Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 250
Filtrar
Mais filtros

País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Environ Res ; 258: 119248, 2024 Oct 01.
Artigo em Inglês | MEDLINE | ID: mdl-38823615

RESUMO

To ensure the structural integrity of concrete and prevent unanticipated fracturing, real-time monitoring of early-age concrete's strength development is essential, mainly through advanced techniques such as nano-enhanced sensors. The piezoelectric-based electro-mechanical impedance (EMI) method with nano-enhanced sensors is emerging as a practical solution for such monitoring requirements. This study presents a strength estimation method based on Non-Destructive Testing (NDT) Techniques and Long Short-Term Memory (LSTM) and artificial neural networks (ANNs) as hybrid (NDT-LSTMs-ANN), including several types of concrete strength-related agents. Input data includes water-to-cement rate, temperature, curing time, and maturity based on interior temperature, allowing experimentally monitoring the development of concrete strength from the early steps of hydration and casting to the last stages of hardening 28 days after the casting. The study investigated the impact of various factors on concrete strength development, utilizing a cutting-edge approach that combines traditional models with nano-enhanced piezoelectric sensors and NDT-LSTMs-ANN enhanced with nanotechnology. The results demonstrate that the hybrid provides highly accurate concrete strength estimation for construction safety and efficiency. Adopting the piezoelectric-based EMI technique with these advanced sensors offers a viable and effective monitoring solution, presenting a significant leap forward for the construction industry's structural health monitoring practices.


Assuntos
Materiais de Construção , Impedância Elétrica , Aprendizado de Máquina , Redes Neurais de Computação , Materiais de Construção/análise , Nanotecnologia/instrumentação , Nanotecnologia/métodos , Teste de Materiais/métodos
2.
BMC Public Health ; 24(1): 1202, 2024 Apr 30.
Artigo em Inglês | MEDLINE | ID: mdl-38689223

RESUMO

BACKGROUND: Adherence to antiparkinsonian drugs (APDs) is critical for patients with Parkinson's disease (PD), for which medication is the main therapeutic strategy. Previous studies have focused on specific disorders in a single system when assessing clinical factors affecting adherence to PD treatment, and no international comparative data are available on the medical costs for Chinese patients with PD. The present study aimed to evaluate medication adherence and its associated factors among Chinese patients with PD using a systematic approach and to explore the impact of adequate medication adherence on direct medical costs. METHODS: A retrospective analysis was conducted using the electronic medical records of patients with PD from a medical center in China. Patients with a minimum of two APD prescriptions from January 1, 2016 to August 15, 2018 were included. Medication possession ratio (MPR) and proportion of days covered were used to measure APD adherence. Multiple linear regression analysis was used to identify factors affecting APD adherence. Gamma regression analysis was used to explore the impact of APD adherence on direct medical costs. RESULTS: In total, 1,712 patients were included in the study, and the mean MPR was 0.68 (± 0.25). Increased number of APDs and all medications, and higher daily levodopa-equivalent doses resulted in higher MPR (mean difference [MD] = 0.04 [0.03-0.05]; MD = 0.02 [0.01-0.03]; MD = 0.03 [0.01-0.04], respectively); combined digestive system diseases, epilepsy, or older age resulted in lower MPR (MD = -0.06 [-0.09 to -0.03]; MD = -0.07 [-0.14 to -0.01]; MD = -0.02 [-0.03 to -0.01], respectively). Higher APD adherence resulted in higher direct medical costs, including APD and other outpatient costs. For a 0.3 increase in MPR, the two costs increased by $34.42 ($25.43-$43.41) and $14.63 ($4.86-$24.39) per year, respectively. CONCLUSIONS: APD adherence rate among Chinese patients with PD was moderate and related primarily to age, comorbidities, and healthcare costs. The factors should be considered when prescribing APDs.


Assuntos
Antiparkinsonianos , Registros Eletrônicos de Saúde , Adesão à Medicação , Doença de Parkinson , Humanos , Doença de Parkinson/tratamento farmacológico , Doença de Parkinson/economia , Adesão à Medicação/estatística & dados numéricos , Masculino , Feminino , Estudos Retrospectivos , Pessoa de Meia-Idade , Idoso , Registros Eletrônicos de Saúde/estatística & dados numéricos , China , Antiparkinsonianos/uso terapêutico , Antiparkinsonianos/economia , Custos de Cuidados de Saúde/estatística & dados numéricos
3.
J Pediatr Nurs ; 78: e424-e431, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-39147636

RESUMO

PURPOSE: Effective nurse-child communication is a fundamental aspect of delivering pediatric nursing care. Family caregivers' global ratings to hospital are considered a proxy-reported measure for assessing a child's inpatient stay experience. We investigate the associations between nurse-child communication and family caregivers' global ratings to hospital. DESIGN AND METHODS: A retrospective analysis of a national child patient experience survey data was conducted. Patient experience with nurse-child communication and the family caregivers' global ratings of hospital were measured using the Child Hospital Consumer Assessment of Healthcare Providers and Systems. Hierarchical linear models were constructed to examine the association between nurse-child communication measures and family caregivers' global ratings to hospital. RESULTS: Data from 1010 patients at six National Regional Centers for Pediatric in China were collected. The overall rating of hospitals and the willingness to recommend the hospital showed increasing trends as the nurse-child communication score increased. How often nurses encourage children to ask questions was significantly associated with family caregivers' overall ratings of hospital and the family caregivers' willingness to recommend the hospital. CONCLUSIONS: Effective communication by nurses with the child is associated with significantly higher global ratings to the hospital by family caregivers during inpatient care. Encouraging children to ask questions is a promising contributor to caregivers' global ratings to hospital. PRACTICE IMPLICATIONS: Pediatric nurses should emphasis encouraging children to ask questions for effective communication in nursing practice. Future research is also needed to develop more targeted strategies to assist pediatric nurse to communicate with child better.


Assuntos
Cuidadores , Humanos , Estudos Retrospectivos , Masculino , Feminino , China , Criança , Cuidadores/psicologia , Relações Enfermeiro-Paciente , Enfermagem Pediátrica , Comunicação , Relações Profissional-Família , Pré-Escolar , Hospitais Pediátricos , Satisfação do Paciente , Adulto
4.
Beilstein J Org Chem ; 20: 661-671, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38590540

RESUMO

Herein, we report a visible-light-mediated palladium-catalyzed three-component radical-polar crossover carboamination of 1,3-dienes or allenes with diazo esters and amines, affording unsaturated γ- and ε-amino acid derivatives with diverse structures. In this methodology, the diazo compound readily transforms into a hybrid α-ester alkylpalladium radical with the release of dinitrogen. The radical intermediate selectively adds to the double bond of a 1,3-diene or allene, followed by the allylpalladium radical-polar crossover path and selective allylic substitution with the amine substrate, thereby leading to a single unsaturated γ- or ε-amino acid derivative. This approach proceeds under mild and simple reaction conditions and shows high functional group tolerance, especially in the incorporation of various bioactive molecules. The studies on scale-up reactions and diverse derivatizations highlight the practical utility of this multicomponent reaction protocol.

5.
BMC Plant Biol ; 23(1): 215, 2023 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-37098482

RESUMO

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.


Assuntos
Melatonina , Tobamovirus , Reguladores de Crescimento de Plantas , Cisteína , Melatonina/farmacologia , Tobamovirus/genética , Nicotiana/genética , Doenças das Plantas/genética
6.
Arch Biochem Biophys ; 744: 109699, 2023 08.
Artigo em Inglês | MEDLINE | ID: mdl-37499994

RESUMO

Hepatocellular carcinoma (HCC), which is a primary liver cancer subtype, has a poor prognosis due to its high degree of malignancy. The lack of early diagnosis makes systemic therapy the only hope for HCC patients with advanced disease; however, resistance to drugs is a major obstacle. In recent years, targeted molecular therapy has gained popularity as a potential treatment for HCC. An increase in reactive oxygen species (ROS), which are cancer markers and a potential target for HCC therapy, can both promote and inhibit the disease. At present, many studies have examined targeted regulation of ROS in the treatment of HCC. Here, we reviewed the latest drugs that are still in the experimental stage, including nanocarrier drugs, exosome drugs, antibody drugs, aptamer drugs and polysaccharide drugs, to provide new hope for the clinical treatment of HCC patients.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Humanos , Carcinoma Hepatocelular/tratamento farmacológico , Carcinoma Hepatocelular/patologia , Neoplasias Hepáticas/tratamento farmacológico , Neoplasias Hepáticas/patologia , Espécies Reativas de Oxigênio
7.
Inorg Chem ; 62(14): 5863-5871, 2023 Apr 10.
Artigo em Inglês | MEDLINE | ID: mdl-36976914

RESUMO

It is difficult to subject simple reaction starting materials to a "one-pot" in situ tandem reaction without post-treatment under mild reaction conditions to obtain multimers with complex structural linkages. In organic synthesis, acetal reactions are often used to protect derivatives containing carbonyl functional groups. Therefore, acetal products tend to have very low stability, and performing multi-step condensation to obtain complex multimeric products is difficult. Herein, we achieved the first efficient multiple condensation of o-vanillin derivatives using Dy(OAc)3·6H2O undergoing a "one-pot" in situ tandem reaction under mild solvothermal conditions to obtain a series of dimers (I and II, clusters 1 and 2) and trimers (I and II, clusters 3 and 4). When methanol or ethanol is used as the solvent, the alcoholic solvent participates in acetal and dehydration reactions to obtain dimers (I and II). Surprisingly, when using acetonitrile as the reaction solvent, the o-vanillin derivatives undergo acetal and dehydration reactions to obtain trimers (I and II). In addition, clusters 1-4 all showed distinct single-molecule magnetic behaviors under zero-field conditions. To the best of our knowledge, this is the first time that multiple acetal reactions catalyzed by coordination-directed catalysis under "one-pot" conditions have been realized, opening a new horizon for the development of fast, facile, green, and efficient synthetic methods for complex compounds.

8.
J Chem Inf Model ; 63(15): 4948-4959, 2023 08 14.
Artigo em Inglês | MEDLINE | ID: mdl-37486750

RESUMO

Traditional Chinese medicine (TCM) not only maintains the health of Asian people but also provides a great resource of active natural products for modern drug development. Herein, we developed a Database of Constituents Absorbed into the Blood and Metabolites of TCM (DCABM-TCM), the first database systematically collecting blood constituents of TCM prescriptions and herbs, including prototypes and metabolites experimentally detected in the blood, together with the corresponding detailed detection conditions through manual literature mining. The DCABM-TCM has collected 1816 blood constituents with chemical structures of 192 prescriptions and 194 herbs and integrated their related annotations, including physicochemical, absorption, distribution, metabolism, excretion, and toxicity properties, and associated targets, pathways, and diseases. Furthermore, the DCABM-TCM supported two blood constituent-based analysis functions, the network pharmacology analysis for TCM molecular mechanism elucidation, and the target/pathway/disease-based screening of candidate blood constituents, herbs, or prescriptions for TCM-based drug discovery. The DCABM-TCM is freely accessible at http://bionet.ncpsb.org.cn/dcabm-tcm/. The DCABM-TCM will contribute to the elucidation of effective constituents and molecular mechanism of TCMs and the discovery of TCM-derived drug-like compounds that are both bioactive and bioavailable.


Assuntos
Medicamentos de Ervas Chinesas , Medicina Tradicional Chinesa , Humanos , Medicamentos de Ervas Chinesas/farmacologia , Medicamentos de Ervas Chinesas/química , Bases de Dados Factuais
9.
Neurol Sci ; 44(6): 2003-2015, 2023 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-36689009

RESUMO

BACKGROUND: Essential tremor (ET) is an autosomal dominant inheritance disorder. Mutations in fusion sarcoma (FUS), mitochondrial serine peptidase 2 (HTRA2), teneurin transmembrane protein 4 (TENM4), sortilin1 (SORT1), SCN11A, and notch2N-terminal-like (NOTCH2NLC) genes are associated with familial ET. METHODS: A proband with ET was tested using whole-exome sequencing and repeat-primed polymerase chain reaction. Subsequently, the family members were screened for the suspected mutation, and the results were verified using Sanger sequencing. The relationship between pedigree and phenotype was also analyzed, and structural and functional changes in the variants were predicted using bioinformatics analysis. RESULTS: In a family with ET, the proband (III4) and the proband's father (II1), grandfather (I1), uncle (II2), and cousin (III5) all presented with involuntary tremors of both upper limbs. The responsible mutation was identified as TENM4 c.1262C > T (p.P421L), which showed genetic co-segregation in the family survey. AlphaFold predicted a change in the spatial position of TENM4 after the P421L mutation, which may have affected its stability. AlphaFold also predicted P421L to be a deleterious variation, which would lead to lower degrees of freedom of the TENM4 protein, thereby affecting the protein's structure and stability. According to the bioinformatics analysis, TENM4 (p.P421L) may reduce the signal reaching the nucleus by affecting the expression of TENM4 messenger RNA (mRNA), thereby impairing the normal oligodendrocyte differentiation process and leading to impaired myelination. CONCLUSION: This study revealed that the TENM4 (p.P421L) pathogenic missense variation was responsible for ET in the proband.


Assuntos
Tremor Essencial , Humanos , China , Tremor Essencial/genética , Sequenciamento do Exoma , Mutação/genética , Linhagem
10.
BMC Med Imaging ; 23(1): 159, 2023 10 16.
Artigo em Inglês | MEDLINE | ID: mdl-37845636

RESUMO

BACKGROUND: There is a paucity of research investigating the application of machine learning techniques for distinguishing between lipid-poor adrenal adenoma (LPA) and subclinical pheochromocytoma (sPHEO) based on radiomic features extracted from non-contrast and dynamic contrast-enhanced computed tomography (CT) scans of the abdomen. METHODS: We conducted a retrospective analysis of multiphase spiral CT scans, including non-contrast, arterial, venous, and delayed phases, as well as thin- and thick-thickness images from 134 patients with surgically and pathologically confirmed. A total of 52 patients with LPA and 44 patients with sPHEO were randomly assigned to training/testing sets in a 7:3 ratio. Additionally, a validation set was comprised of 22 LPA cases and 16 sPHEO cases from two other hospitals. We used 3D Slicer and PyRadiomics to segment tumors and extract radiomic features, respectively. We then applied T-test and least absolute shrinkage and selection operator (LASSO) to select features. Six binary classifiers, including K-nearest neighbor (KNN), logistic regression (LR), decision tree (DT), random forest (RF), support vector machine (SVM), and multi-layer perceptron (MLP), were employed to differentiate LPA from sPHEO. Receiver operating characteristic (ROC) curves and area under the curve (AUC) values were compared using DeLong's method. RESULTS: All six classifiers showed good diagnostic performance for each phase and slice thickness, as well as for the entire CT data, with AUC values ranging from 0.706 to 1. Non-contrast CT densities of LPA were significantly lower than those of sPHEO (P < 0.001). However, using the optimal threshold for non-contrast CT density, sensitivity was only 0.743, specificity 0.744, and AUC 0.828. Delayed phase CT density yielded a sensitivity of 0.971, specificity of 0.641, and AUC of 0.814. In radiomics, AUC values for the testing set using non-contrast CT images were: KNN 0.919, LR 0.979, DT 0.835, RF 0.967, SVM 0.979, and MLP 0.981. In the validation set, AUC values were: KNN 0.891, LR 0.974, DT 0.891, RF 0.964, SVM 0.949, and MLP 0.979. CONCLUSIONS: The machine learning model based on CT radiomics can accurately differentiate LPA from sPHEO, even using non-contrast CT data alone, making contrast-enhanced CT unnecessary for diagnosing LPA and sPHEO.


Assuntos
Adenoma , Neoplasias das Glândulas Suprarrenais , Feocromocitoma , Humanos , Adenoma/diagnóstico por imagem , Neoplasias das Glândulas Suprarrenais/diagnóstico por imagem , Lipídeos , Aprendizado de Máquina , Feocromocitoma/diagnóstico por imagem , Estudos Retrospectivos , Tomografia Computadorizada por Raios X
11.
Ergonomics ; : 1-8, 2023 Dec 04.
Artigo em Inglês | MEDLINE | ID: mdl-38044671

RESUMO

Lower limb body shape is important in the design of functional pants. The skin, muscles, and body shapes of the lower limbs of wheelchair users may differ from healthy people because of the different shapes of their legs and the prolonged seating position. This study aimed to classify the shapes of the lower limbs of adult female wheelchair users. The lower body measurement of 384 female wheelchair users was obtained. The principal component analysis and two-step cluster analysis were used to categorise the body shapes into three different types and five different size standards. Based on the study findings, female wheelchairs have larger waist, belly, and hip circumferences than healthy individuals, with 89.3% of them having prominent hips. Therefore, the design and production of trousers for wheelchair users should take into consideration the classification of lower limb shapes and sizes reported in this study.Practitioner summary: This work initiated the investigation of human body size assessment of clothes for handicapped persons in China, allowing paraplegic female wheelchair users to wear adapted trousers.

12.
Matern Child Nutr ; 19(4): e13542, 2023 10.
Artigo em Inglês | MEDLINE | ID: mdl-37376961

RESUMO

To explore the effects of UNICEF-suggested modifiable factors, that is, water, sanitation and hygiene (WASH), early adequate feeding and health care on child malnutrition, and to examine the extent to which each factor contributes to urban-rural disparities of child malnutrition in China. Pooling two waves of regionally representative survey data from Jilin, China, in 2013 and 2018, we report on urban-rural relative risks (RRs) in the prevalence of child stunting, wasting and overweight. We employ Poisson regression to examine the effects of urban-rural setting and the three modifiable factors on the prevalence of each malnutrition outcome, that is, stunting, wasting and overweight. We perform mediation analyses to estimate the extent to which each modifiable factor could explain the urban-rural disparities in each malnutrition outcome. The prevalence of stunting, wasting and overweight were 10.9%, 6.3% and 24.7% in urban, and 27.9%, 8.2% and 35.9% in rural Jilin, respectively. The rural to urban crude RR was 2.55 (95% confidence interval [CI]: 1.92-3.39) for stunting, while the corresponding RRs for wasting and overweight were 1.31 (95% CI: 0.84-2.03) and 1.45 (95% CI: 1.20-1.76), respectively. The rural to urban RR for stunting reduced to 2.01 (95% CI: 1.44-2.79) after adjusting for WASH. The mediation analyses show that WASH could mediate 23.96% (95% CI: 4.34-43.58%) of the urban-rural disparities for stunting, while early adequate feeding and health care had no effects. To close the persistent urban-rural gap in child malnutrition, the specific context of rural China suggests that a multi-sectoral approach is warranted that focuses on the sanitation environment and other wider social determinants of health.


Assuntos
Transtornos da Nutrição Infantil , Desnutrição , Criança , Humanos , Lactente , Saneamento , Transtornos da Nutrição Infantil/epidemiologia , Água , Sobrepeso/epidemiologia , Desnutrição/epidemiologia , Transtornos do Crescimento/epidemiologia , Higiene , China/epidemiologia , Acessibilidade aos Serviços de Saúde
13.
Am J Pathol ; 191(11): 1932-1945, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-33711310

RESUMO

Age-related cerebral small-vessel disease (CSVD) is a major cause of stroke and dementia. Despite a widespread acceptance of small-vessel arteriopathy, lacunar infarction, diffuse white matter injury, and cognitive impairment as four cardinal features of CSVD, a unifying pathologic mechanism of CSVD remains elusive. Herein, we introduce partial endothelial nitric oxide synthase (eNOS)-deficient mice as a model of age-dependent, spontaneous CSVD. These mice developed cerebral hypoperfusion and blood-brain barrier leakage at a young age, which progressively worsened with advanced age. Their brains exhibited elevated oxidative stress, astrogliosis, cerebral amyloid angiopathy, microbleeds, microinfarction, and white matter pathology. Partial eNOS-deficient mice developed gait disturbances at middle age, and hippocampus-dependent memory deficits at older ages. These mice also showed enhanced expression of bone morphogenetic protein 4 (BMP4) in brain pericytes before myelin loss and white matter pathology. Because BMP4 signaling not only promotes astrogliogenesis but also blocks oligodendrocyte differentiation, we posit that paracrine actions of BMP4, localized within the neurovascular unit, promote white matter disorganization and neurodegeneration. These observations point to BMP4 signaling pathway in the aging brain vasculature as a potential therapeutic target. Finally, because studies in partial eNOS-deficient mice corroborated recent clinical evidence that blood-brain barrier disruption is a primary cause of white matter pathology, the mechanism of impaired nitric oxide signaling-mediated CSVD warrants further investigation.


Assuntos
Proteína Morfogenética Óssea 4/metabolismo , Doenças de Pequenos Vasos Cerebrais/metabolismo , Doenças de Pequenos Vasos Cerebrais/fisiopatologia , Modelos Animais de Doenças , Óxido Nítrico Sintase Tipo III/deficiência , Animais , Doenças de Pequenos Vasos Cerebrais/patologia , Camundongos
14.
Inorg Chem ; 61(49): 20169-20176, 2022 Dec 12.
Artigo em Inglês | MEDLINE | ID: mdl-36445983

RESUMO

Widespread concern has been raised over the synthesis of highly nucleated lanthanide clusters with special shapes and/or specific linkages. Construction of lanthanide clusters with specific shapes and/or linkages can be achieved by carefully regulating the hydrolysis of lanthanide metal ions and the resulting hydrolysis products. However, studies on the manipulation of lanthanide-ion hydrolysis to obtain giant lanthanide-oxo clusters have been few. In this study, we obtained a tetraicosa lanthanide cluster (3) by manipulating the hydrolysis of Dy(III) ions using an anion (OAc-). As far as we know, cluster 3 has the highest nucleation among all lanthanide-oxo clusters reported. In 3, two triangular Dy3O4 are oriented in opposite directions to form the central connecting axis Dy6(OH)8, which is in turn connected to six Dy3O4 that are oriented in different directions. Meanwhile, a sample of a chiral trinuclear dysprosium cluster (1) was obtained in a mixed CH3OH and CH3CN solvent and by replacing the anion in the reaction to Cl- ions. In this cluster, 1,3,4-thiadiazole-2,5-diamine (L2) is free on one side through π···π interactions and is parallel to the o-vanillin (L1)- ligand, thus resulting in a triangular arrangement. The arrangement of L2 affects the end group coordination in the cluster 1 structure through hydrogen bonding and induces the cluster to exhibit chirality. When the reaction solvent was changed to CH3OH, a sample of cluster 2, composed of two independent triangular Dy3 that have different end group arrangements, was obtained. Magnetic analysis showed that clusters 1 and 3 both exhibit distinctive single-molecule magnetic properties under zero-magnetic-field conditions. This study thus provides a method for the creation of chiral high-nucleation clusters from achiral ligands and potentially paves the way for the synthesis of high-nucleation lanthanide clusters with unique forms.


Assuntos
Elementos da Série dos Lantanídeos , Elementos da Série dos Lantanídeos/química , Ânions , Ligantes , Hidrólise , Íons
15.
Inorg Chem ; 61(50): 20513-20523, 2022 Dec 19.
Artigo em Inglês | MEDLINE | ID: mdl-36475643

RESUMO

By changing the coordination anions (OAc- and Cl-), reaction temperature, solvent, and ligand substituents, four Dy(III)-based complexes were obtained by directed synthesis, which are [Dy4(L1)2(L2)2(OAc)4]·4C2H5OH·3H2O (1, L1 = 1,3,4-thiadiazole-2,5-diamine, H4L2 = 6,6'-(((1,3,4-thiadiazole-2,5-diyl)bis(azanediyl))bis(((3-ethoxy-2-hydroxybenzyl)oxy)methylene))bis(2-ethoxyphen), [Dy4(L3)4(OAc)4]·C2H5OH·H2O (2, H3L3 = 2-(((5-amino-1,3,4-thiadiazol-2-yl)amino)((3-ethoxy-2-hydroxybenzyl)oxy)methyl)-6-ethoxyphenol)), [Dy6(L4)4(L5)2(µ3-OH)4(CH3O)4Cl4]Cl2 (3, H2L4 = 2-hydroxy-3-methoxybenzaldehyde, H2L5 = 2-(((5-amino-1,3,4-thiadiazol-2-yl)amino)(hydroxy)methyl)-6-methoxyphenol), and [Dy6(L6)4(L7)2(µ3-OH)4(CH3O)4Cl4]Cl2·2H3O (4, H2L6 = 2-hydroxy-3-ethoxybenzaldehyde, H2L7 = 2-(((5-amino-1,3,4-thiadiazol-2-yl)amino)(hydroxy)methyl)-6-ethoxyphenol). A series of acetal products (H4L2, H3L3, H2L5, and H2L7) were obtained through dehydration in situ tandem reactions. Magnetic studies show that complexes 1-4 exhibited different single-molecule magnet behavior under zero-field conditions. The best fitting results showed that under zero DC field, the effective energy barriers (Ueff) and magnetic relaxation times (τ0) of complexes 1-4 are Ueff = 117.0 (2.1) K and τ0 = 6.07 × 10-7 s; Ueff = 83.91 (1.5) K and τ0 = 4.28 × 10-7 s; Ueff = 1.28 (0.2) K and τ0 = 0.73 s, and Ueff = 104.43 (13.3) K and τ0 = 8.25 × 10-8 s, respectively.

16.
BJOG ; 129(7): 1062-1072, 2022 06.
Artigo em Inglês | MEDLINE | ID: mdl-34860444

RESUMO

OBJECTIVE: We assessed factors associated with the frequency and contents of antenatal care (ANC) in remote rural China, including the province of residence and individual-level factors. DESIGN: Survey-based cross-sectional study. SETTING: Five provinces in remote rural China: Guizhou, Hunan, Jilin, Ningxia and Shaanxi. SAMPLE: A cohort of 3918 women with a live birth in 2009-2016. METHODS: Poisson regression. MAIN OUTCOME MEASURES: ANC frequency: five or more visits, starting in the first trimester. ANC contents: coverage of six care components and overuse of ultrasound. RESULTS: Three-quarters (72.9%) of women had five or more ANC visits, starting in the first trimester; 68.8% received all six care components and 94.5% had three or more ultrasounds. Only 30.9% of women sought ANC from township hospitals, paying between $3.80 and $25.80 per visit. ANC frequency and contents were associated with the socio-economic characteristics of the women, but provincial effects were much greater, even after adjusting for individual factors. Women living in Guizhou and Ningxia, the two poorest provinces, with high proportions of ethnic minorities, were particularly underserved. Compared with women in Shaanxi, women in Guizhou were 33% (adjusted RR 0.67, 95% CI 0.61-0.74) less likely to receive five or more ANC visits, starting in the first trimester; women in Ningxia were 17% less likely (adjusted RR 0.83, 95% CI 0.76-0.90) to receive all six care components. CONCLUSIONS: The province of residence was a stronger predictor of ANC frequency and contents than the individual characteristics of women in China, suggesting that strengthening the decentralised system of the financing and organisation of ANC at the province level is crucial for achieving success. Future efforts are warranted to engage subregional administrations. TWEETABLE ABSTRACT: The province of residence was a stronger predictor of ANC frequency and contents than the individual characteristics of women.


Assuntos
Cuidado Pré-Natal , População Rural , China/epidemiologia , Estudos Transversais , Feminino , Humanos , Aceitação pelo Paciente de Cuidados de Saúde , Gravidez , Primeiro Trimestre da Gravidez , Fatores Socioeconômicos
17.
Curr Microbiol ; 79(11): 347, 2022 Oct 08.
Artigo em Inglês | MEDLINE | ID: mdl-36209302

RESUMO

There are gender differences in obesity and related metabolic diseases, but the mechanism of these differences has not been elucidated. Gut microbiota has been recently recognized as a pivotal determinant of obesity and related diseases. The aim of the present study was to investigate sex differences in gut microbiota and its metabolites in an obesity rat model induced by prolonged high-fat-diet (HFD) feeding. In this study, male and female Sprague-Dawley rats were fed normal chow or HFD for 16 weeks (n = 8 for each group). We found that comparing with male rats on HFD (MHFD), female rats on HFD (FHFD) gained more body weight percentage, while had lower body weight gain efficiency and less severity of hepatic steatosis. HFD induced decreased taxon diversity and richness of gut microbiota, and FHFD group had even lower diversity than MHFD group. Among key genera, HFD induced increased Bilophila in male rats but not in female rats. Compared with the MHFD group, FHFD group possessed increases of Akkermansia and Murimonas, and decreases of Acetanaerobacterium, Bacteroides, Bilophila, Blautia and Romboutsia. The levels of total SCFAs in colon contents were increased in tendency in HFD-fed rats of both sexes. FHFD group had increased propionate and decreased ratio of acetate to propionate and butyrate than MHFD group. For MCFAs, HFD induced increases in undecanoic acid and lauric acid in female rats but not in males. In conclusion, HFD induced sex-related alterations in gut microbiome and short/medium-chain fatty acids in rats.


Assuntos
Dieta Hiperlipídica , Microbioma Gastrointestinal , Animais , Peso Corporal , Butiratos , Dieta Hiperlipídica/efeitos adversos , Ácidos Graxos/metabolismo , Ácidos Graxos Voláteis , Feminino , Ácidos Láuricos , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Obesidade/microbiologia , Propionatos , Ratos , Ratos Sprague-Dawley , Caracteres Sexuais , Fatores Sexuais
18.
BMC Health Serv Res ; 22(1): 1187, 2022 Sep 22.
Artigo em Inglês | MEDLINE | ID: mdl-36138410

RESUMO

BACKGROUND: Consultation length, the time a health provider spend with the patient during a consultation, is a crucial aspect of patient-physician interaction. Prior studies that assessed the relationship between consultation length and quality of care were mainly based on offline visits. Research was lacking in E-consults settings, an emerging modality for primary health care. This study aims to examine the association between consultation length and the quality of E-consults services. METHODS: We defined as standardized patient script to present classic urticaria symptoms in asynchronous E-consults at tertiary public hospitals in Beijing and Hangzhou, China. We appraised consultation length using six indicators, time waiting for first response, time waiting for each response, time for consultation, total times of provider's responses, total words of provider's all responses, and average words of provider's each response. We appraised E-consults services quality using five indicators building on China's clinical guidelines (adherence to checklist; accurate diagnosis; appropriate prescription; providing lifestyle modification advice; and patient satisfaction). We performed ordinary least squares (OLS) regressions and logistic regressions to investigate the association between each indictor of consultation length and E-consults services quality. RESULTS: Providers who responded more quickly were more likely to provide lifestyle modification advice and achieve better patient satisfaction, without compromising process, diagnosis, and prescribing quality; Providers who spent more time with patients were likely to adhere to clinical checklists; Providers with more times and words of responses were significantly more likely to adhere to the clinical checklist, provide an accurate diagnosis, appropriate prescription, and lifestyle modification advice, which achieved better satisfaction rate from the patient as well. CONCLUSIONS: The times and words that health providers provide in E-consult can serve as a proxy measure for quality of care. It is essential and urgent to establish rules to regulate the consultation length for Direct-to-consumer telemedicine to ensure adequate patient-provider interaction and improve service quality to promote digital health better.


Assuntos
Dermatologia , Telemedicina , Estudos Transversais , Humanos , Satisfação do Paciente , Encaminhamento e Consulta
19.
J Med Internet Res ; 24(10): e38567, 2022 10 26.
Artigo em Inglês | MEDLINE | ID: mdl-36287598

RESUMO

BACKGROUND: The WeChat platform has become a primary source for medical information in China. However, no study has been conducted to explore the quality of information on WeChat for the treatment of hypertension, the leading chronic condition. OBJECTIVE: This study aimed to explore the quality of information in articles on WeChat that are related to hypertension treatment from the aspects of credibility, concreteness, accuracy, and completeness. METHODS: We searched for all information related to hypertension treatment on WeChat based on several inclusion and exclusion criteria. We used 2 tools to evaluate information quality, and 2 independent reviewers performed the assessment with the 2 tools separately. First, we adopted the DISCERN instrument to assess the credibility and concreteness of the treatment information, with the outcomes classified into five grades: excellent, good, fair, poor, and very poor. Second, we applied the Chinese Guidelines for Prevention and Treatment of Hypertension (2018 edition) to evaluate the accuracy and completeness of the article information with regard to specific medical content. Third, we combined the results from the 2 assessments to arrive at the overall quality of the articles and explored the differences between, and associations of, the 2 independent assessments. RESULTS: Of the 223 articles that were retrieved, 130 (58.3%) full texts were included. Of these 130 articles, 81 (62.3%) described therapeutic measures for hypertension. The assessment based on the DISCERN instrument reported a mean score of 31.22 (SD 8.46). There were no articles rated excellent (mean score >63); most (111/130, 85.4%) of the articles did not refer to the consequences-in particular, quality of life-of no treatment. For specific medical content, adherence to the Chinese Guidelines for Prevention and Treatment of Hypertension was generally low in terms of accuracy and completeness, and there was much erroneous information. The overall mean quality score was 10.18 (SD 2.22) for the 130 articles, and the scores differed significantly across the 3 types (P=.03) and 5 sources (P=.02). Articles with references achieved higher scores for quality than those reporting none (P<.001). The results from the DISCERN assessment and the medical content scores were highly correlated (ρ=0.58; P<.001). CONCLUSIONS: The quality of hypertension treatment-related information on the WeChat platform is low. Future work is warranted to regulate information sources and strengthen references. For the treatment of hypertension, crucial information on the consequences of no treatment is urgently needed.


Assuntos
Hipertensão , Envio de Mensagens de Texto , Humanos , Estudos Transversais , Qualidade de Vida , Anti-Hipertensivos , Hipertensão/terapia
20.
Plant Dis ; 2022 Apr 20.
Artigo em Inglês | MEDLINE | ID: mdl-35442054

RESUMO

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA