Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 67
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
País de afiliação
Intervalo de ano de publicação
1.
BMC Neurol ; 24(1): 15, 2024 Jan 02.
Artigo em Inglês | MEDLINE | ID: mdl-38166857

RESUMO

BACKGROUND: Combined oxidative phosphorylation deficiency (COXPD) is a severe disorder with early onset and autosomal recessive inheritance, and has been divided into 51 types (COXPD1-COXPD51). COXPD14 is caused by a mutation in the FARS2 gene, which encodes mitochondrial phenylalanyl-tRNA synthetase (mt-PheRS), an enzyme that transfers phenylalanine to its cognate tRNA in mitochondria. Since the first case was reported in 2012, an increasing number of FARS2 variations have been subsequently identified, which present three main phenotypic manifestations: early onset epileptic encephalopathy, hereditary spastic paraplegia, and juvenile-onset epilepsy. To our knowledge, no adult cases have been reported in the literature. METHODS: We report in detail a case of genetically confirmed COXPD14 and review the relevant literature. RESULTS: Approximately 58 subjects with disease-causing variants of FARS2 have been reported, including 31 cases of early onset epileptic encephalopathy, 16 cases of hereditary spastic paraplegia, 3 cases of juvenile-onset epilepsy, and 8 cases of unknown phenotype. We report a case of autosomal recessive COXPD14 in an adult with status epilepticus as the only manifestation with a good prognosis, which is different from that in neonatal or infant patients reported in the literature. c.467C > T (p.T156M) has been previously reported, while c.119_120del (p.E40Vfs*87) is novel, and, both mutations are pathogenic. CONCLUSIONS: This case of autosomal recessive COXPD14 in an adult only presented as status epilepticus, which is different from the patients reported previously. Our study expands the mutation spectrum of FARS2, and we tended to define the phenotypes based on the clinical manifestation rather than the age of onset.


Assuntos
Epilepsia , Doenças Mitocondriais , Fenilalanina-tRNA Ligase , Paraplegia Espástica Hereditária , Estado Epiléptico , Lactente , Adulto , Recém-Nascido , Humanos , Paraplegia Espástica Hereditária/genética , Epilepsia/genética , Doenças Mitocondriais/genética , Mutação/genética , Fenótipo , Fenilalanina-tRNA Ligase/genética , Proteínas Mitocondriais/genética
2.
Epilepsy Behav ; 147: 109387, 2023 10.
Artigo em Inglês | MEDLINE | ID: mdl-37625346

RESUMO

Coronavirus disease-2019 (COVID-19) first emerged in late 2019 and has since spread worldwide. More than 600 million people have been diagnosed with COVID-19, and over 6 million have died. Vaccination against COVID-19 is one of the best ways to protect humans. Epilepsy is a common disease, and there are approximately 10 million patients with epilepsy (PWE) in China. However, China has listed "uncontrolled epilepsy" as a contraindication for COVID-19 vaccination, which makes many PWE reluctant to get COVID-19 vaccination, greatly affecting the health of these patients in the COVID-19 epidemic. However, recent clinical practice has shown that although a small percentage of PWE may experience an increased frequency of seizures after COVID-19 vaccination, the benefits of COVID-19 vaccination for PWE far outweigh the risks, suggesting that COVID-19 vaccination is safe and recommended for PWE. Nonetheless, vaccination strategies vary for different PWE, and this consensus provides specific recommendations for PWE to be vaccinated against COVID-19.


Assuntos
COVID-19 , Epilepsia , Humanos , COVID-19/prevenção & controle , Vacinas contra COVID-19/efeitos adversos , Consenso , População do Leste Asiático , Epilepsia/complicações , Epilepsia/epidemiologia , Vacinação
3.
Eur J Nucl Med Mol Imaging ; 47(11): 2507-2515, 2020 10.
Artigo em Inglês | MEDLINE | ID: mdl-32424483

RESUMO

PURPOSE: The purpose was to investigate the effects of short acquisition time on the image quality and the lesion detectability of oncological 18F-FDG total-body PET/CT. METHODS: Nineteen oncological patients (6/13 women/men, age 65.6 ± 9.4 years) underwent total-body PET/CT on uEXPLORER scanner using 3D list mode. The administration of 18F-FDG was weight-based (4.4 MBq/kg). The acquisition time was 900 s, and PET data were reconstructed into 900-, 180-, 120-, 60-, 30-, and 18-s duration groups. The subjective PET image quality was scored using a 5-point scale (5, excellent; 1, poor) in 3 perspectives: overall quality, noise, and lesion conspicuity. The objective image quality was evaluated by SUVmax and standard deviation (SD) of the liver, SUVmax of the tumor, and tumor-to-background ratio (TBR). The lesion detectability was the percentage of identifiable lesions in the groups of 180 to 18 s using the group 900 s as reference. RESULTS: Our results showed that sufficient and acceptable subjective image quality could be achieved with 60- and 30-s groups, and good image quality scores were given to 180- and 120-s groups without significant difference. For shortened acquisition time, SD was increased, while SUVmax of tumor and TBR remained unchanged. The lesion detectability was decreased with shorter acquisition time, but the detection performance could be maintained until the 60-s group compared with the 900-s group, although the image quality degraded. CONCLUSION: The total-body PET/CT can significantly shorten the acquisition time with maintained lesion detectability and image quality.


Assuntos
Fluordesoxiglucose F18 , Neoplasias , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias/diagnóstico por imagem , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Tomografia por Emissão de Pósitrons
4.
Chembiochem ; 20(19): 2467-2473, 2019 10 01.
Artigo em Inglês | MEDLINE | ID: mdl-31063617

RESUMO

This study demonstrates that the enzymatic reaction rate can be increased significantly by targeted heating of the microenvironment around the enzyme, while maintaining the reaction system at environmental temperature. Enzyme molecules are covalently attached to the surface of Fe3 O4 @reduced graphite oxide (rGO). Under visible-light irradiation, the reaction rate catalyzed by the enzyme-Fe3 O4 @rGO system is clearly enhanced relative to that of the free enzyme and a mixture of free enzyme and Fe3 O4 @rGO. This local heating mechanism contributes to promotion of the enzymatic reactions of the targeted heating of the enzyme (THE) system, which has been validated by using different enzymes, including lipase, glucose oxidase, and organophosphorus hydrolase. These results indicate that targeted heating of the catalytic centers has the same effect on speeding up reactions as that of traditional heating methods, which treat the whole reaction system. As an example, it is shown that the THE system promotes the sensitivity of an enzyme screen-printed electrode by 14 times at room temperature, which implies that the THE system can be advantageous in improving enzyme efficiency, especially if heating the entire system is impossible or could lead to degradation of substrates or damage of components, such as in vitro bioanalysis of frangible molecules or in vivo diagnosis.


Assuntos
Arildialquilfosfatase/metabolismo , Técnicas Biossensoriais , Glucose Oxidase/metabolismo , Grafite/química , Calefação/métodos , Lipase/metabolismo , Nanopartículas/química , Arildialquilfosfatase/química , Sobrevivência Celular , Microambiente Celular , Compostos Férricos/química , Glucose Oxidase/química , Humanos , Raios Infravermelhos , Lipase/química
5.
BMC Neurol ; 19(1): 227, 2019 Sep 16.
Artigo em Inglês | MEDLINE | ID: mdl-31526374

RESUMO

BACKGROUND: Adrenoleukodystrophy is a rare neurogenetic disease, AMN is the most common adult phenotype, such patients in China have not gotten enough attention. This article aims to study the features of AMN in Chinese patients and expand the gene spectrum of Chinese X-linked adrenoleukodystrophy (X-ALD) patients. METHODS: We applied clinical analysis, radiology, plasma levels of very long chain fatty acids (VLCFA) and genetic analysis to test the 6 Chinese AMN patients. RESULTS: All 6 patients are men. Ages of neurological symptom onset are distributed between 21 and 38. Sexual dysfunction occurred in 5 of 6 patients. Three patients had positive family history. Five patients had Addison's disease. Four patients were diagnosed as pure AMN, while the other two patients were with cerebral involvement. Four patients had abnormalities of nerve conduction studies. There were four patients with central conduction defects in somatosensory evoked potential tests. All 6 patients were found diffuse cord atrophy in spinal MRI. Brain MRI showed abnormal signals in 2 of the 6 tested patients, which indicated the clinical phenotypes. Plasma levels of VLCFA, as well as C24:0/C22:0 and C26:0/C22:0 ratios were elevated in 5 tested patients. Five different ABCD1 mutations were identified in 5 tested patients, one of which was a de novo mutation, and the other four have been reported previously. CONCLUSION: This research described the clinical, neuroimaging, biochemical, and genetic sides of Chinese AMN patients. A de novo mutation in the ABCD1 gene sequence was identified. Emotional trauma may trigger or aggravate the development of cerebral demyelination in AMN patients. Regular evaluation of brain MRI is important for AMN patients, especially for 'pure AMN' patients. When encountering patients with 'myeloneuropathy-only', neurologists should not ignore the tests of VLCFA or/and the ABCD1 gene.


Assuntos
Adrenoleucodistrofia , Membro 1 da Subfamília D de Transportadores de Cassetes de Ligação de ATP/genética , Adrenoleucodistrofia/genética , Adrenoleucodistrofia/metabolismo , Adrenoleucodistrofia/patologia , Adrenoleucodistrofia/fisiopatologia , Adulto , China , Humanos , Masculino , Adulto Jovem
6.
BMC Endocr Disord ; 18(1): 68, 2018 Sep 21.
Artigo em Inglês | MEDLINE | ID: mdl-30241518

RESUMO

BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.


Assuntos
Hiperplasia Suprarrenal Congênita/diagnóstico por imagem , Hiperplasia Suprarrenal Congênita/genética , Povo Asiático/genética , Heterozigoto , Esteroide 11-beta-Hidroxilase/genética , Humanos , Masculino , Mutação/genética , Adulto Jovem
7.
Nanotechnology ; 26(16): 165401, 2015 Apr 24.
Artigo em Inglês | MEDLINE | ID: mdl-25815586

RESUMO

To achieve iron-nitrogen-carbon (Fe-N-C) nanofibers with excellent electrocatalysis for replacing high-cost Pt-based catalysts in the cathodes of fuel cells and metal-air batteries, we have investigated and evaluated the effects of polyacrylonitrile (PAN) concentration and the proportion of iron to PAN, along with voltage and flow rate during the electrospinning process, and thus proposed three criteria to optimize these parameters for ideal nanofiber catalysts. The best half-wave potential of an optimized catalysts is 0.82 V versus reversible hydrogen electrode in an alkaline medium, which reaches the best range of the non-precious-metal catalysts reported and is very close to that of commercial Pt/C catalysts. Furthermore, the electron-transfer number of our catalysts is superior to that of the Pt/C, indicating the catalysts undergo a four-electron process. The durability of the optimized Fe-N-C nanofibers is also better than that of the Pt/C, which is attributed to the homogeneous distribution of the active sites in our catalysts.

8.
Zhonghua Yi Xue Za Zhi ; 95(5): 378-81, 2015 Feb 03.
Artigo em Zh | MEDLINE | ID: mdl-26168676

RESUMO

OBJECTIVE: To explore the changes over time of cannabinoid receptor 1 (CB1R) in hippocampus of status epilepticus (SE) rats. METHODS: A rat model of SE was established by an intraperitoneal injection of kainic acid (KA). The animals were scarified 30 minutes later. And the changes of CB1lR were detected by immunohistochemistry and Western blot at 4 hours, 1 day, 1 week, 1 month and 2 months post-SE. RESULTS: CB1R in CAl area of hippocampus of SE rats increased gradually at 1 week and then decreased to normal afterward (KA vs NS: 5. 5 ± 1. 1 vs 1.8 ± 0. 2, 6. 4 ± 3. 7 vs 3. 1 ± 0. 7, 16. 9 ± 10. 4 vs 3. 7 ± 1. 7, 8. 8 ± 5. 4 vs 6. 9 ± 4. 0, 3. 2 ± 1. 0 vs 4.4 ± 1. 9). And CBlR in area of CA3, DG had the same trend as CAI. The IA of CBl R significantly increased at 1 week (P <0. 05) and insignificantly deceased after 1 week (P > 0. 05). CONCLUSION: There is a protective increase of CB1R in hippocampus of SE rats and then it returns to normal. Thus CB1R may he involved in the occurrences and terminations of seizures.


Assuntos
Hipocampo , Estado Epiléptico , Animais , Canabinoides , Ácido Caínico , Ratos , Receptor CB1 de Canabinoide , Convulsões
9.
Small ; 10(20): 4072-9, 2014 Oct 29.
Artigo em Inglês | MEDLINE | ID: mdl-24995876

RESUMO

Electrospun carbon nanofibers containing iron and nitrogen are designed to catalyze the oxygen reduction reaction instead of Pt-based catalysts. Their surface morphology is modified finely by using ultralow oxygen flow, and their onset and half-wave potentials are improved to 0.88 V and 0.76 V versus the reversible hydrogen electrode, respectively, approaching those of Pt-based catalysts.

10.
J Headache Pain ; 15: 70, 2014 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-25366245

RESUMO

BACKGROUND: To examine the association between headaches and epilepsy. METHODS: Consecutive adult epileptic patients who went to the outpatient clinic of the Epilepsy Center of PLA General Hospital between February 01, 2012, and May 10, 2013, were recruited into this study. A total of 1109 patients with epilepsy completed a questionnaire regarding headaches. RESULTS: Overall, 60.1% of the patients (male: 57.2%; female: 63.8%) reported headaches within the last year. The age-weighted prevalence of interictal migraine was 11.7% (male 8.9%, female 15.3%), which is higher than that reported in a large population-based study (8.5%, male 5.4%, female 11.6%) using the same screening questions. The prevalence of postictal headaches was 34.1% (males 32.7%, females 35.2%), and the presence of preictal headaches was 4.5% (males 4.3%, females 5.2%). The prevalence of headache yesterday in the general population was 4.8% (male 3.0%, female 6.6%). Thus, the prevalence of headaches, including migraine, is higher in epileptic patients in China. CONCLUSIONS: The high prevalence of postictal headaches confirms the frequent triggering of a headache by a seizure. A much lower frequency of preictal headaches, a condition in which the real triggering effect of the headache on the seizure might be difficult to prove.


Assuntos
Epilepsia/epidemiologia , Cefaleia/epidemiologia , Adolescente , Adulto , Idoso , China/epidemiologia , Comorbidade , Feminino , Cefaleia/diagnóstico , Humanos , Masculino , Pessoa de Meia-Idade , Prevalência , Índice de Gravidade de Doença , Adulto Jovem
11.
Zhonghua Yi Xue Za Zhi ; 94(39): 3062-5, 2014 Oct 28.
Artigo em Zh | MEDLINE | ID: mdl-25549678

RESUMO

OBJECTIVE: To improve the understanding of lumbosacralradiculitis by analyzing the clinical, magnetic resonance imaging (MRI) and neuroeletrophysiological characteristics of disease. METHODS: The clinical, MRI and neuroeletrophysiological data of 14 patients diagnosed as lumbosacralradiculitis were retrospectively analyzed. RESULTS: The predominant age of onset was in the forth decade. Each patient had bilateral or unilateral lower extremity numbness and weakness of variable severity, including muscle atrophy (n = 5) and decreased sensation in L4-S1 nerve root territory (n = 9). Lower extremity tendon reflexes decreased or became absent in all patients. Urinary and defecation disorders were seen in 3 patients. Lumbosacral MRI showed lumbosacral meninges and nerve root enhancement in 4 patients. Cerebrospinal fluid analysis revealed elevated white blood cell (30×10(6)/L) (n = 1) and increased protein content (n = 12) (450-1 000 mg/L, n = 7; 1 000-2 000 mg/L, n = 3; 2 000-3 000 mg/L, n = 2). Needle electromyography (EMG) demonstrated neurogenic damage in 13 patients. Motor nerve conduction study showed decreased motor never conduction velocity (MCV) (n = 5), decreased compound muscle action potential (CMAP) amplitude (n = 12), CMAP absent at right side (n = 2) and left side (n = 1) among 22 peroneal nerves; decreased MCV (n = 6), decreased CMAP amplitude (n = 6), CMAP absent at right side (n = 2) and left side (n = 1) among 23 tibial nerves. F-wave was performed for 11 patients and abnormal in 6 patients, with prolonged latency and reduced occurrence rate in right common peroneal nerve (n = 2), left prolonged latency (n = 3) and right tibial nerve (n = 1) respectively. Bilateral sural nerve conduction study revealed no abnormality. CONCLUSION: Diagnosing lumbosacralradiculitis is not easy based on lumbosacral MRI. And neuroelectrophysiological study may provide more valuable information in verifying the location of lesions and judging the damage extent of lumbosacralradiculitis.


Assuntos
Eletromiografia , Região Lombossacral , Radiculopatia , Humanos , Imageamento por Ressonância Magnética , Nervos Periféricos , Estudos Retrospectivos
12.
J Mov Disord ; 17(3): 282-293, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38600684

RESUMO

OBJECTIVE: Sialidosis type 2 has variants that are both catalytically inactive (severe), while sialidosis type 1 has at least one catalytically active (mild) variant. This study aimed to discuss the structural changes associated with these variants in a newly reported family carrying N-acetyl-α-neuraminidase-1 (NEU1) variants and explore the clinical characteristics of different combinations of variants in sialidosis type 1. METHODS: First, whole-exome sequencing and detailed clinical examinations were performed on the family. Second, structural analyses, including assessments of energy, flexibility and polar contacts, were conducted for several NEU1 variants, and a sialidase activity assay was performed. Third, previous NEU1 variants were systematically reviewed, and the clinical characteristics of patients in the severe-mild and mild-mild groups with sialidosis type 1 were analyzed. RESULTS: We report a novel family with sialidosis type 1 and the compound heterozygous variants S182G and V143E. The newly identified V143E variant was predicted to be a mild variant through structural analysis and was confirmed by a sialidase activity assay. Cherry-red spots were more prevalent in the severe-mild group, and ataxia was more common in the mild-mild group. Impaired cognition was found only in the severe-mild group. Moreover, patients with cherry-red spots and abnormal electroencephalographies and visual evoked potentials had a relatively early age of onset, whereas patients with myoclonus had a late onset. CONCLUSION: Changes in flexibility and local polar contacts may be indicators of NEU1 pathogenicity. Sialidosis type 1 can be divided into two subgroups according to the variant combinations, and patients with these two subtypes have different clinical characteristics.

13.
Epileptic Disord ; 2024 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-38896014

RESUMO

OBJECTIVE: This study aimed to analyze the clinical characteristics, etiology, and treatment of midlife-onset epilepsy in a real-world setting at a single center in China. METHODS: The clinical data of patients who attended the epilepsy clinic of the Department of Neurology, First Medical Center of Chinese PLA General Hospital from February 1999 to March 2023 were retrospectively analyzed. The clinical characteristics, etiology, and risk factors for midlife-onset epilepsy over the past 24 years were analyzed. RESULTS: Of the 969 patients with onset at 45-64 years of age, 914 were diagnosed with epilepsy with at least two unprovoked seizures 24 h apart. Of those, 99.7% (911) were of focal origin. The median duration from the initial seizure to follow-up treatment was 2 months (interquartile range [IQR]: 1.0-6.0 months). Before commencing treatment, 30.2% (207/683) of patients experienced more than two seizures. A structural etiology was found in 66.3% (606/914) of patients. Cerebrovascular disease (CVD) and traumatic brain injury (TBI) accounted for 19.9% (182/914) and 16.6% (152/914) of the cases, respectively. Logistic regression analysis showed that patients with abnormal imaging (odds ratio [OR] 2.04; 95% confidence interval [CI] 1.25-3.32; p = .004), focal seizures (OR 2.98; 95%CI 1.82-4.87; p < .001), and seizure clusters (OR 2.40; 95%CI 1.21-4.73; p = .01) had poor drug responses. Treatment outcomes were generally better in patients with epilepsy after CVD (OR .49; 95%CI .28-.85; p = .01). Treatment initiation after two seizures (OR .70; 95%CI .42-1.15; p = .16) or 6 months after the first seizure (OR 1.17; 95%CI .66-2.09; p = .58) did not result in poor drug effectiveness. SIGNIFICANCE: Midlife-onset epilepsy is typically of focal etiology, with CVD being the most common cause, and tends to respond well to medication. The median duration from the initial seizure to follow-up treatment was 2 months. Over 30% of patients experienced more than two seizures before commencing treatment, but this did not affect subsequent outcomes.

14.
Endocrine ; 85(3): 1162-1169, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-38622435

RESUMO

PURPOSE: Multiple daily injection (MDI) insulin therapy is an effective method of glycemic control and appropriate assignment to MDI therapy could minimize the risks of hypoglycemia and weight gain. The aim of the present study was to identify factors associated with indication for MDI therapy in type 2 diabetes (T2DM). METHODS: We recruited 360 participants with T2DM that were admitted to the Endocrinology Department of Peking University People's Hospital between August 2017 and July 2018. They first underwent intensive insulin therapy, then were switched to an optimized, simpler insulin treatment that aimed to maintain fasting blood glucose between 4.4 and 7.2 mmol/L, without episodes of hypoglycemia. The baseline characteristics of groups administering either MDI or basal/premix insulin were compared and multivariable logistic regression analysis was used to determine the odds ratios (ORs) for factors associated with MDI therapy. Receiver operating characteristic (ROC) curves were then used to identify independent predictors of MDI insulin regimen efficacy. RESULTS: The mean age of the participants was 57.6 ± 12.9 years, and diabetes duration was 14.2 ± 8.2 years. Two hundred and sixty-seven participants administered basal/premix insulin and 93 underwent MDI therapy, of whom 61.8% and 46.2% were male, respectively (p = 0.01). The duration of diabetes was significantly longer in the MDI group (13.1 ± 7.7 years vs. 17.3 ± 8.7 years; p < 0.01). Fasting plasma glucose (FPG) was higher in the MDI group than in the basal/premix group (8.3 [6.7, 11.3] mmol/L vs. 7.2 [5.7, 9.3] mmol/L; p < 0.01), while the postprandial C-peptide concentration (PCP) was significantly lower in the MDI group (2.6 [1.8, 3.5] ng/mL) compared to the basal/premix group (3.6 [2.5, 6.2] ng/mL, p < 0.01. Multivariable logistic regression analysis suggested that diabetes duration and FPG were positively associated with MDI therapy: OR (95% confidence interval [CI]) 1.06 (1.02, 1.10) and 1.12 (1.02, 1.24), respectively. In addition, PCP was negatively associated with MDI therapy (0.72 [0.60, 0.86]). ROC analysis suggested that a PCP of < 3.1 ng/mL predicted MDI therapy with 59.6% sensitivity and 72.1% specificity. CONCLUSION: The results of our study suggest that longer diabetes duration, higher FPG, and lower PCP were associated with necessity for MDI insulin regimen. These findings should assist with the personalization of insulin treatment.


Assuntos
Glicemia , Peptídeo C , Diabetes Mellitus Tipo 2 , Hipoglicemiantes , Insulina , Período Pós-Prandial , Humanos , Diabetes Mellitus Tipo 2/tratamento farmacológico , Diabetes Mellitus Tipo 2/sangue , Masculino , Feminino , Pessoa de Meia-Idade , Hipoglicemiantes/administração & dosagem , Hipoglicemiantes/uso terapêutico , Insulina/administração & dosagem , Idoso , Peptídeo C/sangue , Glicemia/análise , Glicemia/efeitos dos fármacos , Valor Preditivo dos Testes , Adulto , Resultado do Tratamento , Esquema de Medicação
15.
Epilepsia Open ; 9(4): 1406-1415, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-38808742

RESUMO

OBJECTIVES: Epilepsy and migraine are common chronic neurological disease. Epidemiologic studies and shared pathophysiology and treatment suggest that these two diseases overlap. However, migraine is often underestimated among patients with epilepsy. This study aimed to evaluate the prevalence of migraine and identify the related influencing factors among adult patients with epilepsy. METHODS: Adult patients with epilepsy were recruited at the outpatient epilepsy clinic of 13 tertiary hospitals in China from February to September 2022. ID Migraine questionnaire was applied to evaluate for migraine. Both univariable and multivariable logistic regression models were used to explore the influencing factors of migraine. RESULTS: A total of 1326 patients with epilepsy were enrolled in this study. The prevalence of migraine among patients with epilepsy was 19.2% (254/1326). In the multivariable analysis, being female (OR = 1.451, 95% CI: 1.068-1.975; p = 0.018), focal and focal to bilateral tonic-clonic seizures (OR = 1.583, 95% CI: 1.090-2.281; p = 0.015), and current seizure attack in the last 3 months (OR = 1.967, 95% CI: 1.282-3.063; p = 0.002) were the influencing factors for migraine. However, <10% of patients with epilepsy received analgesics for migraine. SIGNIFICANCE: Approximately 20% of patients with epilepsy screened positive for migraine. Being female, focal and focal to bilateral tonic-clonic seizures, and current seizure attack in the last 3 months were the influencing factors for migraine. Neurologists should pay more attention to the screening and management of the migraine among patients with epilepsy in China. PLAIN LANGUAGE SUMMARY: Epilepsy and migraine are common chronic neurological disease with shared pathophysiological mechanisms and therapeutic options. However, migraine is often underestimated among patients with epilepsy. This multicenter study aimed to evaluate the prevalence of migraine and current status of treatment. In this study, approximately 20% of patients with epilepsy screened positive for migraine. Female, focal and focal to bilateral tonic-clonic seizures, and current seizure attack in the last 3 months were identified as independent influencing factors for migraine. Despite the high prevalence, the treatment for migraine was not optimistic, neurologists should pay more attention to the screening and management of migraine.


Assuntos
Epilepsia , Transtornos de Enxaqueca , Humanos , Transtornos de Enxaqueca/epidemiologia , Feminino , Masculino , Epilepsia/epidemiologia , Adulto , Prevalência , Estudos Transversais , China/epidemiologia , Pessoa de Meia-Idade , Inquéritos e Questionários , Adulto Jovem , Fatores de Risco
16.
World J Pediatr ; 2024 May 28.
Artigo em Inglês | MEDLINE | ID: mdl-38806855

RESUMO

BACKGROUND: The diagnosis and treatment of attention deficit hyperactivity disorder (ADHD) comorbid with epilepsy have been insufficiently addressed in China. We conducted a study in China to investigate the current status, diagnosis, and treatment of ADHD in children to further our understanding of ADHD comorbid with epilepsy, strengthen its management, and improve patients' quality of life. METHODS: We carried out a multicenter cross-sectional survey of children with epilepsy across China between March 2022 and August 2022. We screened all patients for ADHD and compared various demographic and clinical factors between children with and without ADHD, including gender, age, age at epilepsy onset, duration of epilepsy, seizure types, seizure frequency, presence of epileptiform discharges, and treatment status. Our objective was to explore any possible associations between these characteristics and the prevalence of ADHD. RESULTS: Overall, 395 epilepsy patients aged 6-18 years were enrolled. The age at seizure onset and duration of epilepsy ranged from 0.1-18 to 0.5-15 years, respectively. Focal onset seizures were observed in 212 (53.6%) patients, while 293 (76.3%) patients had epileptiform interictal electroencephalogram (EEG) abnormalities. Among the 370 patients treated with anti-seizure medications, 200 (54.1%) had monotherapy. Although 189 (47.8%) patients had ADHD, only 31 received treatment for it, with the inattentive subtype being the most common. ADHD was more common in children undergoing polytherapy compared to those on monotherapy. Additionally, poor seizure control and the presence of epileptiform interictal EEG abnormalities may be associated with a higher prevalence of ADHD. CONCLUSIONS: While the prevalence of ADHD was higher in children with epilepsy than in normal children, the treatment rate was notably low. This highlights the need to give more importance to the diagnosis and treatment of ADHD in children with epilepsy.

17.
Front Neurol ; 14: 1326841, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38264090

RESUMO

Objective: Neuropsychiatric comorbidities are common among patients with mesial temporal lobe epilepsy (MTLE). One of these comorbidities, impulsivity, can significantly impact the quality of life and prognosis. However, there have been few studies of impulsivity in these patients, and the existing findings are inconsistent. The present study investigates impulsivity in MTLE patients from the perspective of inhibitory control and its underlying processes using event-related potentials (ERPs) initiated using a Go/NoGo task. Methods: A total of 25 MTLE patients and 25 age-, gender-, and education-matched healthy controls (HCs) completed an unequal visual Go/NoGo task. Different waveforms as well as behavioral measures were analyzed between Go and NoGo conditions (N2d and P3d). Impulsivity was also assessed using self -rating scales, and clinical variables that may be related to ERPs were explored. Results: Compared with HCs, MTLE patients exhibited significantly longer reaction time (RT) (p = 0.002) and lower P3d especially at the frontal electrode sites (p = 0.001). In the MTLE group, the seizure frequency (p = 0.045) and seizure types (p < 0.001) were correlated with the P3d amplitude. A self-rated impulsivity assessment revealed that MTLE patients had higher non-planning (p = 0.017) and total scores (p = 0.019) on the BIS-11 as well as higher DI (p = 0.010) and lower FI (p = 0.007) on the DII. Conclusion: The findings demonstrate that the presence of inhibitory control deficits in patients with MTLE are characterized by deficits in the late stage of inhibition control, namely the motor inhibition stage. This study improves our understanding of impulsivity in MTLE patients and suggests that ERPs may constitute a sensitive means of detecting this trait.

18.
Ann Clin Transl Neurol ; 10(8): 1407-1416, 2023 08.
Artigo em Inglês | MEDLINE | ID: mdl-37329164

RESUMO

BACKGROUND: Anti-metabotropic glutamate receptor 5 (mGluR5) encephalitis is a rare and under-recognized autoimmune encephalitis. This study is conducted to characterize its clinical and neuroimaging features. METHODS: Twenty-nine patients with anti-mGluR5 encephalitis (15 new cases identified in this study and 14 previously reported cases) were included in this study and their clinical features were characterized. Brain MRI volumetric analysis using FreeSurfer software was performed in 9 new patients and compared with 25 healthy controls at both early (≤6 months of onset) and chronic (>1 year of onset) disease stages. RESULTS: The common clinical manifestations of anti-mGluR5 encephalitis included cognitive deficits (n = 21, 72.4%), behavioral and mood disturbances (n = 20, 69%), seizures (n = 16, 55.2%), and sleep disorder (n = 13, 44.8%). Tumors were observed in 7 patients. Brain MRI T2/FLAIR signal hyperintensities were observed predominantly in mesiotemporal and subcortical regions in 75.9% patients. MRI volumetric analysis demonstrated significant amygdala enlargement in both early and chronic disease stages compared to healthy controls (P < 0.001). Twenty-six patients had complete or partial recovery, one remained stable, one died and one was lost to follow-up. CONCLUSION: Our findings demonstrated that cognitive impairment, behavioral disturbance, seizures, and sleep disorder are the prominent clinical manifestations of anti-mGluR5 encephalitis. Most patients showed a good prognosis with full recovery, even in the paraneoplastic disease variants. The amygdala enlargement in the early and chronic disease stages is a distinct MRI feature, which exploratively offer a valuable perspective for the study of the disease processes.


Assuntos
Encefalite , Transtornos do Sono-Vigília , Humanos , Imageamento por Ressonância Magnética , Neuroimagem , Encefalite/diagnóstico por imagem , Convulsões , Encéfalo/diagnóstico por imagem
19.
Quant Imaging Med Surg ; 13(9): 5701-5712, 2023 Sep 01.
Artigo em Inglês | MEDLINE | ID: mdl-37711806

RESUMO

Background: This study aimed to investigate the effects of the volume and time of hydration on the quantification of healthy tissue uptake for 2-deoxy-2-[18F]-fluoro-D-glucose (18F-FDG) total-body positron emission tomography (PET)-computed tomography (CT) with half-dose activity. Methods: This study prospectively enrolled 180 patients who underwent a total-body PET-CT scan 10 min after injection of a half-dose (1.85 MBq/kg) of 18F-FDG. These patients were placed in hydration groups (30 patients in each group) according to different hydration volumes and times: oral hydration with 500 mL of water 20 min before (G1), 5 min after (G2), and 30 min after (G3) the 18F-FDG injection; and oral hydration with 200 mL of water 20 min before (G4), 5 min after (G5), and 30 min after (G6) the 18F-FDG injection. Another 30 patients underwent dynamic imaging without hydration and were used a nonhydration group. The analysis of quantification of healthy tissue uptake included the maximum standardized uptake value (SUVmax) and the mean SUV (SUVmean) of the blood pool and muscle, as well as the SUVmax, SUVmean, and signal-to-noise ratio (SNR) of the liver. Results: The SUVmax of the blood pool (2.33±0.36), liver (3.03±0.42), and muscle (0.81±0.15) was significantly higher in the nonhydration group than in any of the 6 hydrated groups (P<0.05 for all hydration groups vs. nonhydration group). Muscle SUVmax and SUVmean were significantly (P<0.05) lower in G1 and G2 than in G3 and were lower in G4 and G5 than in G6. The SUVmax and SUVmean of the blood pool were significantly (P<0.05) lower in G1 than in G3 and G4 and lower in G3 than in G6. Conclusions: When total-body PET-CT with a half dose of 18F-FDG activity is performed, hydration can significantly affect the quantification of healthy tissue uptake. Oral administration of 500 mL of water 20 min before injection could reduce background radioactivity.

20.
Diabetes ; 72(6): 812-818, 2023 06 01.
Artigo em Inglês | MEDLINE | ID: mdl-36939643

RESUMO

Glucokinase variant-induced maturity-onset diabetes of the young (GCK-MODY) exhibits the unique clinical features of mild fasting hyperglycemia. However, formal studies of its glucose excursion pattern in daily life in comparison with those with or without other types of diabetes are lacking. We conducted a case-control study including 25 patients with GCK-MODY, 25 A1C-matched, drug-naive patients with type 2 diabetes (T2DM), and 25 age-, BMI-, and sex-matched subjects with normal glucose tolerance (NGT). All the subjects wore flash glucose monitoring (FGM) sensors for 2 weeks, and glucose readings were masked. Glucose excursion was significantly lower in the GCK-MODY than that in A1C-matched T2DM during the daytime, but was similar during the nighttime. The daytime coefficient of variation (CV) driven by postprandial glucose could separate GCK-MODY from well-controlled T2DM, but the nighttime CV could not. In discriminating between GCK-MODY and T2DM, the area under the curve of the CV was 0.875. However, in GCK-MODY and NGT subjects, the CVs were similar at 24 h, whereas the other four excursion parameters were significantly higher in GCK-MODY than those in NGT subjects. FGM confirmed the stability and mildness of hyperglycemia in GCK-MODY patients. Postprandial regulation is a key driver of the difference in excursion between GCK-MODY and T2DM.


Assuntos
Diabetes Mellitus Tipo 2 , Hiperglicemia , Humanos , Glucose , Glicemia , Automonitorização da Glicemia , Estudos de Casos e Controles , Hemoglobinas Glicadas , Glucoquinase/genética , Mutação
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA