Profiling the long noncoding RNA interaction network in the regulatory elements of target genes by chromatin in situ reverse transcription sequencing.

Long noncoding RNAs (lncRNAs) can regulate the activity of target genes by participating in the organization of chromatin architecture. We have devised a "chromatin-RNA in situ reverse transcription sequencing" (CRIST-seq) approach to profile the lncRNA interaction network in gene regulatory elements by combining the simplicity of RNA biotin labeling with the specificity of the CRISPR/Cas9 system. Using gene-specific gRNAs, we describe a pluripotency-specific lncRNA interacting network in the promoters of Sox2 and Pou5f1, two critical stem cell factors that are required for the maintenance of pluripotency. The promoter-interacting lncRNAs were specifically activated during reprogramming into pluripotency. Knockdown of these lncRNAs caused the stem cells to exit from pluripotency. In contrast, overexpression of the pluripotency-associated lncRNA activated the promoters of core stem cell factor genes and enhanced fibroblast reprogramming into pluripotency. These CRIST-seq data suggest that the Sox2 and Pou5f1 promoters are organized within a unique lncRNA interaction network that determines the fate of pluripotency during reprogramming. This CRIST approach may be broadly used to map lncRNA interaction networks at target loci across the genome.

Development of Conductive Hydrogels for Fabricating Flexible Strain Sensors.

Conductive hydrogels can be prepared by incorporating various conductive materials into polymeric network hydrogels. In recent years, conductive hydrogels have been developed and applied in the field of strain sensors owing to their unique properties, such as electrical conductivity, mechanical properties, self-healing, and anti-freezing properties. These remarkable properties allow conductive hydrogel-based strain sensors to show excellent performance for identifying external stimuli and detecting human body movement, even at subzero temperatures. This review summarizes the properties of conductive hydrogels and their application in the fabrication of strain sensors working in different modes. Finally, a brief prospectus for the development of conductive hydrogels in the future is provided.

Macrophage-derived extracellular vesicles regulates USP5-mediated HDAC2/NRF2 axis to ameliorate inflammatory pain.

Emerging research has highlighted the capacity of microRNA-23a-3p (miR-23a-3p) to alleviate inflammatory pain. However, the molecular mechanism by which miR-23a-3p attenuates inflammatory pain is yet to be fully understood. Hence, the current study aimed to elucidate the mechanism by which miR-23a-3p influences inflammatory pain. Bioinformatics was initially performed to predict the inflammatory pain related downstream targets of miR-23a-3p in macrophage-derived extracellular vesicles (EVs). An animal inflammatory pain model was established using Complete Freund's Adjuvant (CFA). The miR-23a-3p expression was downregulated in the microglia of CFA-induced mice, after which the inflammatory factors were determined by ELISA. FISH and immunofluorescence were performed to analyze the co-localization of miR-23a-3p and microglia. Interestingly, miR-23a-3p was transported to the microglia via M2 macrophage-EVs, which elevated the mechanical allodynia and the thermal hyperalgesia thresholds in mice model. The miR-23a-3p downstream target, USP5, was found to stabilize HDAC2 via deubiquitination to promote its expression while inhibiting the expression of NRF2. Taken together, the key findings of the current study demonstrate that macrophage-derived EVs containing miR-23a-3p regulates the HDAC2/NRF2 axis by decreasing USP5 expression to alleviate inflammatory pain, which may provide novel therapeutic targets for the treatment of inflammatory pain.

Analysis of the ignition of hydrogen/air mixtures induced by a hot particle.

Understanding the ignition and explosion of hydrogen induced by a hot particle is crucial for the safety of hydrogen storage, transmission and utilization. In this paper, the ignition/explosion of hydrogen/air mixtures induced by a hot particle is investigated theoretically and numerically. Eigenvalue analysis is conducted for the radical-runaway ignition process in which a detailed reaction mechanism is considered. The governing equation for radical accumulation is converted into a rate-controlling ordinary differential equation (ODE). The ODE can be solved with the help of a hypothetical single-step reaction model, whose kinetic characteristics are related to the positive eigenvalue of the rate matrix constituted by relevant linear chain reactions. Based on the single-step reaction model, the critical ignition Damköhler number can be determined. Besides, transient simulations are conducted using in-house code A-SURF, in which detailed chemistry and transport are considered. The critical ignition temperatures predicted by eigenvalue analysis agree well with experimental data reported in the literature and present numerical results over a wide range of particle radii. The particle surface introduces temperature inhomogeneity in the ignition of a hydrogen/air mixture, which yields a Z-shaped curve of the explosion limit. The Z-shaped curve shifts to a higher temperature and pressure regime along the boundary of the second explosion limit when the particle size decreases. The increasing difficulty in the ignition can be attributed to the strengthening of radical diffusion as the particle becomes smaller. Compared to a homogeneous ignition system, the presence of a particle surface can alter the relative impacts among key chain reactions. The effects of preferential diffusion between heat and mass transport (i.e., Lewis number effect) and equivalence ratio on the Z-shaped curve of the explosion limit are assessed and interpreted. The present study provides useful insights into the kinetics and transport involved in the ignition of hydrogen/air mixtures by a hot particle, which is closely related to the fire/explosion safety of hydrogen.

Targeting Jurkat T Lymphocyte Leukemia Cells by an Engineered Interferon-Alpha Hybrid Molecule.

BACKGROUND/AIMS: Adult T-cell leukemia/lymphoma (ATL) is a very aggressive T cell malignancy that carries a poor prognosis, primarily due to its resistance to chemotherapy and to life-threatening infectious complications. Interferon-alpha (IFNα) has been used in combination with the anti-retroviral drug zidovudine to treat patients with ATL. However, the efficacy of long-term therapy is significantly limited due to the systemic toxicity of IFNα. METHODS: We utilized phage display library screening to identify short peptides that specifically bind to Jurkat T lymphocyte leukemia cells. By fusing the Jurkat-binding peptide to the C-terminus of IFNα, we constructed an engineered chimeric IFNα molecule (IFNP) for the treatment of ATL. RESULTS: We found that IFNP exhibited significantly higher activity than wild type IFNα in inhibiting the growth of leukemia cells and inducing cell blockage at the G0/G1 phase. The synthetic IFNP molecule exerted its antitumor activity by upregulating the downstream genes involved in the STAT1 pathway and in apoptosis. Using a cell receptor binding assay, we showed that this Jurkat-binding peptide facilitated the binding affinity of IFNα to the cell surface type I IFN receptor. CONCLUSION: The isolated Jurkat-binding peptide significantly potentiates the therapeutic activity of IFNα in T lymphocyte leukemia cells. The engineered IFNP molecule may prove to a novel antitumor approach in the treatment of patients with ATL.

N-Cadherin Maintains the Healthy Biology of Nucleus Pulposus Cells under High-Magnitude Compression.

BACKGROUND/AIMS: Mechanical load can regulate disc nucleus pulposus (NP) biology in terms of cell viability, matrix homeostasis and cell phenotype. N-cadherin (N-CDH) is a molecular marker of NP cells. This study investigated the role of N-CDH in maintaining NP cell phenotype, NP matrix synthesis and NP cell viability under high-magnitude compression. METHODS: Rat NP cells seeded on scaffolds were perfusion-cultured using a self-developed perfusion bioreactor for 5 days. NP cell biology in terms of cell apoptosis, matrix biosynthesis and cell phenotype was studied after the cells were subjected to different compressive magnitudes (low- and high-magnitudes: 2% and 20% compressive deformation, respectively). Non-loaded NP cells were used as controls. Lentivirus-mediated N-CDH overexpression was used to further investigate the role of N-CDH under high-magnitude compression. RESULTS: The 20% deformation compression condition significantly decreased N-CDH expression compared with the 2% deformation compression and control conditions. Meanwhile, 20% deformation compression increased the number of apoptotic NP cells, up-regulated the expression of Bax and cleaved-caspase-3 and down-regulated the expression of Bcl-2, matrix macromolecules (aggrecan and collagen II) and NP cell markers (glypican-3, CAXII and keratin-19) compared with 2% deformation compression. Additionally, N-CDH overexpression attenuated the effects of 20% deformation compression on NP cell biology in relation to the designated parameters. CONCLUSION: N-CDH helps to restore the cell viability, matrix biosynthesis and cellular phenotype of NP cells under high-magnitude compression.

Valproic Acid Enhances iPSC Induction From Human Bone Marrow-Derived Cells Through the Suppression of Reprogramming-Induced Senescence.

Reprogramming of human somatic cells into pluripotent cells (iPSCs) by defined transcription factors is an extremely inefficient process. Treatment with the histone deacetylase inhibitor valproic acid (VPA) during reprogramming can improve the induction of iPSCs. To examine the specific mechanism underlying the role of VPA in reprogramming, we transfected human bone marrow-derived cells (HSC-J2 and HSC-L1) with lentiviruses carrying defined factors (OCT4, SOX2, KLF4, and c-MYC, OSKM) in the presence of VPA. We found that, OSKM lentiviruses caused significant senescence in transfected cells. Administration of VPA, however, significantly suppressed this reprogramming-induced stress. Notably, VPA treatment improved cell proliferation in the early stages of reprogramming, and this was related to the down-regulation of the activated p16/p21 pathway. In addition, VPA also released the G2/M phase blockade in lentivirus-transfected cells. This study demonstrates a new mechanistic role of the histone deacetylase inhibitor in enhancing the induction of pluripotency. J. Cell. Physiol. 231: 1719-1727, 2016. © 2015 Wiley Periodicals, Inc.

Low-dose radiation may be a novel approach to enhance the effectiveness of cancer therapeutics.

It has been generally accepted that both natural and man-made sources of ionizing radiation contribute to human exposure and consequently pose a possible risk to human health. However, accumulating evidence has shown that the biological effects of low-dose radiation (LDR) are different from those of high-dose radiation. LDR can stimulate proliferation of normal cells and activate their defense systems, while these biological effects are not observed in some cancer cell types. Although there is still no concordance on this matter, the fact that LDR has the potential to enhance the effects of cancer therapeutics and reduce the toxic side effects of anti-cancer therapy has garnered significant interest. Here, we provide an overview of the current knowledge regarding the experimental data detailing the different responses of normal and cancer tissues to LDR, the underlying mechanisms, and its significance in clinical application.

Histone deacetylase inhibitor valproic acid promotes the induction of pluripotency in mouse fibroblasts by suppressing reprogramming-induced senescence stress.

Histone deacetylase inhibitor valproic acid (VPA) has been used to increase the reprogramming efficiency of induced pluripotent stem cell (iPSC) from somatic cells, yet the specific molecular mechanisms underlying this effect is unknown. Here, we demonstrate that reprogramming with lentiviruses carrying the iPSC-inducing factors (Oct4-Sox2-Klf4-cMyc, OSKM) caused senescence in mouse fibroblasts, establishing a stress barrier for cell reprogramming. Administration of VPA protected cells from reprogramming-induced senescent stress. Using an in vitro pre-mature senescence model, we found that VPA treatment increased cell proliferation and inhibited apoptosis through the suppression of the p16/p21 pathway. In addition, VPA also inhibited the G2/M phase blockage derived from the senescence stress. These findings highlight the role of VPA in breaking the cell senescence barrier required for the induction of pluripotency.

A novel antisense long noncoding RNA within the IGF1R gene locus is imprinted in hematopoietic malignancies.

Dysregulation of the insulin-like growth factor type I receptor (IGF1R) has been implicated in the progression and therapeutic resistance of malignancies. In acute myeloid leukemia (AML) cells, IGF1R is one of the most abundantly phosphorylated receptor tyrosine kinases, promoting cell growth through the PI3K/Akt signaling pathway. However, little is known regarding the molecular mechanisms underlying IGF1R gene dysregulation in cancer. We discovered a novel intragenic long noncoding RNA (lncRNA) within the IGF1R locus, named IRAIN, which is transcribed in an antisense direction from an intronic promoter. The IRAIN lncRNA was expressed exclusively from the paternal allele, with the maternal counterpart being silenced. Using both reverse transcription-associated trap and chromatin conformation capture assays, we demonstrate that this lncRNA interacts with chromatin DNA and is involved in the formation of an intrachromosomal enhancer/promoter loop. Knockdown of IRAIN lncRNA with shRNA abolishes this intrachromosomal interaction. In addition, IRAIN was downregulated both in leukemia cell lines and in blood obtained from high-risk AML patients. These data identify IRAIN as a new imprinted lncRNA that is involved in long-range DNA interactions.

Unique Dual Functions for Carbon Dots in Emulsion Preparations: Costabilization and Fluorescence Probing.

Recently, carbon dots (CDs) have drawn much attention as evidenced by their incorporation into many branches of science and engineering. Herein, a further unique application is elucidated: CDs that are synthesized by the hydrothermal treatment of gelatin for a dual functionality as expressed in costabilization of particle-based emulsions and their concomitant role as fluorescent probes. CDs either with or without gelatin matrixes induce the aggregation of Laponite particles. The introduction of CDs thus enhanced the stability of Laponite-stabilized emulsions and promoted the formation of multiple emulsions and emulsions with fine and uniform droplets when the CD-to-Laponite mass ratio was less than 45% and exceeded 60%, respectively. However, CDs without gelatin matrixes show slightly higher efficiency than CDs within gelatin matrixes for the costabilization of emulsions. CDs also costabilized emulsions with Laponite to allow the distribution of Laponite particles to be traced and the emulsion profiled under UV.

Transparent, super stretchable, freezing-tolerant, self-healing ionic conductive cellulose based eutectogel for multi-functional sensors.

In this study, we propose a non - toxic and low-cost fabrication of cellulose-based eutectogel through the ZnCl2/H2O/H3PO4 deep eutectic solvent (DES) to dissolve cellulose followed by free-radical polymerization of acrylamide. Particularly, the introduction of cellulose enhances the mechanical properties of eutectogels while eliminating the environmental concerns of the traditional nanocellulose fabrication process. Owing to the dynamic transfer of ions in the eutectogel network, the prepared eutectogels exhibit adjustable conductivity (0.9- 1.37 Sm-1, 15 °C) and stretching sensitivity (Gauge factor = 5.4). The resulting DES - cellulose-based eutectogels (DCEs) exhibited ultra stretchability (4086 %), high toughness (261.3 MJ/m3), excellent ionic conductivity (1.64 Sm-1, 20 °C), high transparency (>85 %), outstanding antifreezing performance (<-80 °C), and other comprehensive characteristics. The DCEs had been proven to have multiple sensitivities to external stimuli, like temperature, strain, and pressure. As a result, the DCEs can be assembled into multifunctional sensors. Moreover, this work also demonstrated the satisfactory performance of DCEs in flexible electroluminescent devices. The low cost and high efficiency made the preparation method of this experiment an efficient strategy for developing high-performance cellulose-based eutectogels, which would greatly promote the application of such materials in areas such as artificial skin for soft robots and other wearable devices.

A comprehensive review of the literature on CD10: its function, clinical application, and prospects.

CD10, a zinc-dependent metalloprotease found on the cell surface, plays a pivotal role in an array of physiological and pathological processes including cardiovascular regulation, immune function, fetal development, pain response, oncogenesis, and aging. Recognized as a biomarker for hematopoietic and tissue stem cells, CD10 has garnered attention for its prognostic potential in the progression of leukemia and various solid tumors. Recent studies underscore its regulatory significance and therapeutic promise in combating Alzheimer's disease (AD), and it is noted for its protective role in preventing heart failure (HF), obesity, and type-2 diabetes. Furthermore, CD10/substance P interaction has also been shown to contribute to the pain signaling regulation and immunomodulation in diseases such as complex regional pain syndrome (CRPS) and osteoarthritis (OA). The emergence of COVID-19 has sparked interest in CD10's involvement in the disease's pathogenesis. Given its association with multiple disease states, CD10 is a prime therapeutic target; inhibitors targeting CD10 are now being advanced as therapeutic agents. This review compiles recent and earlier literature on CD10, elucidating its physicochemical attributes, tissue-specific expression, and molecular functions. Furthermore, it details the association of CD10 with various diseases and the clinical advancements of its inhibitors, providing a comprehensive overview of its growing significance in medical research.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].

Lignosulfonate sodium and ionic liquid synergistically promote tough hydrogels for intelligent wearable human-machine interaction.

Flexible wearable devices are garnering significant interest, with conductive hydrogels emerging as a particularly notable category. While many of these hydrogels offer impressive conductivity, they often lack the innate ability to adhere autonomously to human skin. The ideal hydrogel should possess both superior adhesion properties and a wide responsive range. This study introduces a novel double-network conductive hydrogel, synthesized from lignosulfonate sodium and ionic liquid using a one-pot method. The gel's mechanical robustness (fracture elongation of ∼3500 % and tensile strength of ∼130 kPa) and exceptional conductivity sensing performance arise from the synergistic effects of electrostatic interactions, dynamic hydrogen bonding, and a three-dimensional network structure. Additionally, the phenolic hydroxyl and sulfonic groups from lignosulfonate sodium imbue the hydrogel with adhesive qualities, allowing it to easily bond with varied material surfaces. This hydrogel excels in human physiological signal detection and wireless monitoring, demonstrating a rapid response time (149 ms) and high sensitivity (a maximum gauge factor of 10.9 for strains between 400 and 600 %). Given these properties, the flexible, self-adhesive, and conductive hydrogel showcases immense promise for future applications in wearable devices and wireless transmission sensing.

Schiff base and coordinate bonds cross-linked chitosan-based eutectogels with ultrafast self-healing, self-adhesive, and anti-freezing capabilities for motion detection.

Ion conductors offer great potential for diverse electric applications. However, most of the ion conductors were fabricated from non - degradable petroleum-based polymers with non or low biodegradability, which inevitably leads to resource depletion and waste accumulation. Fabricating ion conductors based on renewable, and sustainable materials is highly desirable and valuable. Herein, a series of eutectogels were designed through dual-dynamic-bond cross-linking among ferric iron (Fe3+), protocatechualdehyde (PA), and chitosan (CS) in 1 - allyl-3 - methylimidazole chloride ionic liquid/urea (AmimCl/urea) eutectic-based ionic liquid. Due to the presence of AmimCl/urea eutectic-based ionic liquid, the obtained CS - PA@Fe eutectogels showed excellent ionic conductivity, superior anti-freezing properties that could maintain flexibility and high electrical properties at -20 °C. Dual-dynamic-bond cross-linking of catechol-Fe coordinate and dynamic Schiff base bonds equip CS - PA@Fe eutectogels with excellent injectable, and self-healing abilities. Additionally, due to the presence of phenolic hydroxyl groups of PA, the obtained CS - PA@Fe eutectogels present good adhesiveness. Based on the CS - PA@Fe eutectogels, multifunctional flexible strain sensors with high sensitivity, stability, as well as rapid response speed at wide operating temperature ranges were successfully fabricated. Thus, this study offers a promising strategy for fabricating naturally occurring biopolymers based eutectogels, which show great potential as high-performance flexible strain sensors for next-generation wearable electronic devices.

Curcumin-loaded keratin-chitosan hydrogels for enhanced peripheral nerve regeneration.

Peripheral nerve injury often leads to symptoms of motor and sensory impairment, and slow recovery of nerves after injury and limited treatment methods will aggravate symptoms or even lead to lifelong disability. Curcumin can promote peripheral nerve regeneration, but how to accurately deliver the appropriate concentration of curcumin in the local peripheral nerve remains to be solved. In this study, we designed a human hair keratin/chitosan (C/K) hydrogel with sodium tripolyphosphate ions crosslinked to deliver curcumin topically. Chitosan improves the mechanical properties of hydrogels and keratin improves the biocompatibility of hydrogels. C/K hydrogel showed good cytocompatibility, histocompatibility and degradability. In vitro experiments showed that hydrogels can continuously release curcumin for up to 10 days. In addition, a comprehensive analysis of behavioral, electrophysiological, histology, and target organ recovery results in animal experiments showed that locally delivered curcumin can enhance nerve regeneration in addition to hydrogels. In short, we provide a new method that combines the advantages of human hair keratin, chitosan, and curcumin for nerve damage repair.

Mechanistic insight into the degradation of sulfadiazine by electro-Fenton system: Role of different reactive species.

Sulfadiazine (SDZ), a widely used effective antibiotic, is resistant to conventional biological treatment, which is concerning since untreated SDZ discharge can pose a significant environmental risk. Electro-Fenton (EF) technology is a promising advanced oxidation technology for efficiently removing SDZ. However, due to the limitations of traditional experimental methods, there is a lack of in-depth study on the mechanism of ·OH-dominated SDZ degradation in EF process. In this study, an EF system was established for SDZ degradation and the transformation products (TPs) were detected by mass spectrometry. Dynamic thermodynamic, kinetic and wave function analysis of reactants, transition states and intermediates were proposed by density functional theory calculations, which was applied to elucidate the underlying mechanism of SDZ degradation. Experimental results showed that amino, benzene, and pyrimidine sites in SDZ were oxidized by ·OH, producing TPs through hydrogen abstraction and addition reactions. ·OH was kinetically more likely to attack SDZ- than SDZ. Fe(IV) dominated the single-electron transfer oxidation reaction of SDZ, and the formed organic radicals can spontaneously generate the de-SO2 product via Smiles rearrangement. Toxicity experiments showed the toxicity of SDZ and TPs can be greatly reduced. The results of this study promote the understanding of SDZ degradation mechanism in-depth. ENVIRONMENTAL IMPLICATION: Sulfadiazine (SDZ) is one of the antibiotics widely used around the world. However, it has posed a significant environmental risk due to its overuse and cannot be efficiently removed by traditional treatment methods. The lack of in-depth study on SDZ degradation mechanism under reactive species limits the improvement of SDZ degradation efficiency. Therefore, this work focused on SDZ degradation mechanism in-depth under electro-Fenton system through reactive species investigation, mass spectrometry analysis, and theoretical calculation. The results in this study can provide a theoretical basis for improving the SDZ degradation efficiency which will contribute to solving SDZ pollution problems.

CBX2 enhances the progression and TMZ chemoresistance of glioma via EZH2-mediated epigenetic silencing of PTEN expression.

Chromobox (CBX) 2, a member of the CBX protein family and a crucial component of the polycomb repressive complex (PRC), exerts significant influence on the epigenetic regulation of tumorigenesis, including glioma. However, the precise role of CBX2 in glioma has remained elusive. In our study, we observed a substantial upregulation of CBX2 expression in glioma, which displayed a strong correlation with pathological grade, chemoresistance, and unfavorable prognosis. Through a series of in vivo and in vitro experiments, we established that heightened CBX2 expression facilitated glioma cell proliferation and bolstered resistance to chemotherapy. Conversely, CBX2 knockdown led to a significant inhibition of glioma cell growth and a reduction in chemoresistance. Notably, our investigation uncovered the underlying mechanism by which CBX2 operates, primarily by inhibiting PTEN transcription and activating the AKT/mTOR signalling pathway. Conversely, silencing CBX2 curtailed cell proliferation and attenuated chemoresistance by impeding the activation of the PTEN/AKT/mTOR signalling pathway. Delving deeper into the molecular intricacies, we discovered that CBX2 can recruit EZH2 and modulate the trimethylation of histone H3 lysine 27 (H3K27me3) levels on the PTEN promoter, effectively suppressing PTEN transcription. Our research unveils a comprehensive understanding of how CBX2 impacts the tumorigenesis, progression, chemoresistance, and prognosis of glioma. Furthermore, it presents CBX2 as a promising therapeutic target for drug development and clinical management of glioma.

Fabrication and characterization of an alginate-based film incorporated with cinnamaldehyde for fruit preservation.

Sodium alginate (SA) is widely used in the food, biomedical, and chemical industries due to its biocompatibility, biodegradability, and excellent film-forming properties. This article introduces a simple method for preparing uniform alginate-based packaging materials with exceptional properties for fruit preservation. The alginate was uniformly crosslinked by gradually releasing calcium ions triggered by the sustained hydrolysis of gluconolactone (GDL). A cinnamaldehyde (CA) emulsion, stabilized by xanthan without the use of traditional surfactants, was tightly incorporated into the alginate film to enhance its antimicrobial, antioxidant, and UV shielding properties. The alginate-based film effectively blocked ultraviolet rays in the range of 400-200 nm, while allowing for a visible light transmittance of up to 70 %. Additionally, it showed an increased water contact angle and decreased water vapor permeability. The alginate-based film was also employed in the preparation of coated paper through the commonly used coating process in the papermaking industry. The alginate-based material displayed excellent antioxidant properties and antimicrobial activity against Escherichia coli, Staphylococcus aureus and Botrytis cinerea, successfully extending the shelf life of strawberries to 7 days at room temperature. This low-cost and facile method has the potential to drive advancements in the food and biomedical fields by tightly incorporating active oil onto a wide range of biomacromolecule substrates.