The effect of Saccharomyces boulardii supplementation on Helicobacter pylori eradication in children: a systematic review and meta-analysis of Randomized controlled trials.

BACKGROUND: It is unclear whether Saccharomyces boulardii (S. boulardii) supplementation in standard triple therapy (STT) is effective in eradicating Helicobacter pylori (H. pylori) infection in children. We therefore conducted a meta-analysis of randomized controlled trials (RCTs) to assess the effect of S. boulardii supplementation on H. pylori eradication in children. METHODS: We conducted electronic searches in PubMed, Embase, the Cochrane Library, China National Knowledge Infrastructure and Wanfang database from the beginning up to September 2023. A random-effects model was employed to calculate the pooled relative risk (RR) with 95% confidence intervals (CI) through a meta-analysis. RESULTS: Fifteen RCTs (involving 2156 patients) were included in our meta-analysis. Results of the meta-analysis indicated that S. boulardii in combination with STT was more effective than STT alone (intention-to-treat analysis : 87.7% vs. 75.9%, RR = 1.14, 95% CI: 1.10-1.19, P < 0.00001; per-protocol analysis : 88.5% vs. 76.3%, RR = 1.15, 95% CI: 1.10-1.19, P < 0.00001). The S. boulardii supplementation group had a significantly lower incidence of total adverse events (n = 6 RCTs, 9.2% vs. 29.2%, RR = 0.32, 95% CI: 0.21-0.48, P < 0.00001), diarrhea (n = 13 RCTs, 14.7% vs. 32.4%, RR = 0.46, 95% CI: 0.37-0.56, P < 0.00001), and nausea (n = 11 RCTs, 12.7% vs. 21.3%, RR = 0.53, 95% CI: 0.40-0.72, P < 0.0001) than STT group alone. Similar results were also observed in the incidence of vomiting, constipation, abdominal pain, abdominal distention, epigastric discomfort, poor appetite and stomatitis. CONCLUSIONS: Current evidence indicated that S. boulardii supplementing with STT could improve the eradication rate of H. pylori, and concurrently decrease the incidence of total adverse events and gastrointestinal adverse events in children.

Homozygosity for a novel missense variant of RPGRIP1L causing Joubert syndrome with renal defects in a family of Chinese descent.

The retinitis pigmentosa -GTPase regulator interacting protein 1-like gene (RPGRIP1L) encodes a ciliary protein essential for basic embryonic development. Biallelic variants of RPGRIP1L; cause Joubert syndrome (JS) with renal defects. In addition to characteristic JS features (cerebellar and brain stem malformations, developmental delays, hypotonia, irregular breathing patterns, eye movement abnormalities, ataxia, and intellectual disability), affected individuals typically also exhibit renal disorders, such as cystic kidney disease and nephronophthisis. Here, we describe a 10-year-old female of Chinese descent who was referred to hospital due to lower limb arthralgia. However, the presence of short stature, facial deformities, renal abnormalities, and renal failure suggested a diagnosis of congenital syndrome disorder. Whole-exome sequencing (WES) revealed that the patient was homozygous for a previously unreported RPGRIP1L variant featuring a missense mutation (NM_015272; c.2180G>A, p.Gly727Asp). A subsequent cranial MRI confirmed the presence of midbrain molar tooth sign and cerebellar Dandy-Walker malformation. However, no significant developmental delays or neurological abnormalities were noted. This study makes a significant contribution to the literature by expanding knowledge of the JS-causing RPGRIP1L variant spectrum, enhancing understanding of RPGRIP1L variant-associated JS phenotypes.

A 55-Day-Old Female Infant Infected With 2019 Novel Coronavirus Disease: Presenting With Pneumonia, Liver Injury, and Heart Damage.

BACKGROUND: Previous studies on the pneumonia outbreak caused by the 2019 novel coronavirus disease (COVID-19) were mainly based on information from adult populations. Limited data are available for children with COVID-19, especially for infected infants. METHODS: We report a 55-day-old case with COVID-19 confirmed in China and describe the identification, diagnosis, clinical course, and treatment of the patient, including the disease progression from day 7 to day 11 of illness. RESULTS: This case highlights that children with COVID-19 can also present with multiple organ damage and rapid disease changes. CONCLUSIONS: When managing such infant patients with COVID-19, frequent and careful clinical monitoring is essential.

Novel joint catalytic properties of Fe and N co-doped graphene for CO oxidation.

Using density functional theory, we have performed detailed calculations of the joint catalytic activity of graphene co-doped with Fe and N atoms. The Fe atom can be located on single vacancy graphene and acts as the active site. Due to the strong attraction of the Fe ion, the O-O bond length of the O2 molecule is elongated, which decreases the bonding energy between the O atoms. The energy barrier of CO oxidization is 0.84 eV. When N atoms are doped into the graphene, the interactions between the Fe ions and O2 molecules are stronger, and the O-O bond lengths are elongated further, which makes the desorption of the quasi-CO2 molecule easier. The energy barriers are reduced to 0.62 eV, 0.49 eV, and 0.33 eV for graphene doped with one, two and three N atoms, respectively. The O atom remaining on the Fe ion can form a CO2 molecule with an additional CO molecule. The produced CO2 molecule can be released with a small or even zero energy barrier by adsorbing an O2 molecule. The adsorbed O2 molecule is then involved in the next reaction process, and the material can be used as a recycled catalyst.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Thymidylate synthase gene variation is associated with the risk for conotruncal heart defects in Chinese population.

Conotruncal heart defects are considered to be one of the most common types of birth defect worldwide. Genetic disturbances in folate metabolism such as Thymidylate synthase may increase risk for conotruncal heart defects. We evaluated two common Thymidylate synthase polymorphisms, including the 28 bp tandem repeat in the promoter enhancer region of the 5'-untranslated region and the 6 bp deletion in the 3'-untranslated region, as risk factors of conotruncal heart defects including various subtypes of malformations, in a total of 193 mothers with conotruncal heart defect in offspring and 234 healthy controls in the Chinese population. Logistic regression analyses revealed that mothers who were homozygotes with deletion (-/-) had a 1.8-fold (odds ratio: 1.8; 95% confidence interval: 1.0-3.0, p = 0.040) increased risk for conotruncal heart defect in offspring, respectively, when compared with mothers carrying the wild type (+/+) genotype. Consistently, individuals carrying the genotype -/- of the Thymidylate synthase 6 bp deletion also had higher plasma homocysteine levels compared to the mothers carrying the genotype +/+ in the control and conotruncal heart defect groups (p = 0.006 and p = 0.004, respectively). However, our results showed that Thymidylate synthase 28 bp tandem repeat polymorphism was not associated with risk for conotruncal heart defect and plasma homocysteine level. In conclusion, our data suggest that the maternal Thymidylate synthase 6 bp deletion polymorphism might be associated with plasma homocysteine level and risk for conotruncal heart defect in offspring.

Genetic variation in folate metabolism is associated with the risk of conotruncal heart defects in a Chinese population.

BACKGROUND: Conotruncal heart defects (CTDs) are a subgroup of congenital heart defects that are considered to be the most common type of birth defect worldwide. Genetic disturbances in folate metabolism may increase the risk of CTDs. METHODS: We evaluated five single-nucleotide polymorphisms (SNPs) in genes related to folic acid metabolism: methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), solute carrier family 19, member 1 (SLC19A1 G80A), methionine synthase (MTR A2576G), and methionine synthase reductase (MTRR A66G), as risk factors for CTDs including various types of malformation, in a total of 193 mothers with CTD-affected offspring and 234 healthy controls in a Chinese population. RESULTS: Logistic regression analyses revealed that subjects carrying the TT genotype of MTHFR C677T, the C allele of MTHFR A1298C, and the AA genotype of SLC19A1 G80A had significant 2.47-fold (TT vs. CC, OR [95% CI] = 2.47 [1.42-4.32], p = 0.009), 2.05-2.20-fold (AC vs. AA, 2.05 [1.28-3.21], p = 0.0023; CC vs AA, 2.20 [1.38-3.58], p = 0.0011), and 1.68-fold (AA vs. GG, 1.68 [1.02-2.70], p = 0.0371) increased risk of CTDs, respectively. Subjects carrying both variant genotypes of MTHFR A1298C and SLC19A1 G80A had a higher (3.23 [1.71-6.02], p = 0.0002) increased risk for CTDs. Moreover, the MTHFR C677T, MTHFR A1298C, and MTRR A66G polymorphisms were found to be significantly associated with the risk of certain subtypes of CTD. CONCLUSIONS: Our data suggest that maternal folate-related SNPs might be associated with the risk of CTDs in offspring.

Identification of two novel mutations in patients with X-linked primary immunodeficiencies.

Primary immunodeficiency diseases (PID) are a heterogeneous group of inherited disorders with defects in one or more component of the immune system. In this study, we analyzed gene mutations in four X-linked PID pedigrees, which include one X- linked agammaglobulinemia (XLA) pedigree, one X-linked chronic granulomatous disease (XCGD) pedigree, and two X-linked Hyper IgM syndrome (XHIGM) pedigrees. Sequence analysis of the BTK gene revealed a novel mutation (c.1802_1803delinsGCC, p.Phe601CysfsX3) which results in the developmental arrest of B cells in the bone marrow. Sequence analysis of the CYBB gene revealed a recurrent frameshift mutation (c.1313_1314delinsT) in exon 10, which generates a premature stop codon (p.Lys438IlefsX63). One novel frameshift mutation (c.114delG, p.Ser39GlnfsX14) and one recurrent missense mutation (c.499G>C, p.Gly167Arg) were found in the CD40LG gene and cause defective T cell functioning. In conclusion, our study identified two novel mutations on the BTK and CD40LG genes in Chinese patients and established accurate and simple genetic diagnostic methods for three X-linked PID.

[Potential role of CRELD1 gene in the pathogenesis of atrioventricular septal defect].

OBJECTIVE: To screen potential mutation of the CRELD1 gene in congenital atrioventricular septal defect (AVSD) and explore its functional implications. METHODS: Fragments encompassing the 11 coding exons of CRELD1 gene, including at least 50 bp of flanking intronic regions, were amplified with PCR and subjected to DNA sequencing. Results of sequencing were compared with predicted sequence from the GenBank database. Eukaryotic expression vector pcDNA3.1CRELD1 containing the mutational sequence was constructed. Western blotting and real-time fluorescent quantitative reverse transcription polymerase chain reaction (FQ RT-PCR) was applied to examine the expression of CRELD1, Tenascin C and Aggrecan. RESULTS: C857G was identified in a girl with an isolated partial AVSD. The mutation has resulted in a substitution of Alanine for Proline at amino acid 286 in the first cbEGF domain. Western blotting and FQ RT-PCR confirmed that the P286R missense mutation has been a gain-of-function mutation. Compared with the unloaded control, the Aggrecan mRNA expression was downregulated for both wild-type and mutant type samples (t=140.27 vs. 26.36, P < 0.01). The downregulation was more significant in mutant type (t=25.69, P=0.002). There was no significant difference of the Tenascin C expression between wild-type and the unload control (t=1.167, P> 0.05), whilst the Tenascin C expression was up-regulated in mutant type (t=6.66, P=0.022). CONCLUSION: Mutation of the CRELD1 gene may increase the risk for AVSD rather than being directly causative. The P286R mutation of CRELD1 can downregulate the expression of Aggrecan and upregulates the expression of Tenascin C protein, both of which are crucial to extracellular matrix in the formation of the atrioventricular septum. The P286R mutation of CRELD1 may be correlated to the occurrence of AVSD.

Familial congenital heart disease: data collection and preliminary analysis.

The aim of this study was to explore genetic mechanisms of congenital heart disease by analysing family data. Families with two or more affected members were studied, and information on family history and risk factors was collected. A total of 25 families with congenital heart disease were identified, and among them the condition was confirmed in 57. The prevalence of congenital heart disease in first-degree relatives was 43.0%, that is 46 out of 107, significantly higher than that in second-degree relatives, that is, 4.4%, 11 out of 252) (χ2 = 83.897, P < 0.01). The prevalence difference between twins (90%) and siblings (62.2%) (χ2 = 4.983, P < 0.05) was also significant among first-degree relatives. Eleven families were found to have the same phenotype (44%), including ventricular septal defect in six families, atrial septal defect in two families, conotruncal defects in two families, and hypoplastic left heart syndrome in one family. Both twins were diagnosed with congenital heart disease in 8 out of 10 twin families - all eight twins were monozygotic. The cardiac phenotype of the twins was consistent in three families (37.5%). The cardiac phenotype of first- and second-degree relatives was not fully consistent with their probands. There was an increased incidence of threatened abortion in early pregnancy in patients with familial congenital heart disease when compared with sporadic congenital heart disease (χ2 = 8.704, P < 0.05). Morbidity in relatives was related to blood relationship, with a closer relationship increasing the risk of congenital heart disease. Genetic factors appear to play an important role in congenital heart disease.

The intervention dilemma and high burden of children with autism in Guizhou province, Southwest China.

Background: Autism spectrum disorder (ASD) is a highly disabling neurodevelopmental disorder, and the burden is high. Data on the burden of ASD are limited in China, especially in the southwest. Therefore, the aims of this study were to investigate the intervention status and burden of children with ASD in Southwest China. Materials and methods: Families of children with ASD were recruited from hospitals, special education schools, and private rehabilitation centers; they participated in the survey and completed the questionnaire. Descriptive analysis was conducted on the questionnaire results, which included basic demographic characteristics, rehabilitation status, and burden. Multivariate analysis was used to analyze the association of basic family demographic characteristics, rehabilitation status, and costs of ASD. Results: A total of 231 families of children with ASD participated in this survey, and 78.35% (181/231) of the children with ASD were male. The mean age was 4.34 ± 2.09 years. A total of 55.84% (129/231) of the children with ASD had an intellectual disability. Only 46.32% (107/231) started receiving intervention within 1 month after diagnosis. The institutions for rehabilitation interventions for children with ASD were mainly tertiary hospitals (39.39%), special education schools (29.87%) and private rehabilitation institutions (21.64%). For a total of 42.86% (99/231) of the children with ASD, the duration of the intervention was less than 10 h per week. A total of 74.89% (173/231) of the children with ASD received a rehabilitation intervention at home. A total of 66.67% of the parents were satisfied with the treatment. The monthly cost of medical intervention for the patients of children with autism was 7,225 ± 474 RMB ($1,134 ± 74), and the non-medical intervention cost was 2,133 ± 107 RMB ($334 ± 17). The annual burden of patients with autism was 86,700 ± 5,688 RMB ($13,596 ± 892). The estimated total annual burden of ASD was 5.548 billion RMB ($870 million) in Guizhou province. Conclusion: The results revealed that rehabilitation resources are limited and that the burden of ASD is high in Guizhou province; therefore, improving the rehabilitation status and easing the burden of children with ASD is urgent in these regions.

Detecting 22q11.2 deletion in Chinese children with conotruncal heart defects and single nucleotide polymorphisms in the haploid TBX1 locus.

BACKGROUND: Conotruncal heart defects (CTDs) are present in 75-85% of patients suffering from the 22q11.2 deletion syndrome. To date, no consistent phenotype has been consistently correlated with the 22q11.2 deletions. Genetic studies have implicated TBX1 as a critical gene in the pathogenesis of the syndrome. The aim of study was to determine the incidence of the 22q11.2 deletion in Chinese patients with CTDs and the possible mechanism for pathogenesis of CTDs. METHODS: We enrolled 212 patients with CTDs and 139 unrelated healthy controls. Both karyotypic analysis and multiplex ligation-dependent probe amplification were performed for all CTDs patients. Fluorescence in situ hybridization was performed for the patients with genetic deletions and their relatives. The TBX1 gene was sequenced for all patients and healthy controls. The χ2 and Fisher's exact test were used in the statistical analysis. RESULTS: Thirteen of the 212 patients with CTDs (6.13%) were found to have the 22q11.2 deletion syndrome. Of the 13 cases, 11 presented with a hemizygous interstitial microdeletion from CLTCL1 to LZTR1; one presented with a regional deletion from CLTCL1 to DRCR8; and one presented with a regional deletion from CDC45L to LZTR1. There were eight sequence variants in the haploid TBX1 genes of the del22q11 CTDs patients. The frequency of one single nucleotide polymorphism (SNP) in the del22q11 patients was different from that of the non-del patients (P < 0.05), and the frequencies of two other SNPs were different between the non-del CTDs patients and controls (P < 0.05). CONCLUSIONS: CTDs, especially pulmonary atresia with ventricular septal defect and tetralogy of Fallot, are the most common disorders associated with the 22q11.2 deletion syndrome. Those patients with both CTDs and 22q11.2 deletion generally have a typical or atypical deletion region within the TBX1 gene. Our results indicate that TBX1 genetic variants may be associated with CTDs.

A de novo Variant of ASXL1 Is Associated With an Atypical Phenotype of Bohring-Opitz Syndrome: Case Report and Literature Review.

Bohring-Opitz syndrome (BOS) is a rare genetic disease first reported by Bohring et al. in 1999. With the recent development of exome sequencing (ES), de novo truncating mutations in the additional sex-combs-like 1 (ASXL1) gene have been causally implicated in BOS. Herein, we describe a 7-month-old girl with intrauterine growth restriction, severe pulmonary infection, seizures, and craniofacial abnormalities (microcephaly, micro/retrognathia, hypertelorism, depressed nasal bridge, low-set ears and hypertrichosis) at birth. At a later stage, the patient developed global developmental delay. We performed ES and identified a de novo heterozygous mutation in ASXL1, namely, c.1210C>T/p.R404*. However, this case did not have trigonocephaly, facial hemangioma, prominent eyes, myopia, BOS posture, or brain abnormalities (enlarged subarachnoid spaces, agenesis of the corpus callosum, moderately enlarged cerebral ventricles, or prominent frontal subarachnoid spaces), which are common characteristics in most patients with BOS-harboring ASXL1 mutations. These new data expand the phenotype of BOS driven by ASXL1 and may assist in more accurately delineating the phenotypes caused by variants of this gene.

Rh-CXCL-12 Attenuates Neuronal Pyroptosis after Subarachnoid Hemorrhage in Rats via Regulating the CXCR4/NLRP1 Pathway.

Subarachnoid hemorrhage (SAH) is a cerebrovascular disease associated with high morbidity and mortality. CXCR4 provides neuroprotective effects, which can alleviate brain injury and inflammation induced by stroke. Previous studies have suggested that CXCR4 reduces the pyroptosis of LPS-stimulated BV2 cells. The purpose of this study was to evaluate the antipyroptosis effects and mechanisms of CXCR4 after SAH. SAH animal model was induced via endovascular perforation. A total of 136 male Sprague-Dawley rats were used. Recombinant human cysteine-X-cysteine chemokine ligand 12 (rh-CXCL-12) was administered intranasally at 1 h after SAH induction. To investigate the underlying mechanism, the inhibitor of CXCR4, AMD3100, was administered intraperitoneally at 1 h before SAH. The neurobehavior tests were assessed, followed by performing Western blot and immunofluorescence staining. The Western blot results suggested that the expressions of endogenous CXCL-12, CXCR4, and NLRP1 were increased and peaked at 24 h following SAH. Immunofluorescence staining showed that CXCR4 was expressed on neurons, microglia, and astrocytes. Rh-CXCL-12 treatment improved the neurological deficits and reduced the number of FJC-positive cells, IL-18-positive neurons, and cleaved caspase-1(CC-1)-positive neurons after SAH. Meanwhile, rh-CXCL-12 treatment increased the levels of CXCL-12 and CXCR4, and reduced the levels of NLRP1, IL-18, IL-1ß, and CC-1. Moreover, the administration of AMD3100 abolished antipyroptosis effects of CXCL-12 and its regulation of CXCR4 post-SAH. The CXCR4/NLRP1 signaling pathway may be involved in CXCL-12-mediated neuronal pyroptosis after SAH. Early administration of CXCL-12 may be a preventive and therapeutic strategy against brain injury after SAH.

Further delineation of autosomal recessive intellectual disability syndrome caused by homozygous variant of the NSUN2 gene in a chinese pedigree.

BACKGROUND: The enzyme NOP2/Sun RNA methyltransferase 2 (NSUN2) catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of tRNA(Leu; CAA) precursors containing introns that play a vital role in spindle assembly during mitosis and chromosome segregation. Biallelic variants in the NSUN2 gene cause a rare intellectual disability that has been identified only in a few Middle Eastern patients. Affected individuals usually have other deformities, including developmental delay, short stature, microcephaly, and facial dysmorphism. The aim of this study was to identify the genetic cause of three female patients from a Chinese pedigree, who presented with similar phenotype consisting of the above clinical features. METHODS: Whole-exome sequencing (WES) was used to screen for causal variants in the genome, and the candidate variants were subsequently verified using Sanger sequencing. RESULTS: WES revealed a previously unreported homozygous nonsense variant (NM_017755.5: c.1004T>A, p.Leu335*) in exon 9 of NSUN2, which was consistent with the clinical phenotype of the patients and co-segregated with the disease in their family. A comparison of this phenotype with that of patients in published reports uncovered several novel clinical features related to NSUN2 variations, including feeding difficulties, slender hands and fingers, severely restricted finger mobility, hallux valgus, varus foot, and elevated α-hydroxybutyrate dehydrogenase (HBDH). CONCLUSIONS: These are the first findings of a non-consanguineous Chinese pedigree with a homozygous NSUN2 variant. We expanded the phenotypic spectrum associated with NSUN2 variations.

[Antibiotic susceptibility of pathogenic bacteria isolated from 893 children with lower respiratory infection in Guiyang].

OBJECTIVE: To investigate the distribution and the antibiotic susceptibility of pathogenic bacteria in children from Guiyang with lower respiratory infection (LRI). METHODS: The nasopharyngeal aspirate samples were obtained from 893 hospitalized children with LRI between August 2006 and June 2008. An antibiotic susceptibility test was performed using the VITEK system and the Kirby-Bauer diffuse method after bacteria were identified. RESULTS: Five hundred and forty-three patients (60.8%) were bacteria-positive. A total of 598 strains (30 kinds of bacteria) were obtained from the sputum samples. Of them, 533 strains (89.1%) were gram-negative and 57 were gram-positive (9.8%). Escherichia coli (E. coli) and Kleb-siella pneumoniae (K. pneumoniae) were common in gram-negative strains. They were susceptive to piperacillin/tazobactam, amikacin, ciprofloxacin, and levofloxacin, especially to imipenem. Streptococcus pneumoniae (S. pneumoniae) and Stapthylococcus aureus (S. aureus) were common in gram-positive strains. S. pneumoniae was susceptive to penicillin and cefazolin sodium, but S. aureus was resistant. Both were high susceptive to vancomycin, and resistant to roxithromycin. CONCLUSIONS: Gram-negative bacteria are the main pathogens in children from Guiyang with LRI, and E. coli and K. pneumoniae are common. The antibiotic susceptibility of pathogenic bacteria varies with different strains of bacteria. A reasonable selection of antibiotics should be based on the antibiotic susceptibility test.

Ambient Air Pollution and Daily Hospital Admissions for Respiratory Disease in Children in Guiyang, China.

Objectives: To investigate the association between ambient air pollutant exposure and daily hospital admissions for respiratory diseases in children in Guiyang. Methods: Clinical data of pediatric inpatients with respiratory disease from 2009 to 2016 in Guizhou Provincial People's Hospital and PM2.5, NO2, PM10, and SO2 concentration data were retrieved. A canonical correlation analysis (CCA) was applied to analyse the association between air pollutants and daily hospital admissions for respiratory diseases. A reproducibility analysis was applied to analyse the association between air pollution and the duration and direct cost of hospitalization. The support vector regression (SVR) method was applied to determine whether air pollution data could predict the daily hospital admissions for the upcoming day. Results: A total of 10,876 inpatients with respiratory diseases were included between January 1, 2009 and December 31, 2016. The CCA showed significant correlations between air pollution and daily hospital admissions (r = 0.3564, p < 0.001), the duration of hospitalization (r = 0.2911, p < 0.001) and the economic cost of hospitalization (r = 0.2933, p < 0.001) for respiratory disease. PM10 contributed most to daily hospital admissions for respiratory disease; the concentration the day before hospitalization contributed most to the daily hospital admissions for respiratory disease. There was a slightly stronger correlation between air pollution and respiratory disease in children aged 2-18 years (R = 0.36 vs. R = 0.31 in those under 2 years old). No significant difference was found between male and female patients. The prediction analysis showed that air pollution could successfully predict daily pediatric inpatient hospital admissions (R = 0.378, permutation p < 0.001). Conclusions: Air pollution was significantly associated with hospital admissions, hospitalization duration and the economic cost of hospitalization in children with respiratory diseases. The maximum effect occurred on the day before hospitalization. The effect of PM10 on daily pediatric inpatient hospital admissions for respiratory disease was the greatest among the pollutants evaluated.

Novel TRAPPC11 Mutations in a Chinese Pedigree of Limb Girdle Muscular Dystrophy.

Limb girdle muscular dystrophies (LGMDs) are a heterogeneous group of genetic myopathies leading primarily to proximal muscle weakness. It is caused by mutations at over 50 known genetic loci typically from mutations in genes encoding constituents of the sarcolemmal dystrophin complex or related functions. Herein we describe the case of two siblings with LGMD that were investigated using whole-exome sequencing followed by Sanger sequencing validation of a specific double-mutation in the TRAPPC11 gene. Further, from parental sequencing we determined the mode of transmission, a double heterozygous mutation at the maternal and paternal alleles. The two mutations detected have not been described in other patients.

Therapeutic inhibition of CXC chemokine receptor 2 by SB225002 attenuates LPS-induced acute lung injury in mice.

INTRODUCTION: Sustained neutrophilic infiltration is known to contribute to organ damage, such as acute lung injury (ALI). CXC chemokine receptor 2 (CXCR2) is the major receptor regulating inflammatory neutrophil recruitment in acute and chronic inflamed tissues. The purpose of this study was to investigate the functional relevance of the CXCR2 inhibitor SB225002 in LPS-induced acute lung injury. MATERIAL AND METHODS: Male C57BL/6 mice were randomly divided into the following four experimental groups (n = 10 per group): untreated group (control group, Ctr); LPS-treated ALI group (LPS group, LPS); LPS + PBS-treated group (LPS + PBS); and SB225002-treated ALI group (LPS + SB225002). Twenty-four hours after treatment, the blood, bronchoalveolar lavage fluid (BALF), and lung tissue were collected and wet/dry ratio, protein concentration, myeloperoxidase (MPO) activity, neutrophil infiltration, and inflammatory cytokine secretion in lung tissue were measured. The pathologic changes in the lungs were examined using optical microscopy. Survival rates were recorded at 120 h in all four groups, in other experiments. RESULTS: Histology findings revealed that the SB225002-treated group had significantly milder lung injury compared to the LPS-induced ALI and the PBS-treated control groups. Treatment with SB225002 significantly attenuated LPS-induced lung injury and suppressed the inflammatory responses in damaged lung tissue. Compared to the PBS-treated control group, treatment with SB225002 dramatically decreased the lung wet/dry ratio, protein concentration, and infiltration of neutrophils in lung tissue. Therefore, SB225002 treatment appeared to inhibit the production of inflammatory cytokines and increase survival time compared to the PBS-treated control group. CONCLUSIONS: Together, these data demonstrated that inhibition of CXCR2 signaling by SB225002 could ameliorate LPS-induced acute lung injury, by reducing neutrophil recruitment and vascular permeability. SB225002 may be further developed as a potential novel treatment for LPS-induced ALI.