54, p = 0.02). Bacterial revival after exposure to 24 h of LS was assessed. The mean viable bacteria count was significantly higher for vancomycin LS (9.36 ± 0.10 log(10)CFU) and daptomycin LS (9.16 ± 0.02 log(10)CFU) than for ethanol LS (2.95 ± 1.65 log(10)CFU). Ethanol appeared to be the most attractive option to treat SIP-related infection, but its poor ability to entirely disrupt the biofilm structure may require its use in association with a dispersal agent to avoid renewal of the biofilm.


Assuntos
Biofilmes/efeitos dos fármacos , Daptomicina/farmacologia , Desinfetantes/farmacologia , Desinfecção/métodos , Equipamentos e Provisões/microbiologia , Etanol/farmacologia , Staphylococcus epidermidis/fisiologia , Contagem de Colônia Microbiana , Humanos , Injeções Subcutâneas/métodos , Viabilidade Microbiana/efeitos dos fármacos , Staphylococcus epidermidis/efeitos dos fármacos , Vancomicina/farmacologia
5.
J Hosp Infect ; 140: 1-7, 2023 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-37487794

RESUMO

BACKGROUND: Transmission of infections via contaminated endoscopes is a common problem. Manual cleaning, using at least a detergent, is an important step in endoscope processing and should be performed as soon as possible to avoid drying of organic residues that might interfere with high-level disinfection and promote biofilm formation. AIM: To assess the efficacy of two detergent-disinfectants, enzymatic and non-enzymatic, and of an enzymatic detergent used during the manual cleaning against a Klebsiella pneumoniae biofilm. METHODS: A 24 h biofilm statically formed in a Tygon tube was exposed to detergent-disinfectants at 20 °C and 35 °C for 10 mn, and to enzymatic detergent at 45 °C for 60 mn. The logarithmic reduction in bacteria in the Tygon tube and the number of bacteria in the product supernatant were calculated. FINDINGS: Biofilm formation was reproducible between assays. After exposure to detergent-disinfectants, the logarithmic reduction was between 6.32 and 6.71 log10 cfu/cm2 in the Tygon tubes. No bacteria were found in their supernatants. Results in the detergent-disinfectant group were not affected by the exposure temperature or the addition of enzymes. No decrease in the bacterial load was observed in the Tygon tubes after exposure to the enzymatic detergent. Bacteria were found in its supernatant. CONCLUSION: These results show the importance of the choice of products used during the manual cleaning phase. They also show the potential benefit of combining detergent and disinfectant activity to decrease the bacterial load during the manual cleaning step of endoscope processing.


Assuntos
Desinfetantes , Humanos , Desinfetantes/farmacologia , Klebsiella pneumoniae , Detergentes/farmacologia , Desinfecção/métodos , Endoscópios/microbiologia , Biofilmes
6.
J Clin Microbiol ; 50(3): 938-42, 2012 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-22170930

RESUMO

Opinions differ on the value of microbiological testing of endoscopes, which varies according to the technique used. We compared the efficacy on bacterial biofilms of sampling solutions used for the surveillance of the contamination of endoscope channels. To compare efficacy, we used an experimental model of a 48-h Pseudomonas biofilm grown on endoscope internal tubing. Sampling of this experimental biofilm was performed with a Tween 80-lecithin-based solution, saline, and sterile water. We also performed a randomized prospective study during routine clinical practice in our hospital sampling randomly with two different solutions the endoscopes after reprocessing. Biofilm recovery expressed as a logarithmic ratio of bacteria recovered on bacteria initially present in biofilm was significantly more effective with the Tween 80-lecithin-based solution than with saline solution (P = 0.002) and sterile water (P = 0.002). There was no significant difference between saline and sterile water. In the randomized clinical study, the rates of endoscopes that were contaminated with the Tween 80-lecithin-based sampling solution and the saline were 8/25 and 1/25, respectively (P = 0.02), and the mean numbers of bacteria recovered were 281 and 19 CFU/100 ml (P = 0.001), respectively. In conclusion, the efficiency and therefore the value of the monitoring of endoscope reprocessing by microbiological cultures is dependent on the sampling solutions used. A sampling solution with a tensioactive action is more efficient than saline in detecting biofilm contamination of endoscopes.


Assuntos
Bactérias/crescimento & desenvolvimento , Bactérias/isolamento & purificação , Técnicas Bacteriológicas/métodos , Biofilmes/crescimento & desenvolvimento , Endoscópios/microbiologia , Manejo de Espécimes/métodos , Carga Bacteriana , Hospitais , Humanos , Estudos Prospectivos , Distribuição Aleatória
7.
Reanimation ; 21(Suppl 2): 503-513, 2012.
Artigo em Francês | MEDLINE | ID: mdl-32288729

RESUMO

Outbreaks of infectious diseases within healthcare institutions must be detected early and controlled. Hospitals should develop a plan for coordinating all hospital components to respond to these critical situations. The knowledge of the different steps in an outbreak investigation can help identify the source of ongoing outbreaks and prevent additional cases. Outbreak investigation is based on a multidisciplinary approach and is an opportunity for research, training and program considerations.

8.
Mali Med ; 37(4): 71-73, 2022.
Artigo em Francês | MEDLINE | ID: mdl-38514975

RESUMO

We report a case of intrauterine device (IUD) migration in order to describe the contribution of imaging in its diagnosis. It was a 35-year-old woman received on 06/01/2018 for pelvic ultrasound for pelvic pain. Ultrasound examination revealed a hyperechoic right para-uterine tubular image. A hysterosalpingography revealed an IUD in the pelvis in extra-urine position. Surgical extraction was done without complications. Intrauterine device migration is rare in our context. The radiological means make it possible to specify its topography.


Nous rapportons un cas de migration de dispositif intra-utérin (DIU) dans le but de décrire l'apport de l'imagerie dans son diagnostic. Il s'agissait d'une dame de 35 ans reçue le 01/06/2018 pour une échographie pelvienne dans le bilan d'une douleur pelvienne. L'exploration échographique a objectivé une image hyperéchogène tubulaire para-utérine droite. Une hystérosalpingographie avait objectivé un DIU dans le bassin en position extra-urine. Uneextraction chirurgicale a été faite avec des suites simples. La migration de dispositif intra-utérin est rare dans notre contexte. Les moyens radiologiques permettent de préciser sa topographie.

9.
Mali Med ; 37(4): 61-65, 2022 Dec 26.
Artigo em Inglês | MEDLINE | ID: mdl-36919030

RESUMO

Introduction: Autosomal recessive cerebellar ataxias (ARCA) are a group of rare and heterogynous neurodegenerative diseases mainly characterized by unbalance and walking difficulty and movement incoordination. Objectives: To clinically and paraclinically characterize ARCA in the department of Neurology at the Teaching Hospital of Point G and identify the underlying genetic defect. Patients and method: We have conducted a longitudinal and prospective study from January 2018 to December 2020. Patients with ARCA phenotype seen in the Department of Neurology at the Teaching Hospital of Point "G" were enrolled. Results: We have enrolled 7 families totaling 13 patients after giving an informed verbal and written consent. The sex ratio was 2.2 in favor of males, Kayes region and Fulani ethnic group were respectively the most represented region and ethnic group.Walking difficulty represented the major symptom followed by loss of vibration and joint sense, nystagmus, dysarthria and skeletal deformities. Alpha-foetoprotein level was high in one patient. Genetic testing confirmed Friedreich ataxia in one family and was not conclusive in 4 families. Conclusion: This study showed that ARCA are not uncommon in Mali and genetic testing is crucial to confirm the diagnosis.


Introduction: Les ataxies cérébelleuses autosomiques récessives (ACAR) constituent un groupe de maladies neurodégénératives rares et hétérogènes caractérisées essentiellement par un trouble de l'équilibre et de la marche, et un trouble de la coordination des mouvements. Objectifs: Caractériser les signes cliniques, paracliniques et génétiques des ataxies cérébelleuses autosomiques récessives au Service de Neurologie du CHU du Point "G". Patients et méthodes: Nous avons réalisé une étude de cas enrôlé dans le cadre d'une étude longitudinale et prospective allant de Janvier 2018 à Décembre 2020, portant sur des patients présentant des symptômes d'ACAR et ayant donné leur consentement éclairé. Résultats: Nous avons enrôlé sept familles totalisant 13 patients. Le sexe ratio était de 2,2 en faveur des hommes, la région de Kayes était la plus représentée et l'ethnie peulh était majoritaire. Les troubles de la marche ont représenté les signes majeurs suivis de troubles de la sensibilité profonde, de nystagmus, de dysarthrie, et des déformations ostéoarticulaires. L'alpha-foetoprotéine était élevée chez une patiente. Le test génétique a retrouvé l'ataxie de Friedreich dans une famille et n'a pas été concluant dans quatre autres. Conclusion: Cette étude montre que les ACAR ne sont pas rares au Mali et l'exploration génétique constitue un outil indispensable pour leur diagnostic de certitude.


Assuntos
Ataxia Cerebelar , Ataxia de Friedreich , Masculino , Humanos , Ataxia Cerebelar/genética , Estudos Prospectivos , Mali , Ataxia de Friedreich/genética , Testes Genéticos
10.
Med Trop (Mars) ; 71(6): 636-7, 2011 Dec.
Artigo em Francês | MEDLINE | ID: mdl-22393643

RESUMO

The purpose of this report was to determine the frequency of hysterectomy and describe its indications and outcomes. A retrospective, descriptive study related to active hysterectomy of was conducted at the reference health centre of commune V in Bamako, Mali from January 1st, 2004 to December 31st, 2008. All hysterectomy patients with complete medical files were included. A total of 172 files were identified including 152 that were complete. Hysterectomy accounted for 1.38% of all interventions during the study period. The procedure was carried out in emergency in 0.14% and electively in 13.39%. Mean patient age was 47.9 +/- 11.7 years; 89 patients were older than 45 years. The indications for hysterectomy were complicated uterine fibroids in 82 patients, genital prolapse in 44, adenomyosis in 10, obstetrical hysterectomy in 13 and cervical dysplasia in 3. The abdominal route was used in 100 patients (65.8%) and the vaginal rout in 52 (34.2%). The duration of the procedure and hospital stay was longer after hysterectomy by the abdominal (p<0.05). Perioperative complications were observed in 17% of patients after abdominal hysterectomy versus 7.69% after vaginal hysterectomy. Two maternal deaths due to hemorrhagic shock were observed after obstetrical hysterectomy. Hysterectomy is a frequent intervention that is not without complication risks. Choice of route depends on the indication and skill of the operator. Although endoscopic surgery is still difficult to perform in developing countries, development of vaginal hysterectomy is necessary to reduce perioperative complications.


Assuntos
Histerectomia Vaginal/estatística & dados numéricos , Histerectomia/métodos , Histerectomia/estatística & dados numéricos , Adulto , Idoso , Feminino , Humanos , Histerectomia/efeitos adversos , Histerectomia Vaginal/métodos , Período Intraoperatório , Mali/epidemiologia , Pessoa de Meia-Idade , Complicações Pós-Operatórias/epidemiologia , Estudos Retrospectivos , Fatores de Tempo , Doenças Uterinas/reabilitação , Doenças Uterinas/cirurgia , Adulto Jovem
11.
Mali Med ; 36(4): 39-43, 2021.
Artigo em Francês | MEDLINE | ID: mdl-38200716

RESUMO

PURPOSE: Report radiographic aspects and assess the contribution of computed tomography for the diagnosis and search for extension of bronchial carcinoid tumors. MATERIAL AND METHODS: This retrospective study included 9 patients with a bronchial carcinoid tumor during a four years period. In all patients, the exploration included standard chest radiography, computed tomography (CT) and abdominal ultrasonography. RESULTS: This series included three females and six males, mean age 25 years (age range 20-52 years). The average time between clinical symptoms and diagnosis was 24 months. The important signs were chest pain, dry cough and dyspnea in 7 cases, hemoptysis in 4 cases. Chest radiography has objectified a rounded opacity speculated in 4 cases, opacity systematized in 3 cases and an opaque lung in 2 cases. Computed tomography (CT) revealed an endobronchial process with a endobronchial budding in 5 cases, pneumonia systematized in 4 cases, collapse in 7 cases, a localized dilatation of bronchus in 2 cases, lymph node metastases in 4 cases. Bronchoscopy has the macroscopic diagnosis in all cases. All patients have surgical treatment, the lobectomy in 4 cases, pneumonectomy in 3 cases and bilobectomy in 2 cases. CONCLUSION: CT is indispensable for positive diagnosis, and topographic localization of extension of bronchial carcinoid tumors. The main contribution of CT compared with fibroscopy is to demonstrate exobronchial tumor development and upstream pulmonary complications.


BUT: Rapporter les aspects radiologiques et évaluer l'apport de la tomodensitométrie dans le diagnostic et le bilan d'extension des tumeurs carcinoïdes bronchiques. MATÉRIEL ET MÉTHODE: Etude rétrospective de 9 cas de tumeurs carcinoïdes bronchiques sur une période de 4 ans, portant sur les patients explorés dans le service de radiologie 20 Août, et opérés dans le service de chirurgie thoracique de CHU Ibn Rochd Casablanca. Tous les patients ont bénéficié de radiographies et d'une tomodensitométrie (TDM) thoraciques, ainsi une échographie abdominale. RÉSULTATS: Il s'agissait de 3 femmes et 6 hommes, la moyenne d'âge était de 25ans. Le délai moyen entre la symptomatologie clinique et le diagnostic était de 24 mois. Les signes révélateurs étaient des douleurs thoraciques, une toux sèche et une dyspnée dans 7 cas, une hémoptysie dans 4 cas. La radiographie thoracique a objectivé une opacité centrale arrondie spiculée dans 4 cas, opacité systématisée dans 3 cas et un poumon opaque dans 2 cas. La tomodensitométrie (TDM) thoracique a montré un processus tissulaire avec bourgeon endobronchique dans 5cas, une pneumopathie systématisé dans 4 cas, un collapsus dans 7 cas, une dilatation de bronches localisée dans 2 cas, des adénopathies médiastinales dans 4 cas. La bronchoscopie a permis le diagnostic macroscopique dans tous les cas. Tous les patients ont bénéficié d'un traitement chirurgical fait de lobectomie dans 4 cas, pneumectomie dans 3 cas et bilobectomie dans 2 cas. CONCLUSION: La TDM est indispensable pour le diagnostic positif topographique et dans le bilan d'extension pré-thérapeutique des tumeurs carcinoïdes bronchiques. Son apport principal par rapport à celui de la fibroscopie est de montrer leur éventuel développement exo-bronchique, et les complications pulmonaires d'aval.

12.
Health Sci Dis ; 22(11): 24-28, 2021 Nov.
Artigo em Francês | MEDLINE | ID: mdl-34824573

RESUMO

INTRODUCTION: Limb-Girdle Muscular dystrophies (LGMD) is a group of inherited diseases characterized by predominantly proximal and limb muscle weakness. These are rare diseases that have not been well studied in sub-saharan Africa. The aim of our was the clinical and paraclinical characterization of patients with recessive LGMD at the Department of Neurology of the Teaching Hospital of Point G. PATIENTS AND METHODS: We conducted a longitudinal prospective study which took place from March 2014 to May 2019. Patients with recessive LGMD phenotype were enrolled. Sociodemographic, clinical and laboratory data were analyzed. RESULTS: We enrolled 46 families (67 patients), i.e. a frequency of 16.7% among the neurodegenerative diseases seen in the service. Among them, 45.6% came from the Sikasso region. Autosomal recessive inheritance pattern was suspected in 67.4% of the families. Symptoms appeared mainly in the first decade of life. Proximal muscle weakness was found in almost all patients. Cardiac examination showed dilated cardiomyopathy in 4.5% of cases. CONCLUSION: Limb-Girdle muscular dystrophy is a disabling disease that is found in Mali. Further study of these cases could elucidate the underlying genetic defects.

13.
Endoscopy ; 42(11): 895-9, 2010 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-20725887

RESUMO

BACKGROUND AND STUDY AIMS: Infection is a recognized complication of endoscopic retrograde cholangiopancreatography (ERCP). We describe the epidemiologic and molecular investigations of an outbreak of ERCP-related severe nosocomial infection due to KLEBSIELLA PNEUMONIAE producing extended-spectrum beta-lactamase (ESBL). PATIENTS AND METHODS: We conducted epidemiologic and molecular investigations to identify the source of the outbreak in patients undergoing ERCP. We carried out reviews of the medical and endoscopic charts and microbiological data, practice audits, surveillance cultures of duodenoscopes and environmental sites, and molecular typing of clinical and environmental isolates. RESULTS: Between December 2008 and August 2009, 16 patients were identified post-ERCP with KLEBSIELLA PNEUMONIAE that produced extended-spectrum beta-lactamase type CTX-M-15. There were 8 bloodstream infections, 4 biliary tract infections, and 4 cases of fecal carriage. The microorganism was isolated only from patients who had undergone ERCP. Environmental investigations found no contamination of the washer-disinfectors or the surfaces of the endoscopy rooms. Routine surveillance cultures of endoscopes were repeatedly negative during the outbreak but the epidemic strain was finally isolated from one duodenoscope by flushing and brushing the channels. Molecular typing confirmed the identity of the clinical and environmental strains. Practice audits showed that manual cleaning and drying before storage were insufficient. Strict adherence to reprocessing procedures ended the outbreak. CONCLUSIONS: The endoscopes used for ERCP can act as a reservoir for the emerging ESBL-producing K. PNEUMONIAE. Regular audits to ensure rigorous application of cleaning, high-level disinfection, and drying steps are crucial to avoid contamination.


Assuntos
Colangiopancreatografia Retrógrada Endoscópica/efeitos adversos , Surtos de Doenças , Farmacorresistência Bacteriana Múltipla , Infecções por Klebsiella/epidemiologia , Infecções por Klebsiella/transmissão , Klebsiella pneumoniae/efeitos dos fármacos , Duodenoscopia/efeitos adversos , Eletroforese em Gel de Campo Pulsado , Contaminação de Equipamentos , Humanos , Klebsiella pneumoniae/genética , Tipagem Molecular , beta-Lactamases/análise
14.
J Hosp Infect ; 106(1): 57-64, 2020 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-32590010

RESUMO

BACKGROUND: Surgical site infection (SSI) largely implicates the patient's endogenous skin microbiota. Perioperative disinfection protocols do not follow a general agreement. AIM: To compare antisepsis and skin protection protocols on quantitative analysis of recolonization in the operating room at regular time-steps. The study hypothesis was that one protocol would be more effective than others. METHODS: A single-centre prospective interventional study was conducted between January and June 2019. Healthy volunteers were randomized between protocols and served as their own controls. The protocols began ahead of scheduled orthopaedic surgery with a preoperative shower, mechanical cleansing, application of major antiseptics (alcoholic Bétadine™ 5% or alcoholic chlorhexidine 0.5%), sterile draping, then adhesive draping (3M™ Steri-Drape™ or iodine-impregnated 3M™ Ioban2™). Sampling was by swabbing in the operating room at 30 min intervals up to 90 min after draping. Cultures were performed under aerobic and anaerobic conditions. Qualitative and quantitative (cfu/mL) bacteriology was performed in the laboratory by direct reading on the blood agar plates. FINDINGS: Thirty subjects were included; none was lost to follow-up or excluded from analysis. Bacterial load before manipulation (T0) was significantly higher in males (P < 0.0001) despite a significantly shorter shower-to-sampling interval (P = 0.03). Smoking (P = 0.85), body mass index (P = 0.38), and depilation (P = 0.50) did not significantly affect preoperative load. Mean load increased significantly under all protocols up to T90 min, without significant superiority for any one protocol. Associated Bétadine™/Ioban™ showed the lowest T90 load, and chlorhexidine alone the highest, but without significant difference. Isolates at T0 were predominantly healthy skin commensals: coagulase-negative staphylococci, micrococci, and coryneforms. CONCLUSION: No one protocol demonstrated superiority, whether in immediate bactericidal action or in preventing skin recolonization in the operating room. Further studies are needed to define generally agreed protocols for SSI risk management.


Assuntos
Anti-Infecciosos Locais/farmacologia , Antissepsia/normas , Cuidados Pré-Operatórios/métodos , Pele/microbiologia , Adulto , Antissepsia/métodos , Clorexidina/farmacologia , Desinfecção/métodos , Desinfecção/normas , Feminino , Humanos , Masculino , Salas Cirúrgicas , Povidona-Iodo/farmacologia , Estudos Prospectivos , Distribuição Aleatória , Infecção da Ferida Cirúrgica/microbiologia , Infecção da Ferida Cirúrgica/prevenção & controle , Adulto Jovem
15.
Neurochirurgie ; 66(5): 365-368, 2020 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-32861684

RESUMO

INTRODUCTION: Subdural empyema (SDE) is a rare complication of chronic subdural hematoma (CSDH) surgery. We introduced antibiotic prophylaxis (AP) for this procedure in 2014 following a morbidity-mortality conference (MMC) in our department. We report the results of retrospective data analysis to assess the effect of systematic AP and to identify risk factors for SDE. MATERIAL AND METHODS: Two hundred eight patients were recruited between January 2013 and December 2015; 5 were excluded for incomplete data: 107 without and 96 with AP (n=203). SDE was confirmed by clinical examination, imaging and bacteriological analysis. Comparisons between AP-(no cefuroxime) and AP+ (cefuroxime) groups were made with Chi2 test and Student's t-test. RESULTS: One empyema was found in each group, indicating that AP had no effect (P=1). The only criterion associated with SDE for these two patients was a greater number of reoperations for CSDH recurrence (P=0.013). DISCUSSION: The incidence of postoperative empyema was 1%, similar to the range of 0.2%-2.1% reported in the literature. This rare incidence explains why we found no significant effect of AP. The medical decision taken at the MMC did not help to reduce the rate of postoperative SDE. MMCs can help to define factors associated with adverse surgical events and identify opportunities for improvement. CONCLUSION: AP, introduced after an MMC, did not impact SDE rates. In practice, AP should be required only in case of reoperation for CSDH recurrence. However, we still continue to use AP following the MMC considering different parameters discussed in the manuscript.


Assuntos
Empiema Subdural/terapia , Hematoma Subdural Crônico/cirurgia , Complicações Pós-Operatórias/terapia , Idoso , Idoso de 80 Anos ou mais , Antibioticoprofilaxia , Cefuroxima/uso terapêutico , Estudos de Coortes , Empiema Subdural/epidemiologia , Empiema Subdural/etiologia , Feminino , Humanos , Incidência , Masculino , Pessoa de Meia-Idade , Procedimentos Neurocirúrgicos/efeitos adversos , Procedimentos Neurocirúrgicos/métodos , Complicações Pós-Operatórias/epidemiologia , Recidiva , Estudos Retrospectivos
16.
Mali Med ; 35(1): 20-24, 2020.
Artigo em Francês | MEDLINE | ID: mdl-37978758

RESUMO

INTRODUCTION: Surgical site infections (SSI) are frequent and dangerous in the surgical ward. They represent an obsession for the surgeon. The objectives were to determine the frequency of ISOs and risk factors, to identify the germs and to study their sensitivity to different antibiotics. MATERIALS AND METHODS: This was a cross-sectional study with prospective data collection, performed at the general surgery department of the Bocar Sidy Sall University Hospital Center (Kati CHU) from January 2015 to December 2018. RESULTS: During this period of study we recorded 55 cases of ISO out of 650 operated patients with a frequency of 8.46%. 450 patients were operated on the cold operating program (69.23%) and 200 patients on emergency (30.77%). The average age was 39, the sex ratio was 2.66. Among the 55 cases of ISO, 60% of these patients were operated in emergency and 40% in the operating program. The most common strains found were Escherichia coli (E. coli) in 38.3% of cases, Staphylococcus aureus in 23.4% and Klebsiella pneumonia in 13.3%. Hemoglobin levels were normal in 70% of cases. 4 of our patients or 7.27% were diabetic. We did not have any cases of obesity. Of the 55 cases of ISO, 66% were of class 3 and 4 of Altemeier, 59% were of ASA score 2 and ASA 3, 55% were of score 2 of NNISS (National Nosocomial Infection Surveillance System), 5.45% were NNISS score 3 or 3 cases and these 3 cases developed ISO. The ISOs were parietal in 49 cases, ie 89%. The recovered germs were 100% sensitive to imipenem. The most informative interventions of the ISOs were peritonitis 25 cases (45.45%), intestinal occlusions 12 cases (21.82%), appendicular abscess 8 cases (14.55%). We had 2 death cases, 3.64%, the average hospital stay was 13 days. CONCLUSION: Escherichia coli was the common germ found in the ISO in general surgery at Kati BSS Hospital. The usual resistance to antibiotics must provoke effective preventive actions.


INTRODUCTION: Les infections du site opératoires (ISO) sont fréquentes et redoutables, au service de chirurgie. Elles représentent une hantise pour le chirurgien. Les objectifs étaient de déterminer la fréquence des ISO et les facteurs de risque, d'identifier les germes et étudier leur sensibilité aux différents antibiotiques. MATÉRIELS ET MÉTHODES: il s'agissait d'une étude transversale avec recueil prospectif des données, réalisée au service de chirurgie générale du Centre Hospitalier Universitaire Bocar Sidy Sall (CHU BSS) de Kati allant de janvier 2015 à décembre 2018. Elle a concerné tous les patients opérés dans le service pendant cette période d'étude. N'ont pas été inclus dans cette étude les cas de biopsie. RÉSULTATS: Au cours de cette période d'étude nous avons enregistré 55 cas d'ISO sur 650 malades opérés soit une fréquence de 8,46%. 450 malades ont été opérés au programme opératoire à froid (69,23%) et 200 malades en urgence (30,77%). L'âge moyen était de 39 ans, le sex-ratio à 2,66. Parmi les 55 cas d'ISO, 60% de ces malades ont été opérés en urgence et 40% au programme opératoire. Les différentes souches les plus retrouvées étaient l'Escherichia coli (E. coli) dans 38,3% des cas, le staphylococcus aureus dans 23,4%, klebsiella pneumonia dans 13,3%. Le taux d'hémoglobine était normal dans 70% des cas. 4 de nos patients soit 7,27% étaient diabétiques. Nous n'avions pas enregistré de cas d'obésité. Parmi les 55 cas des ISO, 66 % étaient de classe 3 et 4 d'Altemeier, 59% étaient de score ASA 2 et ASA 3, 55% étaient de score 2 de NNISS (National Nosocomial Infection Surveillance System), 5,45% étaient de score 3 de NNISS soit 3 cas et ces 3 cas ont développé des ISO. Les ISO étaient pariétales dans 49 cas soit 89%. Les germes retrouvés étaient sensibles à 100% à l'imipénème. Les interventions les plus pourvoyeuses des ISO étaient les péritonites 25 cas (45,45%), les occlusions intestinales 12 cas (21,82%), les abcès appendiculaires 8 cas (14,55%). Nous avions enregistré 2 cas de décès soit 3,64%, la durée moyenne d'hospitalisation a été de 13 jours. CONCLUSION: L'Escherichia coli était le germe fréquemment rencontré dans les ISO en chirurgie générale au CHU BSS de Kati. La résistance aux antibiotiques usuels doit susciter des actions préventives efficaces.

17.
J Virol ; 82(7): 3584-9, 2008 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-18199644

RESUMO

The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 x 10(-4) and 8 x 10(-4) nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 x 10(-4) and 11 x 10(-4) nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.


Assuntos
Evolução Molecular , Doenças das Plantas/virologia , Vírus de Plantas/genética , Vírus de RNA/genética , África , Sequência de Bases , Mutação , Oryza , Homologia de Sequência
18.
Virus Res ; 141(2): 258-67, 2009 May.
Artigo em Inglês | MEDLINE | ID: mdl-19195488

RESUMO

The available knowledge on the epidemiology of Rice yellow mottle virus (RYMV) is reassessed in the light of major advances in field and molecular studies of the disease it causes in rice. Previously un-described means of transmission by mammals and through leaf contact have been discovered recently. Several agricultural practices, including the use of seedbed nurseries, have also contributed to a massive build-up of RYMV inoculum. Phytosanitation is now known to be critical to reduce disease incidence in rice. A new model of the ecology of RYMV in which man plays a central role has emerged. Furthermore, estimates of the evolutionary rate of change of RYMV provided a time-frame for its epidemiology, the first attempt for a plant virus. Earlier interpretations of the patterns of virus diversity which assumed a long-term evolution, and assigned a major role to adaptive events had to be discarded. In contrast, a wave-like model of dispersal of RYMV, which postulates its initial diversification in East Africa, followed by westward spread across the continent, was developed, refined and dated. The most salient -- and largely unexpected -- finding is that RYMV emerged recently and subsequently spread rapidly throughout Africa in the last two centuries. Diversification and spread of RYMV has been concomitant with an extension of rice cultivation in Africa since the 19th century. This major agro-ecological change increased the encounters between primary hosts of RYMV and cultivated rice. It also modified the landscape ecology in ways that facilitated virus spread.


Assuntos
Oryza/virologia , Doenças das Plantas/virologia , Vírus de Plantas/genética , Vírus de RNA/genética , África , Filogenia , Vírus de Plantas/classificação , Vírus de Plantas/isolamento & purificação , Vírus de Plantas/fisiologia , Vírus de RNA/classificação , Vírus de RNA/isolamento & purificação , Vírus de RNA/fisiologia
19.
J Med Virol ; 81(1): 42-8, 2009 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-19031461

RESUMO

Enteroviruses (EV) are the main etiological agents of aseptic meningitis. Diagnosis is made by detecting the genome using RT-PCR. The aim of the study was to evaluate the impact of a positive diagnosis on the management of infants, children, and adults. During 2005, 442 patients were admitted to hospital with suspected meningitis. Clinical and laboratory data and initial treatment were recorded for all patients with enteroviral meningitis. The turnaround time of tests and the length of hospital stay were analyzed. The results showed that EV-PCR detected EV in 69 patients (16%), 23% (16/69) were adults. About 18% of CSF samples had no pleocytosis. After positive PCR results, 63% of children were discharged immediately (mean 2 hr 30 min) and 95% within 24 hr. Infants and adults were discharged later (after 1.8 and 2 days, respectively). The use of antibiotics was significantly lower in children than in infants and adults. The PCR results allowed discontinuation of antibiotics in 50-60% of all patients treated. Patients received acyclovir in 16% of cases (7% children vs. 50% adults) and 23% (11% vs. 69%) underwent a CT scan. Clinical data were compared between patients whose positive EV-PCR results were available within 24 hr (n = 32) and those whose results were available > 24 hr after collection of CSF (n = 14). Duration of antibiotic treatment (difference: 2.3 days; P = 0.05) was reduced between the two groups. No statistical difference in the length of stay was observed. The EV-PCR assay should be performed daily in hospital laboratory practice and considered as part of the initial management of meningitis.


Assuntos
Infecções por Enterovirus/diagnóstico , Infecções por Enterovirus/terapia , Enterovirus/isolamento & purificação , Meningite Asséptica/terapia , Meningite Asséptica/virologia , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Antibacterianos/uso terapêutico , Antivirais/uso terapêutico , Administração de Caso , Criança , Pré-Escolar , Enterovirus/genética , Feminino , Humanos , Lactente , Recém-Nascido , Tempo de Internação , Masculino , Pessoa de Meia-Idade , Fatores de Tempo , Tomografia Computadorizada por Raios X
20.
Antibiotiques (Paris) ; 11(1): 29-36, 2009 Feb.
Artigo em Francês | MEDLINE | ID: mdl-32288523

RESUMO

OBJECTIVES: To describe epidemiological features of viral nosocomial infections (VNI) and their prevention principles. EPIDEMIOLOGY: Many factors lead to underestimate VNI: difficulty to distinguish between community-acquired and nosocomial infections for seasonal viral diseases, incubation time leading to symptoms after patient discharge, difficulty for diagnosis. Population at high risks of VNI are the children, the elderly and the immunocompromized patients. The risk of severe diseases is high in this last population. The main reservoir of virus is infected symptomatic or asymptomatic individuals. Asymptomatic carriers, especially health care workers, are a major source of transmission. Main routes of transmission are the fecal-oral route, the respiratory route, cutaneous or mucous contact and blood and body fluids exposure. A review of the main virus involved in VNI is presented. PREVENTION: Preventive measures, such as strict adherence to standard precautions and, in some instances, to isolation procedures, are critical to control VNI. In a major outbreak situation, it may be necessary to consider cohort isolation. Specific control measures rely on immunization, antiviral drug prophylaxis (varicella-zooster, herpes, influenza, exposure to blood) and clinical and biological screening of organ, blood, tissue and cell donors.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA