Structure-guided design of novel biphenyl-quinazoline derivatives as potent non-nucleoside reverse transcriptase inhibitors featuring improved anti-resistance, selectivity, and solubility.

In pursuit of enhancing the anti-resistance efficacy and solubility of our previously identified NNRTI 1, a series of biphenyl-quinazoline derivatives were synthesized employing a structure-based drug design strategy. Noteworthy advancements in anti-resistance efficacy were discerned among some of these analogs, prominently exemplified by compound 7ag, which exhibited a remarkable 1.37 to 602.41-fold increase in potency against mutant strains (Y181C, L100I, Y188L, F227L + V106A, and K103N + Y181C) in comparison to compound 1. Compound 7ag also demonstrated comparable anti-HIV activity against both WT HIV and K103N, albeit with a marginal reduction in activity against E138K. Of significance, this analog showed augmented selectivity index (SI > 5368) relative to compound 1 (SI > 37764), Nevirapine (SI > 158), Efavirenz (SI > 269), and Etravirine (SI > 1519). Moreover, it displayed a significant enhancement in water solubility, surpassing that of compound 1, Etravirine, and Rilpivirine. To elucidate the underlying molecular mechanisms, molecular docking studies were undertaken to probe the critical interactions between 7ag and both WT and mutant strains of HIV-1 RT. These findings furnish invaluable insights driving further advancements in the development of DAPYs for HIV therapy.

Design, synthesis and biological evaluation of Thiazolo[3, 2-a]Pyrimidine derivatives as novel RNase H inhibitors.

Targeting Ribonuclease H (RNase H) has been considered a viable strategy for HIV therapy. In this study, a series of novel thiazolo[3, 2-a]pyrimidine derivatives were firstly designed and synthesized as potential inhibitors of HIV-1 RNase H. Among these compounds, A28 exhibited the most potent inhibition against HIV-1 RNase H with an IC50 value of 4.14 µM, which was about 5-fold increase in potency than the hit compound A1 (IC50 = 21.49 µM). To gain deeper insights into the structure-activity relationship (SAR), a CoMFA model was constructed to yield reasonable statistical results (q2 = 0.658 and R2 = 0.969). Results from magnesium ion chelation experiments and molecular docking studies revealed that these thiazolopyrimidine inhibitors may exert their inhibitory activity by binding to an allosteric site on RNase H at the interface between subunits p51 and p66. Furthermore, this analog demonstrated favorable physicochemical properties. Our findings provide valuable groundwork for further development of allosteric inhibitors targeting HIV-1 RNase H.

Differential Occupational Health Risks between Methylated PAHs and PAHs: Monitoring 126 PAHs and 6 Oxidative Stress Markers in Paired Serum-Urine Samples.

The hazards of polycyclic aromatic hydrocarbons (PAHs) on occupationally exposed population have been widely acknowledged. However, the occupational exposure risks associated their derivatives, methylated PAHs, remain poorly understood. This study conducted a screen of 126 PAHs and 6 oxidative stress biomarkers (OSBs) in paired serum-urine samples from 110 petrochemical workers to assess the risk associated with different PAHs exposure. The results showed that the median concentrations of unmetabolized 16 priority PAHs (p-PAHs), 16 regular PAHs (R-PAHs), 50 methyl-PAHs (Me-PAHs), and 30 nitro-PAHs (N-PAHs) in serum (urine) were 97.98 (66.46), 11.02 (0.00), 77.76 (31.77), and 1.93 (0.10) ng/mL, respectively. The median concentration of metabolized hydroxy PAHs (OH-PAHs) in urine was 12.00 ng/mL (9.49 ng/mg creatinine). OSBs indicate that the hazards of Me-PAHs on exposed populations manifest as protein damage, while the hazards of p-PAHs mainly result in lipid and DNA damage. Results from common diseases and PAH exposure demonstrate a correlation between liver damage and PAH exposure, and Me-PAHs are more difficult to metabolize through urine due to their stronger lipophilicity. This study suggests that traditional health screenings targeting p-PAHs may be insufficient and likely underestimate the exposure risks for occupational populations.

Screening of pesticides in serum, urine and cerebrospinal fluid collected from an urban population in China.

Human exposure to pesticides is a topic of public health concern for decades. Pesticide exposures have been assessed through the analysis of urine or blood matrices, but little is known on the accumulation of these chemicals in cerebrospinal fluid (CSF). CSF plays an important role in maintaining physical and chemical balance of the brain and central nervous system and any perturbation can have adverse effects on health. In this study, we investigated the occurrence of 222 pesticides in CSF from 91 individuals using gas chromatography-tandem mass spectrometry (GC-MS/MS). Measured pesticide concentrations in CSF were compared with those in 100 serum and urine specimens from individuals living in the same urban location. Twenty pesticides were found in CSF, serum and urine, at levels above the limit of detection. Three most frequently detected pesticides in CSF were biphenyl (100%), diphenylamine (75%), and hexachlorobenzene (63%). Median concentrations of biphenyl in CSF, serum and urine were 1.11, 10.6, and 1.10 ng/mL, respectively. Six triazole fungicides were found only in CSF, but not in other matrices. To our knowledge, this is the first study to report pesticide concentrations in CSF in a general urban population.

Comparative Efficacy of Antihypertensive Agents in Flow-Mediated Vasodilation of Patients with Hypertension: Network Meta-Analysis of Randomized Controlled Trial.

Hypertension induces both structural and functional changes in blood vessels, thereby increasing endothelial dysfunction, which in turn, contributes to an increase in blood pressure. A popular and widely used noninvasive tool, flow-mediated dilation (FMD), is used to examine peripheral artery endothelium-dependent dilation. This study aimed to compare the efficacies of different classes of antihypertensive agents based on their effects on FMD. PubMed, Embase, and Cochrane Library were queried till November 1, 2020. Comparative studies on the efficacies of two or more antihypertensive agents or placebos for hypertensive patients were included. The outcomes were variations in mean systolic and diastolic blood pressure. Two reviewers independently reviewed and filtered the literature and extracted the data; the Cochrane "risk of bias" method was used to evaluate the methodological quality of the randomized controlled trials. A network meta-analysis was performed using Stata 15.0 software with a total of 49 studies. Subgroup analysis based on age and duration of treatments was performed. As compared to the placebo group, patients receiving the antihypertensive drugs exhibited significantly enhanced FMD (ARB + CCB: 4.01%, 95% CI, 0.92-7.11%, p < 0.001; ACEI + ARB: 2.81%, 95% CI, 1.19-4.43%, p < 0.001; ACEI: 2.55%, 95% CI, 1.34-3.77%, p < 0.001; ARB: 2.22%, 95% CI, 1.05-3.38%, p < 0.001; ß-blocker: 2.23%, 95% CI, 0.93-3.52%, p < 0.001). In the SUCRA curve for network meta-analysis, the combination of CCB and ARB was found to be the most effective in increasing FMD (SUCRA = 89.0%), followed by ACEI monotherapy (SUCRA = 74.2%). ARB combined with CCB was superior in improving the endothelial function measured as the FMD; ACEI monotherapy was the most effective treatment among the antihypertension medications. There were no significant differences between antihypertensive drug-based monotherapies.

Active and synchronous control of nitrogen and organic matter release from sediments induced with calcium peroxide.

In order to realize the active and synchronous control of nitrogen (N) and organic matter (OM) release from sediments, this study compared the spatiotemporal changes in the physical, chemical, and biological indicators in the water system under different CaO2 dosing modes. Results from 90-day incubation experiment showed that CaO2 formed a dense barrier layer near its dosing position, improved the anoxic condition of water system, increased the physical adsorption of pollutants by sediments, and reduced the nutrients in overlying water, interstitial water, and sediments. Comprehensive comparison, the improvement effect of shallow injection group (I1) was the most obvious. Meanwhile, the activities of ammonia oxidizing bacteria and nitrite oxidizing bacteria near dosing position and those of denitrifiers and anammox bacteria adjacent to dosing site were significantly increased in all test groups (p < 0.01), thereby realizing the biological removal of N and OM in sediments. In addition, DO and ORP were steadily higher than 5 mg L-1 and 100 mV in I1, where the NH4+-N concentration in overlying water was stable below 1 mg L-1, and the easily released N content in the upper (0-3 cm) and middle (4-6 cm) sediments decreased by 41.64% and 43.56%, respectively. Compared with the large pollutant flux in control (14.31 TN mg m-2 d-1 and 194.05 mg TCOD m-2 d-1), I1 completely inhibited the pollutant release and reduced the original nutrients in overlying water. In general, CaO2 efficiently and synchronously controlled the endogenous release of N and OM under the combined actions of physical interception, physical adsorption, chemical oxidation, and biological transformation. Therefore, this study may provide valuable reference and guidance for the active and synchronous removal of N and OM in sediments and inhibition of endogenous pollutant release under anoxic condition.

Respiratory exposure to graphene oxide induces pulmonary fibrosis and organ damages in rats involving caspase-1/p38MAPK/TGF-ß1 signaling pathways.

Numerous studies have shown that graphene oxide (GO) respiratory exposure led to severe lung injury, but whether pulmonary fibrosis caused by GO respiratory exposure is related to the activation of the caspase-1/p38MAPK/TGF-ß1 remains unclear. In this study, rats were administrated GO by intratracheal instillation and fed for three months, and the molecular mechanisms of GO on the pulmonary fibrosis and other organ damage caused by GO respiratory exposure were examined. The results showed that the expression of caspase-1/p38MAPK/TGF-ß1 pathway-related factors were significantly elevated with the increase of exposure concentrations of GO. Those data proved that the caspase-1/p38MAPK/TGF-ß1 signaling pathway was involved in the pulmonary fibrosis caused by GO respiratory exposure. The trends of related factors also proved that the caspase-1/p38MAPK/TGF-ß1 pathway was likely to play a dominant role in the sub-acute and sub-chronic stages. The other organ damage examination found that the liver and spleen were damaged initially by the GO respiratory exposure. Meanwhile for the testicle, although the acute injury was severe, signs of recovery were found during the three-month trial period.

Successful treatment of cerebral venous sinus thrombosis by balloon venoplasty: a case report.

Cerebral venous sinus thrombosis is a special cerebrovascular disease affecting young adult and middle-aged people. The clinical manifestations of cerebral venous sinus thrombosis are diverse and nonspecific; thus, imaging plays an important role in early diagnosis. Anticoagulation with heparin is the preferred treatment for cerebral venous sinus thrombosis. Endovascular treatment is also being increasingly used to achieve recanalization of the cerebral venous sinus. We herein describe a woman in her early 50s who was diagnosed with cerebral venous sinus thrombosis for which anticoagulation with heparin was ineffective. To improve her symptoms and prognosis, we selected balloon venoplasty to treat the right sigmoid sinus thrombosis. Her condition subsequently improved, and no recurrence was observed after several follow-ups.

PcaO positively regulates pcaHG of the beta-ketoadipate pathway in Corynebacterium glutamicum.

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the beta-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167DeltapcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ((-78)AACCCCTGACCTTCGGGGTT(-59)) that was located upstream of the -35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.

Corynebacterium glutamicum contains 3-deoxy-D-arabino-heptulosonate 7-phosphate synthases that display novel biochemical features.

3-Deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase (EC 2.5.1.54) catalyzes the first step of the shikimate pathway that finally leads to the biosynthesis of aromatic amino acids phenylalanine (Phe), tryptophan (Trp), and tyrosine (Tyr). In Corynebacterium glutamicum ATCC 13032, two chromosomal genes, NCgl0950 (aroF) and NCgl2098 (aroG), were located that encode two putative DAHP synthases. The deletion of NCgl2098 resulted in the loss of the ability of C. glutamicum RES167 (a restriction-deficient strain derived from C. glutamicum ATCC 13032) to grow in mineral medium; however, the deletion of NCgl0950 did not result in any observable phenotypic alteration. Analysis of DAHP synthase activities in the wild type and mutants of C. glutamicum RES167 indicated that NCgl2098, rather than NCgl0950, was involved in the biosynthesis of aromatic amino acids. Cloning and expression in Escherichia coli showed that both NCgl0950 and NCgl2098 encoded active DAHP synthases. Both the NCgl0950 and NCgl2098 DAHP synthases were purified from recombinant E. coli cells and characterized. The NCgl0950 DAHP synthase was sensitive to feedback inhibition by Tyr and, to a much lesser extent, by Phe and Trp. The NCgl2098 DAHP synthase was slightly sensitive to feedback inhibition by Trp, but not sensitive to Tyr and Phe, findings that were in contrast to the properties of previously known DAHP synthases from C. glutamicum subsp. flavum. Both Co2+ and Mn2+ significantly stimulated the NCgl0950 DAHP synthase's activity, whereas Mn2+ was much more stimulatory than Co2+ to the NCgl2098 DAHP synthase's activity.

Simultaneous biodegradation of nitrogen-containing aromatic compounds in a sequencing batch bioreactor.

Many nitrogen-containing aromatic compounds (NACs), such as nitrobenzene (NB), 4-nitrophenol (4-NP), aniline (AN), and 2,4-dinitrophenol (2,4-DNP), are environmentally hazardous, and their removal from contaminated water is one of the main challenges facing wastewater treatment plants. In this study, synthetic wastewater containing NB, 4-NP, 2,4-DNP, and AN at concentrations ranging from 50 to 180 mg/L was fed into a sequencing batch reactor (SBR). Analyses of the SBR system indicated that it simultaneously removed more than 99% of the NACs at loading rates of 0.36 kg NB/(m3 x d), 0.3 kg 4-NP/(m3 x d), 0.25 kg AN/(m3 x d), and 0.1 kg 2,4-DNP/(m3 x d). Bacterial groups of Bacteriodetes, Candidate division TM7, alpha-Proteobacteria, and beta-Proteobacteria were dominant in the clone libraries of 16S rRNA genes retrieved from the microbial communities in the SBR system. "Cycle tests" designed to alter feeding and aeration parameters of the SBR system demonstrated that the resident microbial biome of the SBR system responded rapidly to changing conditions. Consumption of O2 was concomitant with the apparent mineralization of NACs. Aromatic ring-cleaving dioxygenase activities suggested that (1) AN and NB were degraded via catechol 2,3-dioxygenase; (2) 4-NP was degraded via 1,2,4-benzentriol 1,2-dioxygenase; and (3) 2,4-DNP was degraded via an unresolved pathway.

Plasma protein binding monitoring of therapeutic drugs in patients using single set of hollow fiber centrifugal ultrafiltration.

AIM: Plasma protein binding (PPB), as a significant influenced factor of pharmacokinetic and pharmacodynamic properties of a medicine, is a suitable index for therapeutic drug monitoring (TDM) strategies. A suitable measurement technique of PPB of patients is in urgent need and attracts many analysts' attention. Results & methodology: In this study, a novel method was proposed to analyze free drug concentration and total drug concentration (Ct) successively in one unit with a sample. All RSDs were less than 3%. The absolute recovery of Ct ranged from 98.1 to 101.2%. DISCUSSION & CONCLUSION: It is extremely valuable to consider PPB as an important index for TDM, perfecting information of medication, reflecting the disease condition more comprehensively, providing assistance for doctors to adjust the dose regimen. The proposed technique, convenience, accuracy and without the influence of plasma condition, provides a feasible method to monitor PPB of various patients, facilitating the popularization of monitoring PPB in TDM.

A revision of the Chinese Gasteruptiidae (Hymenoptera, Evanioidea).

The Chinese fauna of the family Gasteruptiidae is revised, keyed and fully illustrated for the first time. Only one genus of this family, Gasteruption Latreille, 1796, is recorded from China. In total 28 valid species of the genus Gasteruption are recognized. Six species are new to science (Gasteruption angulatumsp. n., Gasteruption assectoidessp. n., Gasteruption coloratumsp. n., Gasteruption latitibiasp. n., Gasteruption sinepunctatumsp. n. and Gasteruption strigosumsp. n.) and eight species are reported new for China (Gasteruption bimaculatum Pasteels, 1958, Gasteruption birmanense Pasteels, 1958, Gasteruption dimidiatum Semenov, 1892, Gasteruption formilis Alekseev, 1995, Gasteruption subhamatum Pasteels, 1958, Gasteruption tonkinense Pasteels, 1958, Gasteruption tournieri Schletterer, 1885, Gasteruption transversiceps Pasteels, 1958). Three new synonyms are proposed: Gasteruption curiosum Pasteels, 1958, of Gasteruption amoyense Pasteels, 1958; Gasteruption sinense var. minus Kieffer, 1924, with Gasteruption japonicum Cameron, 1888,and Gasteruption sinense Kieffer, 1924, of Gasteruption sinarum Kieffer, 1911. Lectotypes are designated for Gasteruption corniculigerum Enderlein, 1913, Gasteruption sinense Kieffer, 1924, and Gasteruption transversiceps Pasteels, 1958. Gasteruption bihamatum Kieffer, 1911, previously reported from South China, is a South American species.

Sex difference in QTc prolongation in chronic institutionalized patients with schizophrenia on long-term treatment with typical and atypical antipsychotics.

OBJECTIVE: The rate-corrected electrocardiographic QT (QTc) interval may significantly increase in patients with schizophrenia taking antipsychotics. The objective of this naturalistic study was to assess the prevalence of prolonged QTc interval in a large population of inpatients with chronic schizophrenia and to explore QTc relationship with demographic variables and prescribed treatments. MATERIALS AND METHODS: Electrocardiograms were obtained from age- and sex-matched 456 controls and 1,006 inpatients with schizophrenia (male/female = 689/317) taking antipsychotics. QTc prolongation was defined as a mean value of two standard deviations above the controls. The adjusted relative risk was calculated using logistic regression analysis. RESULTS: QTc prolongation was present in 45 (4.5%) of 1,006 patients overall. Fewer men (3.2%, 22 of 689) than women (7.3%, 23 of 317) displayed QTc prolongation (p < 0.004). Moreover, QTc intervals were shorter in male (391 ± 31 ms) than female subjects (400 ± 37 ms) (p < 0.001). Clozapine was found to produce a longer QTc intervals compared to risperidone and typical antipsychotics. Furthermore, multiple regression analysis showed that significant predictors for QTc prolongation were comorbid cardiovascular disease, antipsychotic types, sex, and age (all p < 0.01). CONCLUSION: Our present findings suggest that there are sex differences in the prevalence of QTc prolongation and QTc lengthening in schizophrenia. Antipsychotic types are risk factors for QTc prolongation, and risks are substantially higher for clozapine.

Genetic and biochemical characterization of a 4-hydroxybenzoate hydroxylase from Corynebacterium glutamicum.

Corynebacterium glutamicum uses 4-hydroxybenzoic acid (4HBA) as sole carbon source for growth. Previous studies showed that 4HBA was taken up into cells via PcaK, and the aromatic ring was cleaved via protocatechuate 3,4-dioxygenase. In this study, the gene pobA ( Cg ) (ncgl1032) involved in the conversion of 4HBA into 3,4-dihydroxybenzoate (protocatechuate) was identified, and the gene product PobA (Cg) was characterized as a 4HBA 3-hydroxylase, which is a homodimer of PobA(Cg). The pobA (Cg) is physically associated with pcaK and formed a putative operon, but the two genes were located distantly to the pca cluster, which encode other enzymes for 4HBA/protocatechuate degradation. This new 4HBA 3-hydroxylase is unique in that it prefers NADPH to NADH as a cosubstrate, although its sequence is similar to other 4HBA 3-hydroxylases that prefer NADH as a cosubstrate. Sited-directed mutagenesis on putative NADPH-binding sites, D38 and T42, further improved its affinity to NADPH as well as its catalytic efficiency.

[Bacterial diversity in a sequencing batch reactor treating nitrogen-containing aromatic wastewater].

For understanding the mechanism of biodegradation in a SBR reactor treating nitrogen-containing aromatic wastewater, the reactor sludge samples were used for PCR-DGGE analysis. Meanwhile, 90 strains were isolated from the sludge sample after the start-up stage, 36 strains can degrade nitrogen-containing aromatic compounds. 5 strains nitrogen-containing aromatic degraders were further performed aromatic ring cleavage dioxygenase analysis. Result showed that bacterial diversity in the reactor were changed during the start-up stage, Acidobacteria (SBR1, SBR7), Actinobacteria (SBR4) and beta-Proteobacteria (SBR6) may play important role in biodegradation of nitrogen-containing aromatic compounds, among the isolates. Different bacterial diversity research method all have bias, and reflected different part of the bacterial structure. Among the isolates, Actinobacteria were the majority, by analysis the ring cleavage enzyme activity, further understood how the four nitrogen-containing aromatic compound were degraded in the reactor. The results provided valuable references for studying microbiological degradation mechanism in the reactor, and enriched microbial resources of nitrogen-containing aromatic degrader.

Genetic characterization of the resorcinol catabolic pathway in Corynebacterium glutamicum.

Corynebacterium glutamicum grew on resorcinol as a sole source of carbon and energy. By genome-wide data mining, two gene clusters, designated NCgl1110-NCgl1113 and NCgl2950-NCgl2953, were proposed to encode putative proteins involved in resorcinol catabolism. Deletion of the NCgl2950-NCgl2953 gene cluster did not result in any observable phenotype changes. Disruption and complementation of each gene at NCgl1110-NCgl1113, NCgl2951, and NCgl2952 indicated that these genes were involved in resorcinol degradation. Expression of NCgl1112, NCgl1113, and NCgl2951 in Escherichia coli revealed that NCgl1113 and NCgl2951 both coded for hydroxyquinol 1,2-dioxygenases and NCgl1112 coded for maleylacetate reductases. NCgl1111 encoded a putative monooxygenase, but this putative hydroxylase was very different from previously functionally identified hydroxylases. Cloning and expression of NCgl1111 in E. coli revealed that NCgl1111 encoded a resorcinol hydroxylase that needs NADPH as a cofactor. E. coli cells containing Ncgl1111 and Ncgl1113 sequentially converted resorcinol into maleylacetate. NCgl1110 and NCgl2950 both encoded putative TetR family repressors, but only NCgl1110 was transcribed and functional. NCgl2953 encoded a putative transporter, but disruption of this gene did not affect resorcinol degradation by C. glutamicum. The function of NCgl2953 remains unclear.