RESUMO
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
Assuntos
Linfócitos B/imunologia , Proteínas de Ligação a DNA/metabolismo , Cadeias mu de Imunoglobulina/genética , Ativação Linfocitária , Animais , Sequência de Bases , Células Cultivadas , Sulfato de Dextrana , Dextranos , Lipopolissacarídeos , Metilação , Camundongos , Camundongos Endogâmicos BALB C , Mitógenos , Dados de Sequência Molecular , Sondas de Oligonucleotídeos , Baço/imunologiaRESUMO
NF-kappa B has been demonstrated to play critical roles in multiple aspects of immune responses including Ig H chain isotype switching. To better define the specific roles the p50 subunit of NF-kappa B plays in mu-->gamma 3 switch recombination (SR), we systematically evaluated p50-deficient B cells for activities that are strongly correlated with SR. B cell activation with LPS plus anti-IgD-dextran plus IL-5 plus IL-4 plus TGF-beta produced normal levels of proliferation and gamma3 germline transcripts in p50-deficient B cells, but mu-->gamma 3 SR was impaired. In vitro binding studies previously showed that NF-kappa B p50 homodimer binds the switch nuclear B-site protein (SNIP) of the S gamma 3 tandem repeat. Ligation-mediated PCR in vivo footprint analysis demonstrates that the region spanning the SNIP and switch nuclear A-site protein (SNAP) binding sites of the S gamma 3 region are contacted by protein in normal resting splenic B cells. B cells that are homozygous for the targeted disruption of the gene encoding p50 (-/-) show strong aberrant footprints, whereas heterozygous cells (+/-) reveal a partial effect in S gamma 3 DNA. These studies provide evidence of nucleoprotein interactions at switch DNA in vivo and suggest a direct interaction of p50 with S gamma 3 DNA that is strongly correlated with SR competence.
Assuntos
Pegada de DNA , Switching de Imunoglobulina/genética , Região de Troca de Imunoglobulinas/genética , Cadeias gama de Imunoglobulina/genética , Cadeias mu de Imunoglobulina/genética , NF-kappa B/fisiologia , Recombinação Genética/imunologia , Animais , Subpopulações de Linfócitos B/citologia , Subpopulações de Linfócitos B/imunologia , Subpopulações de Linfócitos B/metabolismo , Sequência de Bases , Sítios de Ligação/genética , Sítios de Ligação/imunologia , Células Cultivadas , Pegada de DNA/métodos , Proteínas de Ligação a DNA/metabolismo , Regulação para Baixo/genética , Regulação para Baixo/imunologia , Células Germinativas/imunologia , Cadeias gama de Imunoglobulina/biossíntese , Cadeias gama de Imunoglobulina/metabolismo , Cadeias mu de Imunoglobulina/metabolismo , Interfase/imunologia , Ativação Linfocitária/genética , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Knockout , Camundongos Nus , Dados de Sequência Molecular , NF-kappa B/deficiência , NF-kappa B/genética , Subunidade p50 de NF-kappa B , Nucleoproteínas/metabolismo , Transcrição Gênica/imunologiaRESUMO
The looping-out and deletion model of switch recombination suggests that double strand breaks (DSBs) may occur in switch regions and participate in the recombination transaction. A DSB assay based on the ligation-mediated PCR method has been devised for the Sgamma3 region. Mitogen-inducible DSBs have been detected in Sgamma3 DNA of normal splenic B cells but not in splenic T cells or thymocytes. The breaks are restricted to the Sgamma3 region and are sequence specific. Examination of the sequence surrounding the DSBs has led to the derivation of a consensus sequence for DSB formation. Induction of Sgamma3-specific DSBs is correlated with the onset of switch recombination. The DSBs flank clusters of Sgamma3 recombination breakpoints, suggesting that processing of the broken ends may occur during the recombination reaction.