Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 66
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
BMC Genomics ; 24(1): 384, 2023 Jul 10.
Artigo em Inglês | MEDLINE | ID: mdl-37430212

RESUMO

BACKGROUND: The chlorophyll content (CC) is a key factor affecting maize photosynthetic efficiency and the final yield. However, its genetic basis remains unclear. The development of statistical methods has enabled researchers to design and apply various GWAS models, including MLM, MLMM, SUPER, FarmCPU, BLINK and 3VmrMLM. Comparative analysis of their results can lead to more effective mining of key genes. RESULTS: The heritability of CC was 0.86. Six statistical models (MLM, BLINK, MLMM, FarmCPU, SUPER, and 3VmrMLM) and 1.25 million SNPs were used for the GWAS. A total of 140 quantitative trait nucleotides (QTNs) were detected, with 3VmrMLM and MLM detecting the most (118) and fewest (3) QTNs, respectively. The QTNs were associated with 481 genes and explained 0.29-10.28% of the phenotypic variation. Additionally, 10 co-located QTNs were detected by at least two different models or methods, three co-located QTNs were identified in at least two different environments, and six co-located QTNs were detected by different models or methods in different environments. Moreover, 69 candidate genes within or near these stable QTNs were screened based on the B73 (RefGen_v2) genome. GRMZM2G110408 (ZmCCS3) was identified by multiple models and in multiple environments. The functional characterization of this gene indicated the encoded protein likely contributes to chlorophyll biosynthesis. In addition, the CC differed significantly between the haplotypes of the significant QTN in this gene, and CC was higher for haplotype 1. CONCLUSION: This study's results broaden our understanding of the genetic basis of CC, mining key genes related to CC and may be relevant for the ideotype-based breeding of new maize varieties with high photosynthetic efficiency.


Assuntos
Clorofila , Zea mays , Zea mays/genética , Estudo de Associação Genômica Ampla , Melhoramento Vegetal , Fotossíntese , Nucleotídeos
2.
Anim Biotechnol ; 34(3): 574-584, 2023 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-34629027

RESUMO

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.


Assuntos
Pesos e Medidas Corporais , Polimorfismo de Nucleotídeo Único , Bovinos/genética , Animais , Genótipo , Haplótipos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo
3.
Anim Biotechnol ; 33(2): 312-320, 2022 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32772770

RESUMO

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.


Assuntos
Mutação INDEL , Polimorfismo Genético , Animais , Genótipo , Mutação INDEL/genética , Coativador 1-alfa do Receptor gama Ativado por Proliferador de Peroxissomo/genética , Fenótipo , Polimorfismo Genético/genética , Ovinos/genética
4.
Anim Biotechnol ; 33(1): 1-12, 2022 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-32367774

RESUMO

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.


Assuntos
Mutação INDEL , Animais , Peso Corporal , Bovinos/genética , Expressão Gênica , Genótipo , Mutação INDEL/genética , Fenótipo
5.
Cancer Cell Int ; 21(1): 130, 2021 Feb 23.
Artigo em Inglês | MEDLINE | ID: mdl-33622332

RESUMO

BACKGROUND: Breast cancer (BC) remains a prevalent and common form of cancer with high heterogeneity. Making efforts to explore novel molecular biomarkers and serve as potential disease indicators, which is essential to effectively enhance the prognosis and individualized treatment of BC. FBXO proteins act as the core component of E3 ubiquitin ligase, which play essential regulators roles in multiple cellular processes. Recently, research has indicated that FBXOs also play significant roles in cancer development. However, the molecular functions of these family members in BC have not been fully elucidated. METHODS: In this research, we investigated the expression data, survival relevance and mutation situation of 10 FBXO members (FBXO1, 2, 5, 6, 16, 17, 22, 28, 31 and 45) in patients with BC from the Oncomine, GEPIA, HPA, Kaplan-Meier Plotter, UALCAN and cBioPortal databases. The high transcriptional levels of FBXO1 in different subtypes of BC were verified by immunohistochemical staining and the specific mutations of FBXO1 were obtained from COSMIC database. Top 10 genes with the highest correlation to FBXO1 were identified through cBioPortal and COXPRESdb tools. Additionally, functional enrichment analysis, PPI network and survival relevance of FBXO1 and co-expressed genes in BC were obtained from DAVID, STRING, UCSC Xena, GEPIA, bc-GenExMiner and Kaplan-Meier Plotter databases. FBXO1 siRNAs were transfected into MCF-7 and MDA-MB-231 cell lines. Expression of FBXO1 in BC cell lines was detected by western-blot and RT-qPCR. Cell proliferation was detected by using CCK-8 kit and colony formation assay. Cell migration was detected by wound-healing and transwell migration assay. RESULTS: We found that FBXO2, FBXO6, FBXO16 and FBXO17 were potential favorable prognostic factors for BC. FBXO1, FBXO5, FBXO22, FBXO28, FBXO31 and FBXO45 may be the independent poor prognostic factors for BC. All of them were correlated to clinicopathological staging. Moreover, knockdown of FBXO1 in MCF7 and MDA-MB-231 cell lines resulted in decreased cell proliferation and migration in vitro. We identified that FBXO1 was an excellent molecular biomarker and therapeutic target for different molecular typing of BC. CONCLUSION: This study implies that FBXO1, FBXO2, FBXO5, FBXO6, FBXO16, FBXO17, FBXO22, FBXO28, FBXO31 and FBXO45 genes are potential clinical targets and prognostic biomarkers for patients with different molecular typing of BC. In addition, the overexpression of FBXO1 is always found in breast cancer and predicts disadvantageous prognosis, implicating it could as an appealing therapeutic target for breast cancer patients.

6.
BMC Cancer ; 21(1): 875, 2021 Jul 30.
Artigo em Inglês | MEDLINE | ID: mdl-34330233

RESUMO

BACKGROUND: Occult metastases in axillary lymph nodes have been reported to be associated with poor prognosis in patients with breast cancer. However, studies on the prognostic value of occult metastases have shown controversial results. This meta-analysis aimed to evaluate the prognostic significance of occult lymph node metastases in breast cancer. METHODS: Studies published until May, 2020, which retrospectively examined negative lymph nodes by stepsectioning and/or immunohistochemistry, were retrieved from MEDLINE, EMBASE, CNKI, and Cochrane Library databases. The pooled Relative Risk (RR) with 95% confidence interval (95% CI) for overall survival (OS) and disease-free survival (DFS) were calculated to examine the associations between occult metastases and prognosis. RESULTS: Patients with occult metastases in axillary lymph nodes had poorer five-year DFS (RR = 0.930; 95% CI = 0.907-0.954) and OS (RR = 0.972; 95% CI = 0.954-0.990). Furthermore, the DFS (RR = 0.887; 95% CI = 0.810-0.972) and OS (RR = 0.896; 95% CI = 0.856-0.939) of patients with occult metastases were significantly lower after a ten-year follow-up. CONCLUSIONS: Occult metastases in the axillary lymph nodes are associated with poorer DFS andOS of patients with breast cancer. Occult metastases might serve as a predictive factor of survival outcomes in patients with breast cancer.


Assuntos
Neoplasias da Mama/mortalidade , Neoplasias da Mama/patologia , Linfonodos/patologia , Axila/patologia , Intervalo Livre de Doença , Feminino , Humanos , Metástase Linfática , Prognóstico , Viés de Publicação , Recidiva , Risco
7.
Phys Chem Chem Phys ; 23(47): 26822-26828, 2021 Dec 08.
Artigo em Inglês | MEDLINE | ID: mdl-34817481

RESUMO

Laying-down gold nanorods (GNRs) of a monolayer immobilized on a solid substrate was realized with a hybrid method, a combination of three elemental technologies: surface modification, electrophoresis, and solvent evaporation. The self-assembly of CTAB-protected GNRs in the solution was induced by 0.05 mM of EDTA. The assembled GNRs were deposited in a laying-down form on the solid surface during the hybrid method. The final coverage was over 71% on the substrate with an area larger than 0.6 cm2. The spacing between the sides of the GNRs was fixed to be 4.6 ± 0.9 nm by the thermal annealing-promoted crystalline packing of the bilayer of CTAB salt-bridged with EDTA. The obtained laying-down GNRs of a monolayer on the gold substrate show a small shift of the transverse LSPR around 550-570 nm (with a width of around 100 nm) and a large red shift of the longitudinal LSPR to be 900-1050 nm (with a width of 500 nm), because of the strong electromagnetic coupling between the GNRs and gold substrate. Therefore it can be used in a wide range of wavelengths for surface enhanced Raman spectroscopy (SERS) applications. The film has a high enhancement factor with 105 for R6G.

8.
Nucleic Acids Res ; 47(15): 8239-8254, 2019 09 05.
Artigo em Inglês | MEDLINE | ID: mdl-31216022

RESUMO

XAB2 is a multi-functional protein participating processes including transcription, splicing, DNA repair and mRNA export. Here, we report POLR2A, the largest catalytic subunit of RNA polymerase II, as a major target gene down-regulated after XAB2 depletion. XAB2 depletion led to severe splicing defects of POLR2A with significant intron retention. Such defects resulted in substantial loss of POLR2A at RNA and protein levels, which further impaired global transcription. Treatment of splicing inhibitor madrasin induced similar reduction of POLR2A. Screen using TMT-based quantitative proteomics identified several proteins involved in mRNA surveillance including Dom34 with elevated expression. Inhibition of translation or depletion of Dom34 rescued the expression of POLR2A by stabilizing its mRNA. Immuno-precipitation further confirmed that XAB2 associated with spliceosome components important to POLR2A expression. Domain mapping revealed that TPR motifs 2-4 and 11 of XAB2 were critical for POLR2A expression by interacting with SNW1. Finally, we showed POLR2A mediated cell senescence caused by XAB2 deficiency. Depletion of XAB2 or POLR2A induced cell senescence by up-regulation of p53 and p21, re-expression of POLR2A after XAB2 depletion alleviated cellular senescence. These data together support that XAB2 serves as a guardian of POLR2A expression to ensure global gene expression and antagonize cell senescence.


Assuntos
Senescência Celular/genética , RNA Polimerases Dirigidas por DNA/genética , Íntrons/genética , Fatores de Transcrição/genética , Transcrição Gênica , Linhagem Celular , Linhagem Celular Tumoral , RNA Polimerases Dirigidas por DNA/metabolismo , Células HEK293 , Células HeLa , Humanos , Interferência de RNA , Splicing de RNA , Fatores de Processamento de RNA , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Fatores de Transcrição/metabolismo , Proteína Supressora de Tumor p53/genética , Proteína Supressora de Tumor p53/metabolismo
9.
Anim Biotechnol ; 32(2): 194-204, 2021 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-31625451

RESUMO

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.


Assuntos
Ovinos/crescimento & desenvolvimento , Ovinos/genética , Transdução de Sinais/genética , Fator de Crescimento Transformador beta/genética , Animais , Genótipo , Mutação INDEL , Proteínas de Ligação a TGF-beta Latente/genética , Proteínas de Ligação a TGF-beta Latente/metabolismo , Reação em Cadeia da Polimerase , Transdução de Sinais/fisiologia , Proteína Smad4/genética , Proteína Smad4/metabolismo , Trombospondina 1/genética , Trombospondina 1/metabolismo
10.
J Surg Oncol ; 121(6): 964-966, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-32103507

RESUMO

BACKGROUND: Near-infrared (NIR) fluorescence imaging has recently been introduced to the sentinel lymph node (SLN) mapping because of the benefits of the SLN biopsy, such as providing real-time and high-resolution optical guidance. Methylene blue is available and less expensive as an SLN mapping tracer. Our study aims to identify SLN through the NIR fluorescence imaging system mediated by blue dye. METHODS: Early-stage breast cancer patients were prospectively enrolled. All participants received a subareolar or peritumoral injection of 1 mL methylene blue (MB) before surgery. The MB fluorescence system was set immediately after injection. SLNs were searched and removed under the guidance of fluorescence and blue dye. RESULTS: We identified SLN adequately with the help of real-time lymphography and blue dye. Symbolic lymphatic drainage patterns were also observed. CONCLUSION: NIR fluorescence imaging mediated by blue dye has benefits on the identification of lymph vessels, the location of SLN, and the patterns of breast lymphatic flow.


Assuntos
Neoplasias da Mama/diagnóstico por imagem , Azul de Metileno , Linfonodo Sentinela/diagnóstico por imagem , Espectroscopia de Luz Próxima ao Infravermelho/métodos , Neoplasias da Mama/patologia , Corantes , Sistemas Computacionais , Feminino , Humanos , Linfografia/métodos , Estadiamento de Neoplasias , Linfonodo Sentinela/patologia , Espectrometria de Fluorescência/métodos
11.
Methods ; 168: 84-93, 2019 09 15.
Artigo em Inglês | MEDLINE | ID: mdl-30953758

RESUMO

This study aims to obtain water-soluble fluorescent carbon dots (C-dots) from low-value metabolites through a simple, economical, one-step synthetic route. The urine C-dots (UCDs) and hydrothermally treated urine C-dots (HUCDs) were obtained, respectively, using straightforward Sephadex filtration method from human adults and hydrothermal reaction method. The UCDs and HUCDs emit fluorescence upon being excited with ultraviolet light with a quantum yield of 4.8% and 17.8%, respectively. TEM analysis revealed that UCDs and HUCDs had an average size of 2.5 nm and 5.5 nm, respectively. X-ray photoelectron spectroscopy (XPS) analysis showed the UCDs and HUCDs were mainly composed of carbon, oxygen and nitrogen. Fourier-transform infrared (FTIR) spectroscopy demonstrated the presence of functional groups, such as amino, hydroxyl, carboxylate and carbonyl groups onto the C-dots. The UCDs and HUCDs can be directly used for in vivo and in vitro imaging in Hela cells, Caenorhabditis elegans, onion epidermal cells and bean sprouts. The cytotoxicity study revealed that the UCDs and HUCDs were not toxic to normal rat kidney (NKR) cells with good biocompatibility. The results revealed that the C-dots derived from urine have good biocompatibility, strong fluorescence and may have potential to be a safe fluorescent probe for bio-imaging.


Assuntos
Materiais Biocompatíveis/química , Corantes Fluorescentes/farmacologia , Pontos Quânticos/química , Urina/química , Animais , Caenorhabditis elegans , Carbono , Escherichia coli/metabolismo , Fluorescência , Células HeLa , Humanos , Concentração de Íons de Hidrogênio , Rim/metabolismo , Microscopia Eletrônica de Transmissão , Nitrogênio , Cebolas , Tamanho da Partícula , Espectroscopia Fotoeletrônica , Ratos , Espectroscopia de Infravermelho com Transformada de Fourier , Raios Ultravioleta , Urinálise
12.
Anim Biotechnol ; 31(6): 504-511, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31253059

RESUMO

Pleomorphic adenoma gene 1 (PLAG1) encodes a developmentally regulated zinc finger protein, locating in growth-related QTNs. The mRNA expression of this gene was investigated in different tissues and from two different developmental periods, whilst to explore the functions of PLAG1 in growth traits of cattle. The results showed that PLAG1 was expressed in all examined tissues. However, PLAG1 expression levels in all examined tissues were significantly different between the 5-month fetus and 36-month adult cattle. Our juvenile results indicated PLAG1 is primarily expressed in embryonic tissues of Chinese cattle. Furthermore, two variations were identified. Association analysis revealed that the two variations were associated with growth traits (p < 0.05 or p < 0.01). These new findings provide a comprehensive overview of the critical roles of PLAG1 in growth traits modulation and can be highlighted as candidate molecular markers in cattle breeding.


Assuntos
Bovinos/crescimento & desenvolvimento , Bovinos/genética , Proteínas de Ligação a DNA , Animais , Cruzamento , Proteínas de Ligação a DNA/análise , Proteínas de Ligação a DNA/genética , Proteínas de Ligação a DNA/metabolismo , Estudo de Associação Genômica Ampla , Masculino , Polimorfismo de Nucleotídeo Único/genética , RNA Mensageiro/análise , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Dedos de Zinco/genética
13.
Anim Biotechnol ; 29(4): 276-282, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29200321

RESUMO

In China, Tong sheep (TS) and Lanzhou fat-tailed sheep (LFTS) are two closely relative endanger breeds for low meat production and low fecundity, finding some marker-assisted selected (MAS) is our first priority for improving their growth traits. For this purpose, Hu sheep (HS) and small-tailed Han sheep (STHS) were compared with two endangered breeds (TS and LFTS). Paired-liked homeodomain transcription factor 2 (PITX2) gene was the important member of PITX family, which could adjust animal growth through hypothalamic-pituitary-adrenal axis. During the past years, insertion/deletion (indel) has become increasingly popular in application as MAS. In this study, two novel indel loci were identified, and five significant differences, including chest width, hip width, chest depth, chest circumference, and body height, were found between different breeds. Interestingly, there was no DD genotype and smaller number of ID genotye. All the ID genotypes were significantly greater than II genotype, which was to say the allele of "D" was dominant variation and its frequency was lower, which demonstrated that it has huge space for selection. Briefly, the two indel were potential and useful DNA markers for selecting excellent individuals in relation to growth traits in sheep.


Assuntos
Fertilidade/genética , Variação Genética , Ovinos/genética , Alelos , Animais , Cruzamento , Feminino , Marcadores Genéticos/genética , Genótipo , Sistema Hipotálamo-Hipofisário/crescimento & desenvolvimento , Mutação INDEL , Masculino , Fenótipo , Sistema Hipófise-Suprarrenal/crescimento & desenvolvimento , Ovinos/crescimento & desenvolvimento
14.
Mol Cancer ; 16(1): 60, 2017 03 14.
Artigo em Inglês | MEDLINE | ID: mdl-28288624

RESUMO

As an atypical member of cyclin dependent kinase family, Cyclin dependent kinase 5 (Cdk5) is considered as a neuron-specific kinase in the past decade due to the abundant existence of its activator p35 in post-mitotic neurons. Recent studies show that Cdk5 participates in a series of biological and pathological processes in non-neuronal cells, and is generally dysregulated in various cancer cells. The inhibition or knockdown of Cdk5 has been proven to play an anti-cancer role through various mechanisms, and can synergize the killing effect of chemotherapeutics. DNA damage response (DDR) is a series of regulatory events including DNA damage, cell-cycle arrest, regulation of DNA replication, and repair or bypass of DNA damage to ensure the maintenance of genomic stability and cell viability. Here we describe the regulatory mechanisms of Cdk5, its controversial roles in apoptosis and focus on its links to DDR and cancer.


Assuntos
Quinase 5 Dependente de Ciclina/metabolismo , Dano ao DNA , Neoplasias/genética , Neoplasias/metabolismo , Animais , Apoptose , Pontos de Checagem do Ciclo Celular , Quinase 5 Dependente de Ciclina/antagonistas & inibidores , Quinase 5 Dependente de Ciclina/genética , Replicação do DNA , Regulação Neoplásica da Expressão Gênica , Humanos , Terapia de Alvo Molecular , Neoplasias/tratamento farmacológico , Neoplasias/patologia , Ligação Proteica , Transdução de Sinais/efeitos dos fármacos
15.
Environ Res ; 159: 1-8, 2017 11.
Artigo em Inglês | MEDLINE | ID: mdl-28759783

RESUMO

Polybrominated diphenylethers (PBDE) have been demonstrated to be associated with significant alterations in hormone levels in humans. However, yet few epidemiological human evidence has associated thyroid function with hydroxylated polybrominated diphenylethers (OH-PBDEs), which may be more potent in disrupting thyroid hormone homeostasis. In the present study, the body burdens of 7 PBDEs and 11 OH-PBDEs as well as the serum thyroid status were examined in a cohort of 33 thyroid cancer patients. The levels of ∑PBDEs and ∑OH-PBDEs ranged from 1.07 to 39ng/g lipid, and 0.01-0.46ng/g lipid, respectively. BDE-47, 6-OH-BDE-47 and 3-OH-BDE-47 were the predominant congeners. The associations between these PBDE congeners and thyroid function were not significant after controlling for sociodemographic characteristics, as well as the associations between OH-PBDEs and free T3. There were an inverse association between lg3-OH-BDE-47 and lgFT4 (free T4) but a positive association between lg4'-OH-BDE-49 and TSH. Both lgΣ5OH-PBDEs (the sum of HO-tetra-BDEs) and lgΣOH-PBDEs were significantly and positively associated with lgTSH. Our results are consistent with most human studies, suggesting that OH-PBDEs can alter thyroid function by enhancing the elimination of serum FT4 with elevated TSH levels. To our knowledge, this is the first study to examine and report associations between OH-PBDEs and thyroid function in a cancer population.


Assuntos
Exposição Ambiental , Éteres Difenil Halogenados/sangue , Glândula Tireoide/efeitos dos fármacos , Hormônios Tireóideos/metabolismo , Neoplasias da Glândula Tireoide/sangue , Neoplasias da Glândula Tireoide/fisiopatologia , Tireotropina/metabolismo , Adulto , Monitoramento Ambiental , Feminino , Humanos , Hidroxilação , Masculino , Pessoa de Meia-Idade , Testes de Função Tireóidea , Neoplasias da Glândula Tireoide/metabolismo , Tiroxina/metabolismo , Tri-Iodotironina/metabolismo
16.
J Reconstr Microsurg ; 32(9): 688-698, 2016 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-27487485

RESUMO

Background Microsurgical vascularized lymph node transfer (VLNT) and supermicrosurgical lymphaticovenular anastomosis (LVA) are increasingly performed to treat lymphedema. The surgical outcome is commonly assessed by volume-based measurement (VBM), a method that is not consistently reliable. We describe indocyanine green (ICG) lymphography as an alternative postoperative tracking modality after lymphatic reconstruction with VLNT and LVA. Methods VLNT and LVA were performed in patients with therapy-refractory lymphedema. Patients were evaluated qualitatively by clinical assessment, quantitatively with VBM, and lymphographically using ICG lymphography. The evaluation was performed preoperatively, and at 3, 6, and 12-month postoperatively. Results Overall, 21 patients underwent lymphatic reconstruction with either VLNT or LVA. All reported prompt and durable relief of symptoms during the study period. All experienced disease regression based on the Campisi criteria. Out of the 21 patients, 20 (95%) demonstrated lymphographic down staging of disease severity. Out of the 21 patients, 3 (14%) developed a paradoxical increase in limb volume based on VBM despite clinical improvement. Conclusions ICG lymphography correlated highly with patient self-assessment and clinical examination, and is an effective postoperative tracking modality after lymphatic reconstruction.


Assuntos
Anastomose Cirúrgica/métodos , Corantes/uso terapêutico , Verde de Indocianina/uso terapêutico , Vasos Linfáticos/cirurgia , Linfedema/cirurgia , Linfografia , Microcirurgia , Procedimentos de Cirurgia Plástica/métodos , Idoso , Feminino , Humanos , Vasos Linfáticos/patologia , Linfedema/fisiopatologia , Masculino , Pessoa de Meia-Idade , Resultado do Tratamento
17.
Phys Chem Chem Phys ; 17(46): 31170-6, 2015 Dec 14.
Artigo em Inglês | MEDLINE | ID: mdl-26542353

RESUMO

In the current research, the PtxAgy (x/y = 86/14, 79/21, 52/48, 21/79, 11/89) nanoparticles (NPs) are synthesized in the KNO3-LiNO3 molten salts without using any organic surfactant or solvent. The SEM results suggest that when the content of Ag is higher than 48%, the wormlike PtxAgy nanotubes (NTs) can be synthesized. The diameter of the PtxAgyNTs shows a slow decrease with the increase of Ag content. The TEM and HRTEM results indicate that the growth of hollow PtxAgy NTs undergoes an oriented attachment process and a Kirkendall effect approach. The results of cyclic voltammetry (CV) measurement indicate that the Pt52Ag48 catalyst presents a remarkable enhancement for methanol electrooxidation, while the Pt86Ag14 catalyst prefers electrochemically oxidizing formic acid compared with that of the commercially available Pt black.

18.
ScientificWorldJournal ; 2014: 387640, 2014.
Artigo em Inglês | MEDLINE | ID: mdl-24757420

RESUMO

Intestinal ischemia-reperfusion (I/R) injury is a serious clinical pathophysiological process that may result in acute local intestine and remote liver injury. Protocatechuic acid (PCA), which has been widely studied as a polyphenolic compound, induces expression of antioxidative genes that combat oxidative stress and cell apoptosis. In this study, we investigated the effect of PCA pretreatment for protecting intestinal I/R-induced local intestine and remote liver injury in mice. Intestinal I/R was established by superior mesenteric artery occlusion for 45 min followed by reperfusion for 90 min. After the reperfusion period, PCA pretreatment markedly alleviated intestine and liver injury induced by intestinal I/R as indicated by histological alterations, decreases in serological damage parameters and nuclear factor-kappa B and phospho-foxo3a protein expression levels, and increases in glutathione, glutathione peroxidase, manganese superoxide dismutase protein expression, and Bcl-xL protein expression in the intestine and liver. These parameters were accompanied by PCA-induced adaptor protein p66shc suppression. These results suggest that PCA has a significant protective effect in the intestine and liver following injury induced by intestinal I/R. The protective effect of PCA may be attributed to the suppression of p66shc and the regulation of p66shc-related antioxidative and antiapoptotic factors.


Assuntos
Hidroxibenzoatos/uso terapêutico , Mucosa Intestinal/metabolismo , Hepatopatias/metabolismo , Traumatismo por Reperfusão/metabolismo , Proteínas Adaptadoras da Sinalização Shc/fisiologia , Transdução de Sinais/fisiologia , Animais , Hidroxibenzoatos/farmacologia , Intestinos/irrigação sanguínea , Intestinos/efeitos dos fármacos , Hepatopatias/tratamento farmacológico , Masculino , Camundongos , Camundongos Endogâmicos ICR , Substâncias Protetoras/farmacologia , Substâncias Protetoras/uso terapêutico , Distribuição Aleatória , Traumatismo por Reperfusão/prevenção & controle , Transdução de Sinais/efeitos dos fármacos , Proteína 1 de Transformação que Contém Domínio 2 de Homologia de Src
19.
Diagn Pathol ; 19(1): 53, 2024 Mar 20.
Artigo em Inglês | MEDLINE | ID: mdl-38509525

RESUMO

BACKGROUND: Accurately predicting the response to neoadjuvant chemotherapy (NAC) in breast cancer patients is crucial for guiding treatment strategies and enhancing clinical outcomes. Current studies have primarily focused on a limited set of biomarkers. More importantly, the results of many studies are in conflict. To address this, we conducted a comprehensive evaluation of the predictive value of a diverse range of clinically available molecular biomarkers in breast cancer, including HER2, ER, PR, TOPO II, EGFR, Ki67, CK5/6, AR, and p53. Additionally, we assessed changes in these biomarkers after NAC administration. METHODS: Our study involved 189 patients with invasive breast cancer who underwent NAC at our institute. We examined biomarker profiles in core-needle biopsies taken before NAC and in surgical specimens obtained after NAC. We examined the association between these biomarkers and NAC outcomes, focusing on two main aspects: the rate of pathological complete response (pCR) and the reduction in tumor size. We used Chi-square and Mann-Whitney U tests to compare biomarker status changes between pCR and non-pCR patients. Linear regression analysis was employed to evaluate the relationship between biomarker status and tumor shrinkage rate. Additionally, we compared the expression status of these biomarkers before and after NAC using Chi-square and Wilcoxon signed-rank tests. RESULTS AND CONCLUSIONS: Our results demonstrated significant differences in the expression levels of HER2, ER, PR, TOPO II, EGFR, and Ki67 between pCR and non-pCR patients, underscoring their potential as predictive markers for NAC outcomes. Importantly, our results have shed light on the contentious issue surrounding TOPO II in NAC outcome prediction. We have provided evidence that establishes a significantly positive association between TOPO II expression level and the pCR rate. Notably, tumor size was identified as a relevant predictive factor for achieving pCR. Regarding biomarker profiles, only Ki67 levels and TOPO II status exhibited changes following NAC, resolving previous controversies. While the ER and PR status remained unchanged, their expression values exhibited a slight but significant decrease post-NAC. Our results provide clarity and insights into the value and potential of using these biomarkers to predict NAC responses and prognosis in breast cancer patients.


Assuntos
Neoplasias da Mama , Humanos , Feminino , Neoplasias da Mama/patologia , Biomarcadores Tumorais/análise , Antígeno Ki-67/análise , Terapia Neoadjuvante , Prognóstico , Receptores ErbB , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Receptor ErbB-2/metabolismo , Estudos Retrospectivos
20.
ACS Omega ; 9(2): 2597-2605, 2024 Jan 16.
Artigo em Inglês | MEDLINE | ID: mdl-38250415

RESUMO

In this paper, NiSb/NiTe/Ni composites were smoothly developed via the microwave method for supercapacitors. The synthesis of NiSb/NiTe crystals was revealed by X-ray photoelectron spectroscopy and X-ray diffraction. The analytic results of scanning electron microscopy and energy dispersive spectroscopy uncover the microscopic morphology as well as the constituent elements of the composites. Self-supported NiSb/NiTe is a supercapacitor cathode that combines high capacitance with excellent cycling stability. The obtained composite electrode displayed remarkable electrochemical properties, presenting a special capacitance of 1870 F g-1 (1 A g-1) and 81.5% of the original capacity through 30,000 times (10 A g-1) of the charging/discharging process. Further, an asymmetric supercapacitor was prepared employing NiSb/NiTe as a cathode and activated carbon as an anode. NiSb/NiTe//AC exhibited a high energy density of 224.6 uW h cm-2 with a power density of 750 µW cm-2 and provided a favorable cycling stability of 83% after 10,000 cycles.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA