Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 18 de 18
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
País de afiliação
Intervalo de ano de publicação
1.
Opt Express ; 32(3): 3394-3401, 2024 Jan 29.
Artigo em Inglês | MEDLINE | ID: mdl-38297561

RESUMO

In this paper, a dual interface trapezium liquid prism with beam steering function is implemented and analyzed. The electrowetting-on-dielectric method is used to perform the desired beam steering function without mechanical moving parts. This work examines deflection angles at different applied voltages to determine the beam steering range. The deflection angle can be experimentally measured from 0° to 3.43°. The proposed liquid prism can be applied in the field of optical manipulation, solar collecting system and so on.

2.
Opt Express ; 31(26): 43416-43426, 2023 Dec 18.
Artigo em Inglês | MEDLINE | ID: mdl-38178435

RESUMO

Inspired by the arrangement of iris and crystalline lens in human eyes, we propose a three-phase electrowetting liquid lens with a deformable liquid iris (TELL-DLI). The proposed electrowetting liquid lens has three-phase fluid: air, conductive liquid, and dyed insulating liquid. The insulating liquid is distributed on the inner wall of the chamber in a ring shape. By applying voltage, the contact angle is changed, so that the dyed insulating liquid contracts towards the center, which is similar to the contraction of iris and the function of crystalline lens muscle in human eyes. The variation range of focal length is from -451.9 mm to -107.9 mm. The variation range of the aperture is from 4.89 mm to 0.6 mm. Under the step voltage of 200 V, the TELL-DLI can be switched between the maximum aperture state and the zero aperture state, and the switching time is ∼150/200 ms. Because of the discrete electrodes, TELL-DLI can regionally control the shape and position of the iris, and switch between circle, ellipse, sector, and strip. The TELL-DLI has a wide application prospect in imaging systems, such as microscopic imaging system, and has the potential to be applied in the field of complex beam navigation.

3.
Environ Microbiol ; 23(2): 861-877, 2021 02.
Artigo em Inglês | MEDLINE | ID: mdl-32715552

RESUMO

The bacterial genus Dietzia is widely distributed in various environments. The genomes of 26 diverse strains of Dietzia, including almost all the type strains, were analysed in this study. This analysis revealed a lipid metabolism gene richness, which could explain the ability of Dietzia to live in oil related environments. The pan-genome consists of 83,976 genes assigned into 10,327 gene families, 792 of which are shared by all the genomes of Dietzia. Mathematical extrapolation of the data suggests that the Dietzia pan-genome is open. Both gene duplication and gene loss contributed to the open pan-genome, while horizontal gene transfer was limited. Dietzia strains primarily gained their diverse metabolic capacity through more ancient gene duplications. Phylogenetic analysis of Dietzia isolated from aquatic and terrestrial environments showed two distinct clades from the same ancestor. The genome sizes of Dietzia strains from aquatic environments were significantly larger than those from terrestrial environments, which was mainly due to the occurrence of more gene loss events during the evolutionary progress of the strains from terrestrial environments. The evolutionary history of Dietzia was tightly coupled to environmental conditions, and iron concentrations should be one of the key factors shaping the genomes of the Dietzia lineages.


Assuntos
Actinobacteria/genética , Ecossistema , Genoma Bacteriano , Actinobacteria/classificação , Actinobacteria/isolamento & purificação , Actinobacteria/metabolismo , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Evolução Molecular , Transferência Genética Horizontal , Genômica , Filogenia
4.
Opt Express ; 29(17): 27104-27117, 2021 Aug 16.
Artigo em Inglês | MEDLINE | ID: mdl-34615132

RESUMO

In this paper, a high stability liquid lens with optical path modulation function is designed and fabricated. The liquid lens has an outer chamber and an inner chamber, and the inner chamber has a structure with three annular anchoring layers. This structure can limit the sliding of the three-phase contact line under electrowetting effect and anchor the position of contact angle with a limited distance. The feasibility of this structure is verified by simulation and practice. The zoom imaging, contact angle, focal length and response time of the liquid lens are analyzed. The structure with three annular anchoring layers provides six anchored precision optical path modulation gears, and the optical path difference can be changed by mechanical hydraulic control, up to 1.17 mm. Widespread applications of the proposed liquid lens are foreseeable such as microscopic imaging and a telescope system, etc.

5.
Light Sci Appl ; 13(1): 62, 2024 Feb 29.
Artigo em Inglês | MEDLINE | ID: mdl-38424072

RESUMO

With the development of artificial intelligence, neural network provides unique opportunities for holography, such as high fidelity and dynamic calculation. How to obtain real 3D scene and generate high fidelity hologram in real time is an urgent problem. Here, we propose a liquid lens based holographic camera for real 3D scene hologram acquisition using an end-to-end physical model-driven network (EEPMD-Net). As the core component of the liquid camera, the first 10 mm large aperture electrowetting-based liquid lens is proposed by using specially fabricated solution. The design of the liquid camera ensures that the multi-layers of the real 3D scene can be obtained quickly and with great imaging performance. The EEPMD-Net takes the information of real 3D scene as the input, and uses two new structures of encoder and decoder networks to realize low-noise phase generation. By comparing the intensity information between the reconstructed image after depth fusion and the target scene, the composite loss function is constructed for phase optimization, and the high-fidelity training of hologram with true depth of the 3D scene is realized for the first time. The holographic camera achieves the high-fidelity and fast generation of the hologram of the real 3D scene, and the reconstructed experiment proves that the holographic image has the advantage of low noise. The proposed holographic camera is unique and can be used in 3D display, measurement, encryption and other fields.

6.
Lancet Infect Dis ; 24(8): 922-934, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-38614117

RESUMO

BACKGROUND: The Oka varicella vaccine strain remains neurovirulent and can establish lifelong latent infection, raising safety concerns about vaccine-related herpes zoster. In this study, we aimed to evaluate the immunogenicity and safety of a skin-attenuated and neuro-attenuated varicella vaccine candidate (v7D vaccine). METHODS: We did this randomised, double-blind, controlled, phase 2a clinical trial in Jiangsu, China. Healthy children aged 3-12 years with no history of varicella infection or vaccination were enrolled and randomly assigned (1:1:1:1) to receive a single subcutaneous injection of the v7D vaccine at 3·3 log10 plaque forming units (PFU; low-dose v7D group), 3·9 log10 PFU (medium-dose v7D group), and 4·2 log10 PFU (high-dose v7D group), or the positive control varicella vaccine (vOka vaccine group). All the participants, laboratory personnel, and investigators other than the vaccine preparation and management staff were masked to the vaccine allocation. The primary outcome was assessment of the geometric mean titres (GMTs) and seroconversion rates of anti-varicella zoster virus immunoglobulin G (IgG) induced by different dose groups of v7D vaccine at 0, 42, 60, and 90 days after vaccination in the per-protocol set for humoral immune response analysis. Safety was a secondary outcome, focusing on adverse events within 42 days post-vaccination, and serious adverse events within 6 months after vaccination. This study was registered on Chinese Clinical Trial Registry, ChiCTR2000034434. FINDINGS: On Aug 18-21, 2020, 842 eligible volunteers were enrolled and randomly assigned treatment. After three participants withdrew, 839 received a low dose (n=211), middle dose (n=210), or high dose (n=210) of v7D vaccine, or the vOka vaccine (n=208). In the per-protocol set for humoral immune response analysis, the anti-varicella zoster virus IgG antibody response was highest at day 90. At day 90, the seroconversion rates of the low-dose, medium-dose, and high-dose groups of v7D vaccine and the positive control vOka vaccine group were 100·0% (95% CI 95·8-100·0; 87 of 87 participants), 98·9% (93·8-100·0; 87 of 88 participants), 97·8% (92·4-99·7; 91 of 93 participants), and 96·4% (89·8-99·2; 80 of 83 participants), respectively; the GMTs corresponded to values of 30·8 (95% CI 26·2-36·0), 31·3 (26·7-36·6), 28·2 (23·9-33·2), and 38·5 (31·7-46·7). The v7D vaccine, at low dose and medium dose, elicited a humoral immune response similar to that of the vOka vaccine. However, the high-dose v7D vaccine induced a marginally lower GMT compared with the vOka vaccine at day 90 (p=0·027). In the per-protocol set, the three dose groups of the v7D vaccine induced a similar humoral immune response at each timepoint, with no statistically significant differences. The incidence of adverse reactions in the low-dose, medium-dose, and high-dose groups of v7D vaccine was significantly lower than that in the vOka vaccine group (17% [35 of 211 participants], 20% [41 of 210 participants], and 13% [27 of 210 participants] vs 24% [50 of 208 participants], respectively; p=0·025), especially local adverse reactions (10% [22 of 211 participants], 14% [30 of 210 participants] and 9% [18 of 210 participants] vs 18% [38 of 208 participants], respectively; p=0·016). None of the serious adverse events were vaccine related. INTERPRETATION: The three dose groups of the candidate v7D vaccine exhibit similar humoral immunogenicity to the vOka vaccine and are well tolerated. These findings encourage further investigations on two-dose vaccination schedules, efficacy, and the potential safety benefit of v7D vaccine in the future. FUNDING: The National Natural Science Foundation of China, CAMS Innovation Fund for Medical Sciences, the Fundamental Research Funds for the Central Universities, and Beijing Wantai. TRANSLATION: For the Chinese translation of the abstract see Supplementary Materials section.


Assuntos
Anticorpos Antivirais , Vacina contra Varicela , Varicela , Vacinas Atenuadas , Humanos , Vacina contra Varicela/imunologia , Vacina contra Varicela/administração & dosagem , Vacina contra Varicela/efeitos adversos , Método Duplo-Cego , Vacinas Atenuadas/imunologia , Vacinas Atenuadas/administração & dosagem , Vacinas Atenuadas/efeitos adversos , Masculino , Feminino , Pré-Escolar , Criança , Anticorpos Antivirais/sangue , Varicela/prevenção & controle , Varicela/imunologia , China , Herpesvirus Humano 3/imunologia , Imunogenicidade da Vacina , Vacinação/métodos
7.
Zhongguo Zhen Jiu ; 43(2): 163-9, 2023 Feb 12.
Artigo em Zh | MEDLINE | ID: mdl-36808510

RESUMO

OBJECTIVE: To observe the clinical efficacy of scalp acupuncture for spastic cerebral palsy (CP), and to explore its possible mechanism based on brain white matter fiber bundles, nerve growth related proteins and inflammatory cytokines. METHODS: A total of 90 children with spastic CP were randomly divided into a scalp acupuncture group and a sham scalp acupuncture group, 45 cases in each group. The children in the two groups were treated with conventional comprehensive rehabilitation treatment. The children in the scalp acupuncture group were treated with scalp acupuncture at the parietal temporal anterior oblique line, parietal temporal posterior oblique line on the affected side, and parietal midline. The children in the sham scalp acupuncture group were treated with scalp acupuncture at 1 cun next to the above point lines. The needles were kept for 30 min, once a day, 5 days a week, for 12 weeks. Before and after treatment, the diffusion tensor imaging (DTI) indexes of magnetic resonance (FA values of corticospinal tract [CST], anterior limb of internal capsule [ICAL], posterior limb of internal capsule [ICPL], genu of internal capsule [ICGL], genu of corpus callosum [GCC], body of corpus callosum [BCC] and splenium of corpus callosum [SCC]), serum levels of nerve growth related proteins (neuron-specific enolase [NSE], glial fibrillary acidic protein [GFAP], myelin basic protein [MBP], ubiquitin carboxy terminal hydrolase-L1 [UCH-L1]) and inflammatory cytokines (interleukin 33 [IL-33], tumor necrosis factor α [TNF-α]), cerebral hemodynamic indexes (mean blood flow velocity [Vm], systolic peak flow velocity [Vs] and resistance index [RI], pulsatility index [PI] of cerebral artery), surface electromyography (SEMG) signal indexes (root mean square [RMS] values of rectus femoris, hamstring muscles, gastrocnemius muscles, tibialis anterior muscles), gross motor function measure-88 (GMFM-88) score, modified Ashworth scale (MAS) score, ability of daily living (ADL) score were observed in the two groups. The clinical effect of the two groups was compared. RESULTS: After treatment, the FA value of each fiber bundle, Vm, Vs, GMFM-88 scores and ADL scores in the two groups were higher than those before treatment (P<0.05), and the above indexes in the scalp acupuncture group were higher than those in the sham scalp acupuncture group (P<0.05). After treatment, the serum levels of NSE, GFAP, MBP, UCH-L1, IL-33, TNF-α as well as RI, PI, MAS scores and RMS values of each muscle were lower than those before treatment (P<0.05), and the above indexes in the scalp acupuncture group were lower than those in the sham scalp acupuncture group (P<0.05). The total effective rate was 95.6% (43/45) in the scalp acupuncture group, which was higher than 82.2% (37/45) in the sham scalp acupuncture group (P<0.05). CONCLUSION: Scalp acupuncture could effectively treat spastic CP, improve the cerebral hemodynamics and gross motor function, reduce muscle tension and spasticity, and improve the ability of daily life. The mechanism may be related to repairing the white matter fiber bundles and regulating the levels of nerve growth related proteins and inflammatory cytokines.


Assuntos
Terapia por Acupuntura , Paralisia Cerebral , Criança , Humanos , Paralisia Cerebral/terapia , Interleucina-33 , Imagem de Tensor de Difusão/métodos , Couro Cabeludo , Espasticidade Muscular , Fator de Necrose Tumoral alfa , Citocinas
8.
Food Sci Nutr ; 11(12): 7649-7663, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-38107093

RESUMO

Neonatal hypoxic-ischemic brain damage (HIBD) is a leading cause of infant mortality worldwide. This study explored whether quercetin (Que) exerts neuroprotective effects in a rat model of HIBD. A total of 36 seven-day-old Sprague-Dawley rats were divided into control, Que, HI, and HI + Que groups. The Rice method was used to establish HIBD in HI and HI + Que rats, which were treated with hypoxia (oxygen concentration of 8%) for 2 h after ligation of the left common carotid artery. The rats in the HI + Que group were intraperitoneally injected with Que (30 mg/kg) 1 h before hypoxia, and the rats in the Que group were only injected with the same amount of Que. Brain tissues were harvested 24 h postoperation and assessed by hematoxylin and eosin staining, 2,3,5-triphenyltetrazolium chloride staining, and terminal deoxynucleotidyl transferase dUTP nick-end labeling assay; relative gene and protein levels were evaluated by RT-qPCR, IHC, or western blot (WB) assay. Brain tissue morphologies were characterized by transmission electron microscopy (TEM); LC3B protein levels were assessed by immunofluorescence staining. Escape latencies and platform crossing times were significantly improved (p < .05) in HI + Que groups; infarct volume significantly decreased (p < .001), whereas the numbers of autophagic bodies and apoptotic cells increased and decreased, respectively. Meanwhile, NLRX1, ATG7, and Beclin1 expressions were significantly upregulated, and mTOR and TIM23 expressions, LC3B protein level, and LC 3II/LC 3I ratio were significantly downregulated. Que exerted neuroprotective effects in a rat model of HIBD by regulating NLRX1 and autophagy.

9.
Lancet Infect Dis ; 23(11): 1313-1322, 2023 11.
Artigo em Inglês | MEDLINE | ID: mdl-37475116

RESUMO

BACKGROUND: An Escherichia coli-produced human papillomavirus (HPV) 16 and 18 bivalent vaccine (Cecolin) was prequalified by WHO in 2021. This study aimed to compare the immunogenicity of the E coli-produced HPV 9-valent vaccine Cecolin 9 (against HPV 6, 11, 16, 18, 31, 33, 45, 52, and 58) with Gardasil 9. METHODS: This was a randomised, single-blind trial conducted in China. Healthy non-pregnant women aged 18-26 years, who were not breastfeeding and with no HPV vaccination history, were enrolled in the Ganyu Centre for Disease Control and Prevention (Lianyungang City, Jiangsu Province, China). Women were stratified by age (18-22 years and 23-26 years) and randomly assigned (1:1) using a permutated block size of eight to receive three doses of Cecolin 9 or Gardasil 9 at day 0, day 45, and month 6. All participants, as well as study personnel without access to the vaccines, were masked. Neutralising antibodies were measured by a triple-colour pseudovirion-based neutralisation assay. The primary outcomes, seroconversion rates and geometric mean concentrations (GMCs) at month 7, were analysed in the per-protocol set for immunogenicity (PPS-I). Non-inferiority was identified for the lower limit of the 95% CI of the GMC ratio (Cecolin 9 vs Gardasil 9) at a margin of 0·5 and a seroconversion rate difference (Cecolin 9-Gardasil 9) at a margin of -5%. This study was registered at ClinicalTrials.gov (NCT04782895) and is completed. FINDINGS: From March 14 to 18, 2021, a total of 553 potential participants were screened, of which 244 received at least one dose of Cecolin 9 and 243 received at least one dose of Gardasil 9. The seroconversion rates for all HPV types in both groups were 100% in the PPS-I, with the values of the lower limits of 95% CIs for seroconversion rate differences ranging between -1·8% and -1·7%. The GMC ratios of five types were higher than 1·0, with the highest ratio, for HPV 58, at 1·65 (95% CI 1·38-1·97), and those of four types were lower than 1·0, with the lowest ratio, for HPV 11, at 0·79 (0·68-0·93). The incidence of adverse reactions in both groups was similar (43% [104/244] vs 47% [115/243]). INTERPRETATION: Cecolin 9 induced non-inferior HPV type-specific immune responses compared with Gardasil 9 and is a potential candidate to accelerate the elimination of cervical cancer by allowing for global accessibility to 9-valent HPV vaccinations, especially in low-income and middle-income countries. FUNDING: National Natural Science Foundation, Fujian Provincial Natural Science Foundation, Xiamen Science and Technology Plan Project, Fundamental Research Funds for the Central Universities, CAMS Innovation Fund for Medical Sciences of China, and Xiamen Innovax.


Assuntos
Infecções por Papillomavirus , Vacinas contra Papillomavirus , Humanos , Feminino , Escherichia coli , Papillomavirus Humano , Infecções por Papillomavirus/epidemiologia , Método Simples-Cego , China , Imunogenicidade da Vacina , Anticorpos Antivirais , Método Duplo-Cego
10.
Front Immunol ; 13: 1022850, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36479126

RESUMO

Background: The ulcerative colitis (UC) and Crohn's disease (CD) subtypes of inflammatory bowel disease (IBD) are autoimmune diseases influenced by multiple complex factors. The clinical treatment strategies for UC and CD often differ, indicating the importance of improving their discrimination. Methods: Two methods, robust rank aggregation (RRA) analysis and merging and intersection, were applied to integrate data from multiple IBD cohorts, and the identified differentially expressed genes (DEGs) were used to establish a protein-protein interaction (PPI) network. Molecular complex detection (MCODE) was used to identify important gene sets. Two differential diagnostic models to distinguish CD and UC were established via a least absolute shrinkage and selection operator (LASSO) logistic regression, and model evaluation was performed in both the training and testing groups, including receiver operating characteristic (ROC) curves, calibration plots and decision curve analysis (DCA). The potential value of MMP-associated genes was further verified using different IBD cohorts and clinical samples. Results: Four datasets (GSE75214, GSE10616, GSE36807, and GSE9686) were included in the analysis. Both data integration methods indicated that the activation of the MMP-associated module was significantly elevated in UC. Two LASSO models based on continuous variable (Model_1) and binary variable (Model_2) MMP-associated genes were established to discriminate CD and UC. The results showed that Model_1 exhibited good discrimination in the training and testing groups. The calibration analysis and DCA showed that Model_1 exhibited good performance in the training group but failed in the testing group. Model_2 exhibited good discrimination, calibration and DCA results in the training and testing groups and exhibited greater diagnostic value. The effects of Model_1 and Model_2 were further verified in a new IBD cohort of GSE179285. The MMP genes exhibited high value as biomarkers for the discrimination of IBD patients using published cohort and immunohistochemistry (IHC) staining data. The MMP-associated gene levels were statistically significantly positively correlated with the levels of the differentially expressed cell types, indicating their potential value in differential diagnosis. The single-cell analysis confirmed that the expression of ANXA1 in UC was higher than that in CD. Conclusion: MMP-associated modules are the main differential gene sets between CD and UC. The established Model_2 overcomes batch differences and has good clinical applicability. Subsequent in-depth research investigating how MMPs are involved in the development of different IBD subtypes is necessary.


Assuntos
Colite Ulcerativa , Doença de Crohn , Humanos , Doença de Crohn/diagnóstico , Doença de Crohn/genética , Metaloproteinases da Matriz , Colite Ulcerativa/diagnóstico , Colite Ulcerativa/genética
11.
Zhongguo Zhen Jiu ; 41(7): 751-5, 2021 Jul 12.
Artigo em Zh | MEDLINE | ID: mdl-34259407

RESUMO

OBJECTIVE: To observe the effect of Jin's three-needle combined with Tongdu Tiaoshen acupuncture on development level and activity of daily living in children with intellectual disability, and explore its mechanism. METHODS: A total of 60 children with intellectual disability were randomly divided into an observation group (30 cases, 2 cases dropped off) and a control group (30 cases, 2 cases dropped off). In the control group, rehabilitation training and routine acupuncture were adopted, 30 min each time, once a day, 6 times a week for 3 months. On the base of the treatment as the control group, Jin's three-needle combined with Tongdu Tiaoshen acupuncture were adopted in the observation group. Jin's three-needle was applied at Sishenzhen, Zhisanzhen, Naosanzhen and Niesanzhen for 1 h, Shouzhizhen and Zuzhizhen for 30 min. Tongdu Tiaoshen acupuncture was applied at Baihui (GV 20), Shenting (GV 24), Shuigou (GV 26), etc. for 30 min, once a day, 6 times a week for 3 months. Before and after treatment,the scores of developmental quotient (DQ) and activity of daily living (ADL) were recorded, and the serum levels of neuron-specific enolase (NSE) and monoamine neurotransmitters (dopamine [DA], norepinephrine [NE] and 5-hydroxytryptamine [5-HT]) were detected in the two groups. RESULTS: Compared before treatment, the scores of DQ and ADL and the serum levels of DA, NE, 5-HT after treatment were increased (P<0.05), the serum levels of NSE were decreased (P<0.05) in the two groups. After treatment, the scores of DQ and ADL and the serum levels of DA, NE, 5-HT in the observation group were higher than the control group (P<0.05), while the serum level of NSE was lower than the control group (P<0.05). CONCLUSION: On the base of rehabilitation training and routine acupuncture, Jin's three-needle combined with Tongdu Tiaoshen acupuncture can significantly improve development level and activity of daily living in children with intellectual disability, and its mechanism may be related to the regulation of serum levels of NSE and monoamine neurotransmitter.


Assuntos
Terapia por Acupuntura , Deficiência Intelectual , Atividades Cotidianas , Pontos de Acupuntura , Criança , Humanos , Agulhas , Neurotransmissores , Resultado do Tratamento
12.
J Recept Signal Transduct Res ; 29(5): 266-73, 2009.
Artigo em Inglês | MEDLINE | ID: mdl-19772393

RESUMO

The major immediate early (MIE) gene of cytomegalovirus plays a key role in determining the activation and replication of cytomegalovirus, which represents the most important event signaling the onset of virus-induced disease relapse. The viral-encoded chemokine receptor homolog US28 can constitutively activate many cellular transcription factors, which can bind to the promoter/enhancer of the MIE gene and activate its transcription. Using reporter gene assays in HEK293 cells, we found that US28 enhanced the transcription efficiency of MIE and other genes via cAMP response element-binding protein (CREB). Inhibition of CREB partially blocked the effect of US28, whereas forskolin enhanced this effect. There was a direct correlation between CREB and transcription of MIE gene. These data, together with the broad-spectrum effect of cellular transcription factors, suggest that US28 may be involved in the very early transcription of the host cell during virus activation.


Assuntos
Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/metabolismo , Elementos Facilitadores Genéticos/genética , Regulação Viral da Expressão Gênica , Genes Precoces/genética , Regiões Promotoras Genéticas/genética , Receptores de Quimiocinas/fisiologia , Proteínas Virais/fisiologia , Western Blotting , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/genética , Humanos , Luciferases/metabolismo , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Fatores de Transcrição/metabolismo , Transcrição Gênica
13.
Mol Med Rep ; 12(4): 5865-71, 2015 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-26238071

RESUMO

Emodin is a traditional Chinese medicine, which has been demonstrated to inhibit the growth of pancreatic cancer cells. However, the underlying molecular mechanisms remain to be elucidated. The present study investigated whether emodin suppresses angiogenesis in pancreatic cancer. A nude mouse pancreatic cancer xenograft model was established using SW1990 human pancreatic cancer cells by surgical orthotopic implantation. Different doses of emodin were injected into the abdominal cavities of the tumor­bearing mouse models and controls three times each week for 2 weeks. The tumors were measured and weighed, the expression of cluster of differentiation 34 was detected using immunochemistry, and microvessel densities were calculated. Reverse transcription­quantitative polymerase chain reaction (RT­qPCR) and western blotting were performed to determine the mRNA and protein expression levels of transforming growth factor (TGF)­ß and drosophila mothers against decapentaplegic (Smad) homologs. The angiogenesis­associated microRNAs (miR), miR­20, miR­155 and miR­210 were assessed by RT­qPCR. A negative dose­dependent association was revealed between treatment with emodin and the volume and weight of tumors and microvessel density. Emodin was associated with lower mRNA and protein expression levels of TGF­ß1 and its downstream target, angiopoietin­like 4, and higher mRNA and protein expression levels of TGF­ß receptor (TßR)I, TßRII and Smad4. Notably, treatment with emodin was associated with lower expression levels of miR­155 and miR­210 and higher expression levels of miR­20b. The present study suggested that treatment with emodin may repress angiogenesis in pancreatic cancer by altering the activities of the TGF-ß/Smad pathway and angiogenesis-associated miR-20b, miR-155, and miR-210.


Assuntos
Emodina/farmacologia , MicroRNAs/genética , Neovascularização Patológica/genética , Neovascularização Patológica/metabolismo , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/metabolismo , Fator de Crescimento Transformador beta/metabolismo , Inibidores da Angiogênese/administração & dosagem , Inibidores da Angiogênese/farmacologia , Animais , Antineoplásicos/administração & dosagem , Antineoplásicos/farmacologia , Biomarcadores , Linhagem Celular Tumoral , Modelos Animais de Doenças , Emodina/administração & dosagem , Feminino , Expressão Gênica , Xenoenxertos , Humanos , Camundongos , Neovascularização Patológica/tratamento farmacológico , Neoplasias Pancreáticas/tratamento farmacológico , Neoplasias Pancreáticas/patologia , Inibidores de Proteínas Quinases/administração & dosagem , Inibidores de Proteínas Quinases/farmacologia , Proteínas Serina-Treonina Quinases/genética , Proteínas Serina-Treonina Quinases/metabolismo , RNA Mensageiro/genética , Receptor do Fator de Crescimento Transformador beta Tipo I , Receptor do Fator de Crescimento Transformador beta Tipo II , Receptores de Fatores de Crescimento Transformadores beta/genética , Receptores de Fatores de Crescimento Transformadores beta/metabolismo , Proteína Smad4/genética , Proteína Smad4/metabolismo , Fator de Crescimento Transformador beta1/genética , Fator de Crescimento Transformador beta1/metabolismo , Carga Tumoral/efeitos dos fármacos
14.
Int J Oncol ; 45(3): 1065-72, 2014 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-24938458

RESUMO

Ginsenoside Rg3 (Rg3), a trace tetracyclic triterpenoid saponin, is extracted from ginseng and shown to have anticancer activity against several types of cancers. This study explored the effect of Rg3 on pancreatic cancer vasculogenic mimicry. Altered vasculogenic mimicry formation was assessed using immunohistochemistry and PAS staining and associated with the expression of vascular endothelial-cadherin (VE-cadherin), epithelial cell kinase (EphA2), matrix metalloproteinase (MMP)-2 and MMP-9. The effect of Rg3 on the regulation of pancreatic cancer vasculogenic mimicry was evaluated in vitro and in vivo. The data showed vasculogenic mimicry in pancreatic cancer tissues. In addition, the expression of VE-cadherin, EphA2, MMP-2 and MMP-9 proteins associated with formation of pancreatic cancer vasculogenic mimicry. Rg3 treatment reduced the levels of vasculogenic mimicry in nude mouse xenografts in vitro and in vivo, while the expression of VE-cadherin, EphA2, MMP-2 and MMP-9 mRNA and proteins was downregulated by Rg3 treatment in vitro and in tumor xenografts. In conclusion, ginsenoside Rg3 effectively inhibited the formation of pancreatic cancer vasculogenic mimicry by downregulating the expression of VE-cadherin, EphA2, MMP9 and MMP2. Further studies are required to evaluate ginsenoside Rg3 as an agent to control pancreatic cancer.


Assuntos
Antineoplásicos/farmacologia , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Ginsenosídeos/farmacologia , Neovascularização Patológica/tratamento farmacológico , Neoplasias Pancreáticas/patologia , Animais , Antígenos CD/metabolismo , Caderinas/metabolismo , Linhagem Celular Tumoral , Humanos , Metaloproteinase 2 da Matriz/metabolismo , Metaloproteinase 9 da Matriz/metabolismo , Camundongos , Camundongos Endogâmicos BALB C , Neoplasias Experimentais , Pancreatopatias/metabolismo , Pancreatopatias/patologia , Neoplasias Pancreáticas/metabolismo , Receptor EphA2/metabolismo , Ensaios Antitumorais Modelo de Xenoenxerto
15.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 19(5): 1218-23, 2011 Oct.
Artigo em Zh | MEDLINE | ID: mdl-22040975

RESUMO

This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.


Assuntos
Medula Óssea/virologia , Monócitos/virologia , Muromegalovirus/fisiologia , Células-Tronco/virologia , Animais , Infecções por Citomegalovirus , Camundongos , Camundongos Endogâmicos BALB C , Proteínas Proto-Oncogênicas c-kit
16.
Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi ; 25(5): 385-8, 2009 May.
Artigo em Zh | MEDLINE | ID: mdl-19426590

RESUMO

AIM: To observe the effect of the human cytomegalovirus(HCMV)-encoded chemokine receptor homolog US28 on the human transcription factor CREB related transcriptional activity. METHODS: The US28 gene was cloned from DNA of HCMV-infected fibroblast at 72 h post infection. The amplified gene fragment was subsequently cloned into pcDNA3.1 eukaryotic expression vector. The recombinant plasmid was selected and identified by sequence analysis. US28-pcDNA3.1 was added to the Dual-Luciferase Reporter Assay System. The immunoreactive bands of phospho-CREB(p-CREB)and luminescence values were observed. RESULTS: The constructed recombinant vector was verified by PCR analysis and DNA sequencing. US28 enhanced the transcriptional efficiency of CRE driving gene via p-CREB. CONCLUSION: HCMV could enhance the transcriptional activity of CRE driving gene via p-CREB. CREB might be involved in the very early reprogramming of the host cell during virus activation.


Assuntos
Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/metabolismo , Citomegalovirus/metabolismo , Receptores de Quimiocinas/metabolismo , Proteínas Virais/metabolismo , Western Blotting , Linhagem Celular , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/genética , Citomegalovirus/genética , Humanos , Luciferases/genética , Luciferases/metabolismo , Fosforilação , Reação em Cadeia da Polimerase , Receptores de Quimiocinas/genética , Proteínas Recombinantes de Fusão/genética , Proteínas Recombinantes de Fusão/metabolismo , Transcrição Gênica , Transfecção , Proteínas Virais/genética
17.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 13(4): 542-7, 2005 Aug.
Artigo em Zh | MEDLINE | ID: mdl-16129030

RESUMO

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.


Assuntos
Agkistrodon/genética , Venenos de Crotalídeos/enzimologia , Venenos de Crotalídeos/genética , Trombina/genética , Sequência de Aminoácidos , Animais , Sequência de Bases , Clonagem Molecular , Venenos de Crotalídeos/biossíntese , DNA Complementar/química , DNA Complementar/genética , Escherichia coli/genética , Metaloendopeptidases/biossíntese , Metaloendopeptidases/genética , Dados de Sequência Molecular , Proteínas Recombinantes/biossíntese , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Análise de Sequência de DNA , Homologia de Sequência do Ácido Nucleico , Trombina/biossíntese
18.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 11(3): 305-7, 2003 Jun.
Artigo em Zh | MEDLINE | ID: mdl-12844419

RESUMO

Virus inactivation of plasma can be achieved by methylene blue/photochemical method. To investigate the effect of this method on immunological properties and biochemical functions of plasma components, the virus-inactivation method was performed on single-donor plasma that was exposed to visible light (40,000 lux) at room temperature for 1 h in the presence of 1 micro mol/L methylene blue. The results showed that activities of the factor VIII, PT and APTT were decreased to a certain degree while most of other plasma proteins were not affected significantly. Human plasma components including albumin, glucose and minerals as well as plasma pH were also not affected. By using different electrophoreses and immunochemical techniques, no neoantigens were found in photodynamically treated plasma and electrophoretic mobility revealed identical patterns for untreated and treated plasma. In conclusion, methylene blue/photochemical method dose not considerably influence the properties of major of plasma components.


Assuntos
Azul de Metileno/farmacologia , Plasma/efeitos dos fármacos , Inativação de Vírus/efeitos dos fármacos , Fatores de Coagulação Sanguínea/metabolismo , Complemento C3/metabolismo , Eletroforese/métodos , Fator VIII/metabolismo , Humanos , Concentração de Íons de Hidrogênio , Luz , Tempo de Tromboplastina Parcial , Plasma/metabolismo , Plasma/efeitos da radiação , Tempo de Trombina , Fatores de Tempo , Inativação de Vírus/efeitos da radiação
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA