First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Temperature Effects on Expression Levels of hsp Genes in Eggs and Second-Stage Juveniles of Meloidogyne hapla Chitwood, 1949.

Meloidogyne hapla is one of the most important nematode pathogens. It is a sedentary, biotrophic parasite of plants that overwinters in the soil or in diseased roots. The development of M. hapla is temperature dependent. Numerous studies have been performed on the effect of temperature on the development of M. hapla, but only a few of them analyzed the heat shock protein (hsp) genes. The aim of the study was to perform expression profiling of eight hsp genes (Mh-hsp90, Mh-hsp1, Mh-hsp4, Mh-hsp6, Mh-hsp60, Mh-dnj19, Mh-hsp43, and Mh-hsp12.2) at two development stages of M. hapla, i.e., in eggs and second-stage juveniles (J2). The eggs and J2 were incubated under cold stress (5 °C), heat stress (35 °C, 40 °C), and non-stress (10 °C, 20 °C, and 30 °C) conditions. Expression profiling was performed by qPCR. It was demonstrated that only two genes, Mh-hsp60 and Mh-dnj19, have been upregulated by heat and cold stress at both development stages. Heat stress upregulated the expression of more hsp genes than cold stress did. The level of upregulation of most hsp genes was more marked in J2 than in eggs. The obtained results suggest that the Mh-hsp90 and Mh-hsp1 genes can be used as bioindicators of environmental impacts on nematodes of the Meloidogyne genus.

First report of Meloidogyne hapla on hemp (Cannabis sativa) in Oregon.

Hemp is a crop that has gained interest in Washington and Oregon. As with other crops, hemp production faces challenges due to biotic factors, including plant-parasitic nematodes. During a survey for plant-parasitic nematodes associated with hemp, Meloidogyne sp. was found in a composite root sample collected in Oregon. Morphological characterization of second-stage juveniles identified the nematode as Meloidogyne hapla. Molecular identification confirmed the population as M. hapla. To our knowledge, this is the first report of M. hapla on hemp in the Pacific Northwest of the United States.

Characterization of a Root-Knot Nematode Infecting Aconitum carmichaelii in Southwest China.

Growth of the Chinese herbal medicine industry has resulted in several new pests and diseases. China is one of the world largest producers of monkshood (Aconitum carmichaelii Debx.), but an unidentified root-knot nematode has become a significant pest in the southwestern provinces of Yunnan and Sichuan. Morphological characteristics and the ribosomal DNA-internal transcribed spacer and D2-D3 region of the 28S ribosomal RNA gene sequences were used to identify the nematode as Meloidogyne hapla. Through investigation, this is the first report of M. hapla infecting monkshood in Yunnan and Sichuan Provinces.

Comparative Transcriptome Analysis Reveals the Molecular Mechanism of Bacillus velezensis GJ-7 Assisting Panax notoginseng against Meloidogyne hapla.

The rhizosphere bacteria Bacillus velezensis GJ-7, as a biological control agent (BCA), has significant biological control effects on Meloidogyne hapla, and has strong colonization ability in the root of Panax notoginseng. In this study, we conducted a comparative transcriptome analysis using P. notoginseng plant roots treated with B. velezensis GJ-7 or sterile water alone and in combination with M. hapla inoculation to explore the interactions involving the P. notoginseng plant, B. velezensis GJ-7, and M. hapla. Four treatments from P. notoginseng roots were sequenced, and twelve high-quality total clean bases were obtained, ranging from 3.57 to 4.74 Gb. The Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment showed that numerous DEGs are involved in the phenylpropane biosynthesis pathway and the MAPK signaling pathway in the roots of P. notoginseng with B. velezensis GJ-7 treatments. The analysis results of the two signaling pathways indicated that B. velezensis GJ-7 could enhance the expression of lignin- and camalexin-synthesis-related genes in plant roots to resist M. hapla. In addition, B. velezensis GJ-7 could enhance plant resistance to M. hapla by regulating the expression of resistance-related genes and transcription factors (TFs), including ETR, ERF, ChiB, WRKY22, and PR1. The expression of plant disease resistance genes in the roots of P. notoginseng with different treatments was validated by using real-time quantitative PCR (qRT-PCR), and the results were consistent with transcriptome sequencing. Taken together, this study indicated that B. velezensis GJ-7 can trigger a stronger defense response of P. notoginseng against M. hapla.

Volatile Organic Compounds of Bacillus velezensis GJ-7 against Meloidogyne hapla through Multiple Prevention and Control Modes.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes.

A New Biological Product Shows Promising Control of the Northern Root-Knot Nematode, Meloidogyne hapla, in Greenhouse Tomatoes.

Tomato plants are susceptible to significant yield losses when infested by the northern root-knot nematode, Meloidogyne hapla. While there are many options for conventional chemical management, few of these options offer effective control for organic growers or those who seek to adopt more environmentally considerate strategies. In this study, we showed that a new, biologically based product (referred to as "MN21.2") has potential for controlling populations of the northern root-knot nematode, Meloidogyne hapla, as a pest of susceptible tomato (cv. Rutgers) in a greenhouse trial. This is significant because if this product's efficacy is supported under field conditions, it may provide organic tomato growers with a valuable tool for fighting the plant-parasitic nematode pest, M. hapla.

Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla.

Assuming that the seeds of Vicia sativa L. have a stressful effect on J2 stage Meloidogyne hapla, we undertook research on the effect of these seeds on the motility and mortality of J2 and determined the expression levels of selected hsp genes in J2. The assessment of the effect of V. sativa seeds on the motility of M. hapla specimens consisted of observing the movement of J2 immersed in a seed diffusate or in a tomato root filtrate at temperatures of 10, 17, and 21°C. In J2 treated with V. sativa (cv. Ina) seed diffusates, the expression level of hsp genes was determined by qPCR. J2 exposed to V. sativa diffusates were found to lose their motility, while their mortality did not exceed 30%. J2 in the seed diffusate were characterized by an increase in the expression levels of the Mh-hsp90, Mh-hsp1, and Mh-hsp43 genes. It is suggested that the hsp90 gene may be a potential bioindicator of the environmental impact on Meloidogyne nematodes. The impaired ability to move in J2 of M. hapla is attributable to the occurrence of V. sativa seeds in their habitat. These studies may contribute to developing methods of reducing crop damage caused by M. hapla.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

First report of Meloidogyne hapla infecting Yunmuxiang (Aucklandia lappa) in China.

Yunmuxiang (Aucklandia lappa) is a tall, perennial herbaceous plant in the compositae family, occurring mainly in Asia and Europe. Yunmuxiang originated in India and was introduced into China in approximately 1940. Since then it has been widely cultivated in the southwest region of China for medicinal uses; it is included in the Chinese Pharmacopoeia. Yunmuxiang is used primarily as a sedative, including for anesthesia (Ting et al. 2012). Severely stunted and withered Yunmuxiang plants with rotted and galled roots were observed in a field in near the city of Lijiang (N 99°46'; E 27°18') in October 2019. These symptoms were typical of infection by root-knot nematodes.The second-stage juveniles (J2) were collected from the soil in the root zone, and adult females were dissected from roots. Population densities of J2 ranged from 325 to 645 per 100 cm3. Morphological analysis and species-specific PCR were performed on the second stage (J2) and females. Morphological characteristics are as follows: for J2 (n=20) , body length = 360.5 ± 23.4 µm, tail length = 47.2 ± 6.1 µm, and stylet length = 10.4 ± 1.9 µm, distance from dorsal esophageal gland opening to the stylet knot (DGO) = 3.96 ± 0.42 µm; females (n = 20) were pear-shaped, body length = 565.23 ± 86.68 µm, maximum body width = 407.24 ± 60.21 µm, stylet length = 9.93 ± 0.88 µm, DGO = 4.76 ± 0.32 µm, stylet median bulb width (MBW) = 29.67 ± 3.61 µm, perineum morphology is low and low dorsal arch round, with a typical inferior protrusion near the anus. These morphological characteristics are consistent with Meloidogyne hapla as described by Hunt and Handoo (2009). To confirm species identification, DNA was extracted from females (Blok, et al. 1997) and ITS region was amplified using the primers 18S/26S (Vrain et al. 1992). Furthermore, species-specific SCAR primers JMV1/JMV hapla were used as described by Adam et al. (2007). PCR produced 768 bp and 419 bp sequences. Fragments were sequenced (MW512922and MW228371, respectively) and compared with available sequences on NCBI. Sequences were 99.48% identical to the MT249016, KJ572385, and 100% identical to the GQ395574, GQ395569 M. hapla sequences, respectively. Morphological and molecular characterization supports the identification of the isolate found on Aucklandia lappa as M. hapla. Yunmuxiang seed were planted in 20 cm diameter, 10 cm deep plastic pots containing 1000 cm3 sterilized soil. Seedlings were thinned to one per pot. At the 2-3 leaf stage 10 pots were infested with 1500 M. hapla J2 per seedling, using a sterilized micropipette. Plants were maintained at 20-25°C in a greenhouse. Control plants received sterile water, and the pathogenicity test was repeated three times. After 30 days, plants were removed from pots and soil gently removed from the roots. A large number of galls (95.6 ± 2.5) and egg masses (33.5 ± 0.5) were found on each root system. Yunmuxiang was considered a good host for M. hapla in Lijiang. M. hapla is a major plant parasitic nematode with a wide geographic distribution and range of host plants and causes severe yield losses (Azevedo de Oliveira et al. 2018). Through investigation, this is the first report worldwide of M. hapla infecting Aucklandia lappa.

Pathogen identification of Gentiana macrophylla root-knot nematode disease in Yulong, China.

In September 2020, samples of galled roots with rhizosphere soil were collected from declining Gentiana macrophylla in Yulong County, China. The pathogenic nematodes were identified by observing morphological characteristics of females, second-stage juveniles and perineal pattern, sequence alignments, and specific amplification of sequence characterized amplified region (SCAR). The results showed that the perineal pattern of this nematode was round or oval, the dorsal arch was moderately high or low, one side or both of the lateral field extended to form a wing shape, the tail region had punctations, and the morphological characteristics and morphometric values of second-stage juveniles and females were similar to those of Meloidogyne hapla. The ITS region fragment of this nematode were highly similar to those of M. hapla in NCBI database, with a similarity of over 99.35%. Using the SCAR specific primers, a specific band with an expected size of approximately 440 bp was amplified from this nematode. Morphological and molecular identification supports the nematode species found on Gentiana macrophylla as M. hapla. This is the first report of this regulated root-knot nematode on Gentiana macrophylla in China.

Potential of nicotinamide adenine dinucleotide (NAD) for management of root-knot nematode in tomato.

Nicotinamide adenine dinucleotide (NAD) has been shown to induce plant defense responses to different plant pathogens, including reducing northern root-knot nematode, Meloidogyne hapla, penetration and increasing plant mass in tomato. We wanted to further evaluate NAD that are effective against the more economically important species, M. incognita and whether NAD treatments of tomato seedlings in transplant trays can protect plants in the field. Different NAD concentrations (1 mM, 0.1 mM and 0.01 mM) and three application timings (pre; post; pre and post inoculation) were evaluated in growth room and greenhouse trials. The highest tested NAD concentration (1 mM) suppressed second-stage juveniles (J2) infection for all three application methods. Root gall ratings at 30 days after inoculation (DAI) were also suppressed by 1 mM NAD compared to the other two concentrations, and egg mass number was significantly suppressed for all concentrations and application timings compared to the non-treated control. The rate of 1 mM NAD for all three application timings also improved plant growth at 30 DAI. Long-term effects of 1 mM NAD (pre, pre + post, or post applications) on nematode infection, growth and yield of tomato were evaluated in two additional experiments. All NAD applications suppressed root galls after 60 days, but only the pre + post 1 mM NAD application suppressed gall severity at 105 days, as well as suppressed egg counts by 50% at 60 DAT. No significant difference in plant biomass and fruit yield after 105 days was observed among the treatments. Two field trials were conducted in spring and fall 2020 using tomato seedlings (cv. HM 1823) treated with two different NAD concentrations (1 mM and 5 mM in spring; 5 mM and 10 mM in fall) and transplanting seedlings in fumigated (chloropicrin ± 1,3-dichloropropene) and non-fumigated plastic-mulch beds. No significant impact of NAD in terms of reducing RKN severity or overall tomato growth and production was seen in fumigated beds, but in non-fumigated beds 5 mM NAD slightly increased early fruit yield in spring, and 10 mM NAD reduced root-knot soil populations in fall.

Occurrence and Seasonal Changes in the Population of Root-knot Nematodes on Honeybush (Cyclopia Sp.).

Root-knot nematodes in the genus Meloidogyne are an important group of plant-parasitic nematodes causing severe damage on agricultural crops worldwide. A study was conducted to identify the species of root-knot nematodes causing damage on honeybush monocultures and to assess the seasonal variations in the nematode population. Soil samples were collected from six experimental sites in Genadendal, Western Cape province of South Africa from 2016 to 2017. DNA was extracted from single-second stage juveniles and species identifi cation was done using species-specifi c sequence-characterised amplifi ed regions (SCAR) primers. Meloidogyne hapla and M. javanica were identifi ed from the sites. Mean population density of the nematodes varied significantly (p < 0.05) in the six sites, with the peak population being recorded in summer of 2017. The study suggests that seasonal variation in temperature and moisture could contribute to changes in the population density of root-knot nematodes in the soil.

Identification of Suitable Meloidogyne spp. Housekeeping Genes.

Gene expression studies often require reliable housekeeping (HK) genes to accurately capture gene expression levels under given conditions. This is especially true for root-knot nematodes (RKN, Meloidogyne spp.), whose drastic developmental changes are strongly dependent upon their environment. Here we utilized a publicly available M. hapla RNAseq database to identify putative HK genes throughout the nematode lifecycle. We then validated these candidate HK genes on M. incognita in order to develop a small library of suitable HK genes for RKN. Seven putative HK genes were selected for validation based on high expression level and ease of primer design. The expression of these genes was quantified by qPCR at different developmental stages to capture the entire life cycle of M. incognita which included eggs and naive infective juveniles through 3-wk post inoculation. Two algorithms, geNorm and Normfinder, identified three genes (Disu, Poly, and Skinase) constitutively and uniformly expressed throughout the entire life cycle of RKN. We believe these genes are superior HK genes suitable to be used as internal reference genes at all stages of RKN. Importantly, while we identified Actin, a commonly used HK gene, as a candidate gene within our RNAseq analyses, our qPCR results did not demonstrate stable expression throughout the nematode life cycle of this gene. This study successfully validated suitable HK genes utilizing both RNAseq data and standard qPCR methods across two species of RKN; suitable HK genes are likely applicable to other species of RKN, or even plant-parasitic nematodes. Additional lists of potential HK genes are also provided if the nematode of interest does not have homologues of the three superior reference genes described here. Gene expression studies on RKN should use validated HK genes to ensure accurate representation of transcript abundance.

Sewage sludge amendment and inoculation with plant-parasitic nematodes do not facilitate the internalization of Salmonella Typhimurium LT2 in lettuce plants.

Contamination of fruits and vegetables with Salmonella is a serious threat to human health. In order to prevent possible contaminations of fresh produce it is necessary to identify the contributing ecological factors. In this study we investigated whether the addition of sewage sludge or the presence of plant-parasitic nematodes foster the internalization of Salmonella enterica serovar Typhimurium LT2 into lettuce plants, posing a potential threat for human health. Greenhouse experiments were conducted to investigate whether the amendment of sewage sludge to soil or the presence of plant-parasitic nematodes Meloidogyne hapla or Pratylenchus crenatus promote the internalization of S. Typhimurium LT2 from soil into the edible part of lettuce plants. Unexpectedly, numbers of cultivable S. Typhimurium LT2 decreased faster in soil with sewage sludge than in control soil but not in root samples. Denaturing gradient gel electrophoresis analysis revealed shifts of the soil bacterial communities in response to sewage sludge amendment and time. Infection and proliferation of nematodes inside plant roots were observed but did not influence the number of cultivable S. Typhimurium LT2 in the root samples or in soil. S. Typhimurium LT2 was not detected in the leaf samples 21 and 49 days after inoculation. The results indicate that addition of sewage sludge, M. hapla or P. crenatus to soil inoculated with S. Typhimurium LT2 did not result in an improved survival in soil or internalization of lettuce plants.

The diverse nematicidal properties and biocontrol efficacy of Bacillus thuringiensis Cry6A against the root-knot nematode Meloidogyne hapla.

Cry6A toxin from Bacillus thuringiensis is a representative nematicidal crystal protein with a variety of nematicidal properties to free-living nematode Caenorhabditis elegans. Cry6A shares very low homology and different structure with Cry5B, another representative nematicidal crystal protein, and probably acts in a distinct pathway. All these strongly indicate that Cry6A toxin is likely a potent candidate for nematicide. The present study dealt with global investigation to determine the detrimental impacts of Cry6Aa2 toxin on Meloidogyne hapla, a root-knot nematode, and evaluated its biocontrol efficacy in pot experiment. Obtained results indicated that Cry6Aa2 toxin exhibits obvious toxicity to second-stage juvenile of M. hapla, and significantly inhibits egg hatch, motility, and penetration to host plant. Pot experiment suggested that soil drenching with spore-crystal mixture of Cry6Aa2 can clearly lighten the disease of root-knot nematode, including reduction of galling index and egg masses on host plant root, decreasing final population of nematode in soil. Moreover, application of Cry6Aa2 can obviously promote plant growth. These results demonstrated that Cry6Aa2 toxin is a promising nematicidal agent, and possesses great potential in plant-parasitic nematode management and construction of transgenic crop with constant resistance to nematode.

First Report of Northern Root-Knot Nematode, Meloidogyne hapla, Parasitic on Oaks, Quercus brantii and Q. infectoria in Iran.

Root-knot nematodes (RKN) are the most serious plant parasitic nematodes having a broad host range exceeding 2,000 plant species. Quercus brantii Lindl. and Q. infectoria Oliv are the most important woody species of Zagros forests in west of Iran where favors sub-Mediterranean climate. National Botanical Garden of Iran (NBGI) is scheduled to be the basic center for research and education of botany in Iran. This garden, located in west of Tehran, was established in 1968 with an area of about 150 ha at altitude of 1,320 m. The Zagros collection has about 3-ha area and it has been designed for showing a small pattern of natural Zagros forests in west of Iran. Brant's oak (Q. brantii) and oak manna tree (Q. infectoria) are the main woody species in Zagros collection, which have been planted in 1989. A nematological survey on Zagros forest collection in NBGI revealed heavily infection of 24-yr-old Q. brantii and Q. infectoria to RKN, Meloidogyne hapla. The roots contained prominent galls along with egg sac on the surface of each gall. The galls were relatively small and in some parts of root several galls were conjugated, and all galls contained large transparent egg masses. The identification of M. hapla was confirmed by morphological and morphometric characters and amplification of D2-D3 expansion segments of 28S rRNA gene. The obtained sequences of large-subunit rRNA gene from M. hapla was submitted to the GenBank database under the accession number KP319025. The sequence was compared with those of M. hapla deposited in GenBank using the BLAST homology search program and showed 99% similarity with those KJ755183, GQ130139, DQ328685, and KJ645428. The second stage juveniles of M. hapla isolated from Brant's oak (Q. Brantii) showed the following morphometric characters: (n = 12), L = 394 ± 39.3 (348 to 450) µm; a = 30.9 ± 4 (24.4 to 37.6); b = 4.6 ± 0.44 (4 to 5.1); b΄ = 3.3 ± 0.3 (2.7 to 3.7), c = 8.0 ± 1 (6.2 to 10.3), c = 5.3 ± 0.8 (3.5 to 6.3); Stylet = 12.1 ± 0.8 (11 to 13) µm; Tail = 50 ± 5.6 (42 to 57) µm; Hyaline 15 ± 1.8 (12 to 18) µm. Oak manna, Q. infectoria population of second stage juveniles clearly possessed short body length and consequently other morphometric features were less than those determined for Q. brantii population, and these features were: (n = 12), L = 359.0 ± 17.3 (319 to 372) µm; a = 28.6 ± 3 (22.8 to 31); b = 5.0 ± 0.3 (4.8 to 5.2); b΄ = 3.3 ± 0.2 (3 to 3.6), c = 8.1 ± 0.5 (7.4 to 8.8), c = 4.7 ± 0.5 (3.9 to 5.2); Stylet = 11.4 ± 0.7 (10 to 12) µm; Tail = 44 ± 1.8 (42 to 47) µm; Hyaline 12 ± 1.7 (10 to 15) µm. To date two species of Meloidogyne, M. quercianaGolden, 1979 and M. christieiGolden and Kaplan, 1986 have been reported to parasitize oaks (Quercus spp.) from the United States of America. M. querciana was found on pin oak Quercus palustris in Virginia. The oak RKN infected pine oak, red oak, and American chestnut heavily in greenhouse tests (Golden, 1979). The other species M. christiei was described from turkey oak and Q. laevis in Florida, which has monospecific host range (Golden and Kaplan, 1986). Both of these RKN species seem to be restricted to the United States of America and have not been reported from other place. According to our knowledge this is the first report of occurrence of M. hapla on Q. brantii and Q. infectoria in the world. This study includes these two oak species to the host range of RKN, M. hapla for the world and expands the information of RKN, M. hapla host ranges on oaks.

Evaluation of 31 potential biofumigant brassicaceous plants as hosts for three meloiodogyne species.

Brassicaceous cover crops can be used for biofumigation after soil incorporation of the mowed crop. This strategy can be used to manage root-knot nematodes (Meloidogyne spp.), but the fact that many of these crops are host to root-knot nematodes can result in an undesired nematode population increase during the cultivation of the cover crop. To avoid this, cover crop cultivars that are poor or nonhosts should be selected. In this study, the host status of 31 plants in the family Brassicaceae for the three root-knot nematode species M. incognita, M. javanica, and M. hapla were evaluated, and compared with a susceptible tomato host in repeated greenhouse pot trials. The results showed that M. incognita and M. javanica responded in a similar fashion to the different cover cultivars. Indian mustard (Brassica juncea) and turnip (B. rapa) were generally good hosts, whereas most oil radish cultivars (Raphanus. sativus ssp. oleiferus) were poor hosts. However, some oil radish cultivars were among the best hosts for M. hapla. The arugula (Eruca sativa) cultivar Nemat was a poor host for all three nematode species tested. This study provides important information for chosing a cover crop with the purpose of managing root-knot nematodes.

Biocontrol-based strategies for improving soil health and managing plant-parasitic nematodes in coffee production.

Coffee is an important commodity for Kenya, where production is steadily declining, despite a global rise in demand. Of the various constraints affecting production, plant-parasitic nematodes are a significant, but often overlooked, threat. As a perennial crop, treating plantations once infected with nematodes becomes difficult. The current study evaluated the drenching application of two biocontrol agents, Trichoderma asperellum and Purpureocillium lilacinum, for their nematode control efficacy, as well as their impact on the soil nematode community structure on mature, established coffee trees in Kenya. Seven Arabica coffee field trials were conducted over two years on trees of various ages. All the fields were heavily infested with Meloidogyne hapla, the first report of the species on coffee in Kenya. Both fungal biocontrol agents were detected endophytically infecting roots and recovered from soil but not until six months after initial applications. The population densities of M. hapla had significantly declined in roots of treated trees 12 months after the initial application, although soil nematode density data were similar across treatments. Based upon the maturity index and the Shannon index, treatment with T. asperellum led to improved soil health conditions and enrichment of diversity in the microbial community. Application of P. lilacinum, in particular, led to an increased abundance of fungivorous nematodes, especially Aphelenchus spp., for which P. lilacinum would appear to be a preferred food source. The soils in the trials were all stressed and denuded, however, which likely delayed the impact of such treatments or detection of any differences between treatments using indices, such as the functional metabolic footprint, over the period of study. A longer period of study would therefore likely provide a better indication of treatment benefits. The current study positively demonstrates, however, the potential for using biologically based options for the environmentally and climate-smart management of nematode threats in a sustainable manner on established, mature coffee plantations.