An interplay between a hydrogen atmosphere and dislocation characteristics in BCC Fe from time-averaged molecular dynamics.

The interplay between hydrogen and dislocations (e.g., core and elastic energies, and dislocation-dislocation interactions) has implications on hydrogen embrittlement but is poorly understood. Continuum models of hydrogen enhanced local plasticity have not considered the effect of hydrogen on dislocation core energies. Energy minimization atomistic simulations can only resolve dislocation core energies in hydrogen-free systems because hydrogen motion is omitted so hydrogen atmosphere formation can't occur. Additionally, previous studies focused more on face-centered-cubic than body-centered-cubic metals. Discrete dislocation dynamics studies of hydrogen-dislocation interactions assume isotropic elasticity, but the validity of this assumption isn't understood. We perform time-averaged molecular dynamics simulations to study the effect of hydrogen on dislocation energies in body-centered-cubic iron for several dislocation character angles. We see atmosphere formation and highly converged dislocation energies. We find that hydrogen reduces dislocation core energies but can increase or decrease elastic energies of isolated dislocations and dislocation-dislocation interaction energies depending on character angle. We also find that isotropic elasticity can be well fitted to dislocation energies obtained from simulations if the isotropic elastic constants are not constrained to their anisotropic counterparts. These results are relevant to ongoing efforts in understanding hydrogen embrittlement and provide a foundation for future work in this field.

Correction: Character angle effects on dissociated dislocation core energy in aluminum.

Correction for 'Character angle effects on dissociated dislocation core energy in aluminum' by X. W. Zhou et al., Phys. Chem. Chem. Phys., 2021, 23, 3290-3299, DOI: https://doi.org/10.1039/D0CP05333C.

Comparison of the outer membrane proteomes between clinical carbapenem-resistant and -susceptible Acinetobacter baumannii.

BACKGROUND AND AIM: Carbapenem resistance has become a major obstacle in combating Acinetobacter baumannii infections. Although enzymatic degradation by ß-lactamases is the pivotal mechanism of carbapenem resistance, porin deficiency has also been implicated in the mechanism. In this study, outer membrane proteins (OMPs) pattern of a clinical multidrug-resistant A. baumannii isolate were analysed in order to attain a deeper understanding of carbapenem-resistance strategies. METHODS: OMPs extracts, respectively, separated from carbapenem-resistant and -susceptible clinical A. baumannii isolates were compared using two-dimensional polyacrylamide gel electrophoresis. Differentially expressed proteins were identified by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF). RESULTS: Twenty-three differently expressed proteins were identified between the resistant and susceptible isolates. Among them, six were annotated convincingly as OMPs in UniProt database. CarO was found absent from the resistant isolate and the expression levels of Omp33-36 and Omp25 were significantly lower than that in the susceptible counterpart. Strikingly, a LysM domain/BON superfamily protein, which has been linked to carbapenem resistance in Klebsiella pneumoniae, was found underexpressed by tenfold in the resistant isolate. CONCLUSION: Our study verified some porins which have been proven to play an important role in bacterial resistance against carbapenems. Underexpression of the LysM domain/BON superfamily protein may indicate its possible engagement in bacterial drug resistance, but its actual role requires more investigation.

Character angle effects on dissociated dislocation core energy in aluminum.

Dislocation core energy is an important property in materials mechanics but can only be obtained from atomistic simulations. Periodic boundary conditions are ideally suited for atomistic calculations of dislocation energies but have faced two major challenges. First, viable methods to extract core energies from atomistic data of total energies have been developed only for non-dissociated dislocations whereas realistic dislocations are often dissociated into partials. Second, core energy is a function of dislocation character angle. This functional dependence can only be revealed through calculations at a variety of character angles. This requires both additional computational resources and a robust method to implement arbitrary character angles. Here a new procedure has been developed to overcome both challenges. By applying this approach, we have calculated 22 core energies of dissociated dislocations in aluminium over the entire character angle range between 0° and 90°. In addition to the discrete core energy data for dissociated dislocations, we found that core energy can be approximated by a continuous function of character angle. Specifically, our dissociated dislocation core energies have been well fitted to a polynomial Sinoidal function of character angle. We have also discovered that there exists a critical system dimension below which dislocation core energies cannot be calculated due to dislocation transformation.

Molecular dynamics discovery of an extraordinary ionic migration mechanism in dislocation-containing TlBr crystals.

TlBr can surpass CZT as the leading semiconductor for γ- and X-radiation detection. Unfortunately, the optimum properties of TlBr quickly decay when an operating electrical field is applied. Quantum mechanical studies indicated that if this property degradation comes from the conventional mechanism of ionic migration of vacancies, then an unrealistically high vacancy concentration is required to account for the rapid aging of TlBr seen in experiments. In this work, we have applied large scale molecular dynamics simulations to study the effects of dislocations on ionic migration of TlBr crystals under electrical fields. We found that electrical fields can drive the motion of edge dislocations in both slip and climb directions. These combined motions eject enormous vacancies in the dislocation trail. Both dislocation motion and a high vacancy concentration can account for the rapid aging of the TlBr detectors. These findings suggest that strengthening methods to pin dislocations should be explored to increase the lifetimes of TlBr crystals.

Research Progress on the Molecular Mechanisms of Toxicology of Ethanol-Aconitine Induced Arrhythmia.

ABSTRACT: Aconitum is one of the most widely used Chinese herbal medicines, and aconitine is the major toxic component in it. Aconitine can induce a variety of arrhythmias, resulting in death. Acute ethanol consumption causes arrhythmia as well. Poisoning cases caused by aconitum medicinal liquor are frequently encountered in the practice of forensic medicine. The molecular mechanisms of myocardial toxicity of these two drugs have much in common, and both of them affect the sodium channel, calcium channel and potassium channel of myocardial cell membrane and so on. This paper analyzes and discusses the possible co-effects of ethanol-aconitine on cardiomyocyte channel proteins, by reviewing researches on the mechanism of cardiotoxicity of ethanol and aconitine in recent years, in order to provide ideas and references for the research on the molecular mechanism of arrhythmia caused by combined poisoning.

[Related factors of diabetic nephropathy in patients with type 1 diabetes mellitus].

Objective: To analyze the related factors of diabetic nephropathy in inpatients with type 1 diabetes mellitus (T1DM). Methods: A total of 300 patients with T1DM who were treated in the Department of Endocrinology of Anhui Provincial Hospital between 2014 and 2016 were analyzed retrospectively. All the patients were divided into two groups according to their urine albumin-to-creatinine ratio: non-diabetic nephropathy group (n=193) and diabetic nephropathy group (n=107). Multivariate logistic regression analysis was adopted to analyze the factors related to diabetic nephropathy in T1DM, including the age, diabetic duration, body mass index (BMI) and glycosylated hemoglobin (HbA1c) of the two groups. Results: Age, diabetes duration, HbA1c, systolic blood pressure (SBP), diastolic blood pressure (DBP), total cholesterol, triglyceride and uric acid (UA) of diabetic nephropathy group were higher than those of non-diabetic nephropathy group (all P<0.05). The total bilirubin, hemoglobin (Hb) and albumin in non-diabetic nephropathy group were higher than those in diabetic nephropathy group (P<0.05). The proportion of women in diabetic nephropathy group was higher than non-diabetic nephropathy group (62.6% vs 42.0%, P=0.001). Multivariate logistic regression analysis showed that diabetes duration (OR=2.142, 95% CI: 1.011-4.539), HbA1c (OR=1.262, 95% CI: 1.090-1.462), DBP (OR=1.048, 95% CI: 1.001-1.096), UA (OR=1.005, 95% CI: 1.001-1.009) and Hb (OR=0.952, 95% CI: 0.929-0.975) were independent related factors for diabetic nephropathy. Conclusions: Positive controlling of blood pressure, blood glucose, hyperuricemia and correcting anemia may reduce the incidence of diabetic nephropathy in T1DM patients.

Molecular dynamics studies of irradiation effects on hydrogen isotope diffusion through nickel crystals and grain boundaries.

Experiments indicated that tritium permeation in 316 austenitic stainless steel is enhanced by a factor of ∼2-5 after irradiation as compared to the ex-reactor results. To understand this enhancement, we have performed extensive molecular dynamics simulations to study the effects of both the grain boundary structure (Σ3{111}, Σ5{100} and Σ11{311}) and the nature of point defects (vacancy, interstitial, and Frenkel pair) on hydrogen diffusivities in an exemplar fcc metal (nickel). By deriving diffusivities from mean square displacement, all possible atomic jump paths encountered during real diffusion are realistically sampled. By performing extremely long simulations, the statistical errors typically associated with this method are also significantly reduced. We found that within grains, interstitial defects increase diffusivity whereas vacancies have almost no effects. This mechanism might explain hydrogen permeation enhancements in irradiated materials with coarse grains. The largest increase in hydrogen diffusivity was found at a certain combination of grain boundary and point defect. This suggests that permeability of materials with finer grains can also be enhanced by irradiation depending on whether the grain boundary character is skewed. Our results shed new light on the enhancement of tritium permeation in 316 stainless steels during reactor operations.

[Etiological analysis on patients in department of vertigo and dizziness oriented outpatient].

Objective: We aimed to explore the spectrum of causes for patients in department of vertigo and dizziness oriented outpatient, in order to provide a reference for diagnosis and treatment of patients with vertigo or dizziness. Methods: Retrospective analysis were carried out with clinical data of patients in our department of vertigo and dizziness oriented outpatient. The target group under study was diagnosed based on the uniform diagnostic criteria, and re-visiting patients were excluded. Results: This clinical study was conducted on 5 348 cases, who visited our vertigo and dizziness oriented outpatient from December 2012 to July 2015. The ratio of male to female was 1∶1.48, the age range was between 16 and 93. The frequencies of different etiology were: benign paroxysmal positional vertigo 1 902(35.56%), Chronic subjective dizziness 1 329(24.85%), vestibular migraine 624(11.67%), Meniere's disease 378(7.07%), multi-sensory neuropathy 231(4.32%), vestibular paroxysmia 177(3.31%), benign recurrent vestibulopathy 171(3.20%), presyncope 66(1.23%), posterior circulation ischemia 57(1.07%), vestibular neuritis 54(1.01%), sudden deafness complicated vertigo 36(0.67%), other reasons 68(1.27%), unknown 255(4.77%). Conclusions: Our study indicates that the precedent three causes for vertigo or dizziness are benign paroxysmal positional vertigo, chronic subjective dizziness and vestibular migraine, followed by Meniere's disease、multi-sensory neuropathy, vestibular paroxysmia and benign recurrent vestibulopathy. Presyncope, posterior circulation ischemia, vestibular neuritis and sudden deafness complicated vertigo are relatively infrequent. There are still a certain proportion of patients undetermined.

[Misdiagnosis and associated costs of benign paroxysmal positional vertigo].

Objective: The aims of this study were to investigate the misdiagnosis of benign paroxysmal positional vertigo (BPPV) and to estimate the associated costs. Methods: During October 2015 to December 2015, eighty patients were diagnosed with BPPV in the outpatient dizziness clinic of Shanghai Changzheng Hospital and the clinical data of all the 80 patients were collected including the demographic and clinical characteristics, the history of diagnosis, inappropriate diagnostic tests, costs of the medical tests, transportation and accommodation. All the data were investigated to estimate the misdiagnosis of benign paroxysmal positional vertigo and the associated costs in Shanghai, China. Results: This study showed that the misdiagnosis rate of BPPV was 60.0% (48/80) and the common inappropriate diagnostic tests for BPPV included Cranial CT and MRI test, cervical MRI, cervical and cerebrovascular investigations et al. There was no significant difference between the misdiagnosis patients (48) and patients without misdiagnosis (32) in gender, age, duration of symptom, involved canal and type of BPPV.Complications were significantly more frequent in the misdiagnosis group than for those without[81.3%(39 /48) vs 34.4%(11 /32)]. The estimated costs for each misdiagnosed individual were 8 502.98 China Yuan (CNY) and one-year economic burden associated with the misdiagnosis of BPPV in Shanghai was 13.184 7-78.862 1 million CNY. Conclusions: Our study suggests that the misdiagnosis rate of BPPV is high and the financial impact on patients and society with this disease is huge. The cost-effective Dix-Hallpike or supine roll test maneuver should be used before applying other expensive medical tests in order to minimize misdiagnosis and the waste of health care resources.

An analytical bond-order potential for carbon.

Carbon is the most widely studied material today because it exhibits special properties not seen in any other materials when in nano dimensions such as nanotube and graphene. Reduction of material defects created during synthesis has become critical to realize the full potential of carbon structures. Molecular dynamics (MD) simulations, in principle, allow defect formation mechanisms to be studied with high fidelity, and can, therefore, help guide experiments for defect reduction. Such MD simulations must satisfy a set of stringent requirements. First, they must employ an interatomic potential formalism that is transferable to a variety of carbon structures. Second, the potential needs to be appropriately parameterized to capture the property trends of important carbon structures, in particular, diamond, graphite, graphene, and nanotubes. Most importantly, the potential must predict the crystalline growth of the correct phases during direct MD simulations of synthesis to achieve a predictive simulation of defect formation. Because an unlimited number of structures not included in the potential parameterization are encountered, the literature carbon potentials are often not sufficient for growth simulations. We have developed an analytical bond order potential for carbon, and have made it available through the public MD simulation package LAMMPS. We demonstrate that our potential reasonably captures the property trends of important carbon phases. Stringent MD simulations convincingly show that our potential accounts not only for the crystalline growth of graphene, graphite, and carbon nanotubes but also for the transformation of graphite to diamond at high pressure.

Phylogenetic analysis of widely cultivated Ganoderma in China based on the mitochondrial V4-V6 region of SSU rDNA.

Ganoderma mushroom is one of the most prescribed traditional medicines and has been used for centuries, particularly in China, Japan, Korea, and other Asian countries. In this study, different strains of Ganoderma spp and the genetic relationships of the closely related strains were identified and investigated based on the V4-V6 region of mitochondrial small subunit ribosomal DNA of the Ganoderma species. The sizes of the mitochondrial ribosomal DNA regions from different Ganoderma species showed 2 types of sequences, 2.0 or 0.5 kb. A phylogenetic tree was constructed, which revealed a high level of genetic diversity in Ganoderma species. Ganoderma lucidum G05 and G. eupense G09 strains were clustered into a G. resinaceum group. Ganoderma spp G29 and G22 strains were clustered into a G. lucidum group. However, Ganoderma spp G19, G20, and G21 strains were clustered into a single group, the G. lucidum AF214475, G. sinense, G. strum G17, G. strum G36, and G. sinense G10 strains contained an intron and were clustered into other groups.

Hydrogen isotope population near dislocations in zirconium from molecular dynamics.

Performance of zirconium tritides used for hydrogen isotope storage is significantly changed under reactor environments. This can be attributed to the formation of various radiation-induced dislocations. To help gain insight, molecular dynamics simulations have been employed to investigate hydrogen isotope population in zirconium containing different types of edge dislocations. Our studies reveal that hydrogen isotope concentration is highest near the tensile side of dislocation cores and varies based on dislocation type. This increase in hydrogen isotope concentration can be explained by the Boltzmann equation based on calculations using swelling volume and pressure field, with significantly reduced computational cost. Strikingly, because hydrogen isotope in the compressive regions of dislocations is depleted, the overall hydrogen isotope content is found to be unchanged by dislocation formation. These results counter the previous view that the dislocation trapping effect increases hydrogen isotope solubility and provide an understanding of changes in hydrogen isotope pressure under reactor conditions. By elucidating the impact of dislocations on hydrogen isotope storage performance, this research offers insights for optimizing zirconium tritides in nuclear applications. and contributes to the advancement of hydrogen isotope storage materials.

Molecular dynamics studies of material property effects on thermal boundary conductance.

Thermal boundary resistance (inverse of conductance) between different material layers can dominate the overall thermal resistance in nanostructures and therefore impact the performance of the thermal property limiting nano devices. Because relationships between material properties and thermal boundary conductance have not been fully understood, optimum devices cannot be developed through a rational selection of materials. Here we develop generic interatomic potentials to enable material properties to be continuously varied in extremely large molecular dynamics simulations to explore the dependence of thermal boundary conductance on the characteristic properties of materials such as atomic mass, stiffness, and interfacial crystallography. To ensure that our study is not biased to a particular model, we employ different types of interatomic potentials. In particular, both a Stillinger-Weber potential and a hybrid embedded-atom-method + Stillinger-Weber potential are used to study metal-on-semiconductor compound interfaces, and the results are analyzed considering previous work based upon a Lennard-Jones (LJ) potential. These studies, therefore, reliably provide new understanding of interfacial transport phenomena particularly in terms of effects of material properties on thermal boundary conductance. Our most important finding is that thermal boundary conductance increases with the overlap of the vibrational spectra between metal modes and the acoustic modes of the semiconductor compound, and increasing the metal stiffness causes a continuous shift of the metal modes. As a result, the maximum thermal boundary conductance occurs at an intermediate metal stiffness (best matched to the semiconductor stiffness) that maximizes the overlap of the vibrational modes.

Agrobacterium tumefaciens-mediated genetic transformation of the Taxol-producing endophytic fungus Ozonium sp EFY21.

An efficient Agrobacterium tumefaciens-mediated genetic transformation method was successfully established for a newly isolated Taxol-producing fungus, Ozonium sp EFY21. A specific hygromycin B resistance expression vector, pCAMBIA1304'AN7-1, was constructed for fungal transformation. Key factors affecting transformation efficiency were thoroughly investigated and optimized. PCR amplification and Southern hybridization were used to verify the transformation events. This study should pave the way for future genetic modification studies of Ozonium sp EFY21.

Molecular dynamics exploration of helium bubble nucleation and growth mechanisms in Fe70Ni11Cr19 austenitic stainless steel.

The growth of helium bubbles impacts structural integrity of materials in nuclear applications. Understanding helium bubble nucleation and growth mechanisms is critical for improved material applications and aging predictions. Systematic molecular dynamics simulations have been performed to study helium bubble nucleation and growth mechanisms in Fe70Ni11Cr19 stainless steels. First, helium cluster diffusivities are calculated at a variety of helium cluster sizes and temperatures for systems with and without dislocations. Second, the process of diffusion of helium atoms to join existing helium bubbles is not deterministic and is hence studied using ensemble simulations for systems with and without vacancies, interstitials, and dislocations. We find that bubble nucleation depends on diffusion of not only single helium atoms, but also small helium clusters. Defects such as vacancies and dislocations can significantly impact the diffusion kinetics due to the trapping effects. Vacancies always increase the time for helium atoms to join existing bubbles due to the short-range trapping effect. This promotes bubble nucleation as opposed to bubble growth. Interestingly, dislocations can create a long-range trapping effect that reduces the time for helium atoms to join existing bubbles. This can promote bubble growth within a certain region near dislocations.

Melt-growth dynamics in CdTe crystals.

We use a new, quantum-mechanics-based bond-order potential (BOP) to reveal melt growth dynamics and fine scale defect formation mechanisms in CdTe crystals. Previous molecular dynamics simulations of semiconductors have shown qualitatively incorrect behavior due to the lack of an interatomic potential capable of predicting both crystalline growth and property trends of many transitional structures encountered during the melt→crystal transformation. Here, we demonstrate successful molecular dynamics simulations of melt growth in CdTe using a BOP that significantly improves over other potentials on property trends of different phases. Our simulations result in a detailed understanding of defect formation during the melt growth process. Equally important, we show that the new BOP enables defect formation mechanisms to be studied at a scale level comparable to empirical molecular dynamics simulation methods with a fidelity level approaching quantum-mechanical methods.

Knockdown of RhoGDIα induces apoptosis and increases lung cancer cell chemosensitivity to paclitaxel.

This study aimed to investigate the effects of RhoGDIα knockdown on apoptosis and the chemosensitivity of lung cancer cells to paclitaxel. The signaling proteins involved were also assessed. RhoGDIα expression was assessed by RT-PCR, Western blotting and immunohistochemistry. Apoptosis was determined by flow cytometric assessment, and cell viability was measured with the MTT assay. Phosphorylation levels of signaling proteins, ERK, JNK, Akt, Bad and IκBα were tested by Western blotting and immunohistochemistry. Positivity for RhoGDIα in lung cancer tissues was significantly higher than in paracancerous tissues. Downregulation of RhoGDIα was associated with significantly increased apoptosis and repressed cell viability. This effect could be due to the consequent upregulation of p-JNK, as well as decreased levels of p-ERK, p-Bad and p-IκBα. Knockdown of RhoGDIα strengthened the effect on apoptosis and inhibition of cell viability induced by paclitaxel treatment. This chemosensitization effect could be a result of the intensification of pro-apoptotic JNK activation, and repression of anti-apoptotic p-ERK, p-Bad and p-IκBα expression stimulated by paclitaxel. In summary, our study indicated that RhoGDIα could be a promising therapeutic target, and the combination of RhoGDIα siRNA and paclitaxel might be a valuable potential therapy for lung cancer treatment.

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Characteristics of Radiation-Related Intracranial Aneurysms: A Multicenter Retrospective Study.

BACKGROUND AND PURPOSE: Intracranial aneurysms, a rare complication of radiation therapy, have been reported mainly in case reports or case series. We performed a multicenter, retrospective cohort study to investigate the characteristics of radiation-induced intracranial aneurysms. MATERIALS AND METHODS: Data on 2641 patients with intracranial aneurysms were retrospectively collected from 3 hospitals between January 2005 and June 2014. An additional 1519 patients were recruited from a single center between July 2014 and March 2020. Aneurysms in patients with a history of radiation therapy for at least 6 months were defined as radiation-related aneurysms. Patients' demographic profiles, clinical characteristics, and aneurysm parameters detected on CTA were compared between radiation-related and control groups. RESULTS: Of the 4160 patients, the average age was 57.9 (SD, 13.5) years, 2406 (57.8%) were women, 477 (11.5%) had multiple aneurysms, 3009 (72.3%) had SAH, and 34 (0.8%) had radiation-related aneurysms. The male-to-female ratio in the radiation-related group was significantly higher than that in the control group (2.4:1 versus 0.72:1, P = .001). The mean age of the radiation-related group was significantly younger than in the control group (51.4 [SD, 15.0] years versus 58.2 [SD, 13.5] years, P = .003). More patients in the radiation-related group presented with SAH than in the control group (without age and sex matching, 88.2% versus 72.2%, P = .037; with age and sex matching, 88.2% versus 58.8%, P = .006). Of the 4813 intracranial aneurysms, only 43 (0.9%) aneurysms were categorized as in the radiation-related group, whereas 4770 (99.1%) aneurysms constituted the control group. Compared with the control group, there was a significantly higher proportion of sidewall aneurysms (46.5% versus 32.3%, P = .048) and a predilection for aneurysms involving the ICA and posterior circulation arteries (72.1% versus 52.2%, P = .046) in the radiation-related group. CONCLUSIONS: Compared with the control group, radiation-related aneurysms are more prone to occur in men and young patients, with a higher percentage of sidewall aneurysms located in the ICA and posterior circulation arteries. Furthermore, SAH is highly prevalent in patients with radiation-induced aneurysms, indicating that dedicated screening for aneurysms after radiation therapy is necessary, but further studies are needed to determine when and how to screen.