CRISPR/Cas9-mediated mutagenesis of phytoene desaturase in pigeonpea and groundnut.

The CRISPR/Cas9 technology, renowned for its ability to induce precise genetic alterations in various crop species, has encountered challenges in its application to grain legume crops such as pigeonpea and groundnut. Despite attempts at gene editing in groundnut, the low rates of transformation and editing have impeded its widespread adoption in producing genetically modified plants. This study seeks to establish an effective CRISPR/Cas9 system in pigeonpea and groundnut through Agrobacterium-mediated transformation, with a focus on targeting the phytoene desaturase (PDS) gene. The PDS gene is pivotal in carotenoid biosynthesis, and its disruption leads to albino phenotypes and dwarfism. Two constructs (one each for pigeonpea and groundnut) were developed for the PDS gene, and transformation was carried out using different explants (leaf petiolar tissue for pigeonpea and cotyledonary nodes for groundnut). By adjusting the composition of the growth media and refining Agrobacterium infection techniques, transformation efficiencies of 15.2% in pigeonpea and 20% in groundnut were achieved. Mutation in PDS resulted in albino phenotype, with editing efficiencies ranging from 4 to 6%. Sequence analysis uncovered a nucleotide deletion (A) in pigeonpea and an A insertion in groundnut, leading to a premature stop codon and, thereby, an albino phenotype. This research offers a significant foundation for the swift assessment and enhancement of CRISPR/Cas9-based genome editing technologies in legume crops.

Drought and heat stress: insights into tolerance mechanisms and breeding strategies for pigeonpea improvement.

MAIN CONCLUSION: Pigeonpea has potential to foster sustainable agriculture and resilience in evolving climate change; understanding bio-physiological and molecular mechanisms of heat and drought stress tolerance is imperative to developing resilience cultivars. Pigeonpea is an important legume crop that has potential resilience in the face of evolving climate scenarios. However, compared to other legumes, there has been limited research on abiotic stress tolerance in pigeonpea, particularly towards drought stress (DS) and heat stress (HS). To address this gap, this review delves into the genetic, physiological, and molecular mechanisms that govern pigeonpea's response to DS and HS. It emphasizes the need to understand how this crop combats these stresses and exhibits different types of tolerance and adaptation mechanisms through component traits. The current article provides a comprehensive overview of the complex interplay of factors contributing to the resilience of pigeonpea under adverse environmental conditions. Furthermore, the review synthesizes information on major breeding techniques, encompassing both conventional methods and modern molecular omics-assisted tools and techniques. It highlights the potential of genomics and phenomics tools and their pivotal role in enhancing adaptability and resilience in pigeonpea. Despite the progress made in genomics, phenomics and big data analytics, the complexity of drought and heat tolerance in pigeonpea necessitate continuous exploration at multi-omic levels. High-throughput phenotyping (HTP) is crucial for gaining insights into perplexed interactions among genotype, environment, and management practices (GxExM). Thus, integration of advanced technologies in breeding programs is critical for developing pigeonpea varieties that can withstand the challenges posed by climate change. This review is expected to serve as a valuable resource for researchers, providing a deeper understanding of the mechanisms underlying abiotic stress tolerance in pigeonpea and offering insights into modern breeding strategies that can contribute to the development of resilient varieties suited for changing environmental conditions.

Bacterial exopolysaccharide amendment improves the shelf life and functional efficacy of bioinoculant under salinity stress.

AIM: Bacterial exopolysaccharides (EPS) possess numerous properties beneficial for the growth of microbes and plants under hostile conditions. The study aimed to develop a bioformulation with bacterial EPS to enhance the bioinoculant's shelf life and functional efficacy under salinity stress. METHODS AND RESULTS: High EPS-producing and salt-tolerant bacterial strain (Bacillus haynessi SD2) exhibiting auxin-production, phosphate-solubilization, and biofilm-forming ability, was selected. EPS-based bioformulation of SD2 improved the growth of three legumes under salt stress, from which pigeonpea was selected for further experiments. SD2 improved the growth and lowered the accumulation of stress markers in plants under salt stress. Bioformulations with varying EPS concentrations (1% and 2%) were stored for 6 months at 4°C, 30°C, and 37°C to assess their shelf life and functional efficacy. The shelf life and efficacy of EPS-based bioformulation were sustained even after 6 months of storage at high temperature, enhancing pigeonpea growth under stress in both control and natural conditions. However, the efficacy of non EPS-based bioformulation declined following four months of storage. The bioformulation (with 1% EPS) modulated bacterial abundance in the plant's rhizosphere under stress conditions. CONCLUSION: The study brings forth a new strategy for developing next-generation bioformulations with higher shelf life and efficacy for salinity stress management in pigeonpea.

Insights into the role of SUMO in regulating drought stress responses in pigeonpea (Cajanus cajan).

KEY MESSAGE: We have identified and analyzed 28 SUMO-pathway proteins from pigeonpea. Enhanced transcripts of pathway genes and increased SUMO conjugation under drought signifies the role of SUMO in regulating stress. Being a protein-rich and nutrient-dense legume crop, pigeonpea (Cajanus cajan) holds a vital position in a vegetarian meal. It is a resilient crop capable of striving in harsh climates and provides a means of subsistence to small-holding farmers. Nevertheless, extremes of water scarcity and drought conditions, especially during seedling and reproductive stages, remains a major issue severely impacting the growth and overall productivity of pigeonpea. Small ubiquitin-like modifier (SUMO), a post-translational modification system, plays a pivotal role in fortifying plants against stressful conditions by rapid reprogramming of molecular events. In this study, we have scanned the entire pigeonpea genome and identified 28 candidates corresponding to SUMO machinery components of pigeonpea. qRT-PCR analysis of different SUMO machinery genes validated their presence under natural conditions. The analysis of the promoters of identified SUMO machinery genes revealed the presence of abiotic stress-related cis-regulatory elements highlighting the potential involvement of the genes in abiotic stress responses. The transcript level analysis of selected SUMO machinery genes and global SUMO status of pigeonpea proteins in response to drought stress suggests an integral role of SUMO in regulating drought stress conditions in pigeonpea. Collectively, the work puts forward a detailed in silico analysis of pigeonpea SUMO machinery candidates and highlights the essential role of SUMOylation in drought stress responses. Being the first report on a pulse crop, the study will serve as a resource for devising strategies for counteracting drought stress in pigeonpea that can be further extended to other pulse crops.

Genetic diversity and population structure of Fusarium udum in India and its correlation with pigeonpea wilt incidence.

In a study conducted in India, 50 Fusarium isolates were collected from pigeonpea growing regions and extensively examined for their cultural and morphological characteristics. These isolates exhibited significant variations in traits including growth rate, mycelial growth patterns, color, zonation, pigmentation, spore size, and septation. Subsequently, 30 isolates were chosen for pathogenicity testing on eight pigeonpea genotypes. Results showed distinct reactions, with four genotypes displaying differential responses (ICP8858, ICP8859, ICP8862, and BDN-2), while ICP9174 and ICP8863 consistently exhibited resistance and ICP2376 and BAHAR remained susceptible to wilt disease. To study the interaction between Fusarium isolates and pigeonpea host differentials (HDs), an additive main effects and multiplicative interaction analysis was conducted. The majority of disease incidence variation (75.54%) was attributed to HD effects, while Fusarium isolate effects accounted for only 1.99%. The interaction between Isolates and HDs (I × HD) contributed 21.95% to the total variation, being smaller than HD but larger than I. Based on HD reactions, isolates were classified into nine variants, showing varying distributions across pigeonpea growing states, with variants 2 and 3 being prevalent in several regions. This diversity underscores the need for location-specific wilt-resistant pigeonpea cultivars. Furthermore, genetic analysis of 23 representative isolates, through internal transcribed spacer region of ribosomal DNA and translation elongation factor 1-α gene sequencing, revealed three major clusters: Fusarium udum, Fusarium solani, and Fusarium equiseti. These findings hold potential for developing location-specific wilt-resistant pigeonpea cultivars and enhancing disease management strategies.

Cajanus platycarpus Flavonoid 3'5' Hydroxylase_2 (CpF3'5'H_2) Confers Resistance to Helicoverpa armigera by Modulating Total Polyphenols and Flavonoids in Transgenic Tobacco.

Pod borer Helicoverpa armigera, a polyphagus herbivorous pest, tremendously incurs crop damage in economically important crops. This necessitates the identification and utility of novel genes for the control of the herbivore. The present study deals with the characterization of a flavonoid 3'5' hydroxylase_2 (F3'5'H_2) from a pigeonpea wild relative Cajanus platycarpus, possessing a robust chemical resistance response to H. armigera. Though F3'5'H_2 displayed a dynamic expression pattern in both C. platycarpus (Cp) and the cultivated pigeonpea, Cajanus cajan (Cc) during continued herbivory, CpF3'5'H_2 showed a 4.6-fold increase vis a vis 3-fold in CcF3'5'H_2. Despite similar gene copy numbers in the two Cajanus spp., interesting genic and promoter sequence changes highlighted the stress responsiveness of CpF3'5'H_2. The relevance of CpF3'5'H_2 in H. armigera resistance was further validated in CpF3'5'H_2-overexpressed transgenic tobacco based on reduced leaf damage and increased larval mortality through an in vitro bioassay. As exciting maiden clues, CpF3'5'H_2 deterred herbivory in transgenic tobacco by increasing total flavonoids, polyphenols and reactive oxygen species (ROS) scavenging capacity. To the best of our knowledge, this is a maiden attempt ascertaining the role of F3'5'H_2 gene in the management of H. armigera. These interesting leads suggest the potential of this pivotal branch-point gene in biotic stress management programs.

Structural and functional analysis of CCT family genes in pigeonpea.

BACKGROUND: Pigeonpea (Cajanus cajan L.) is a photoperiod-sensitive short-day plant. Understanding the flowering-related genes is critical to developing photoperiod insensitive cultivars. METHODS: The CCT family genes were identified using 'CCT DOMAIN PROTEIN' as a keyword and localized on the chromosomes using the BLAST search option available at the LIS database. The centromeric positions were identified through BLAST search using the centromeric repeat sequence of C. cajan as a query against the chromosome-wise FASTA files downloaded from the NCBI database. The CCT family genes were classified based on additional domains and/or CCT domains. The orthologous and phylogenetic relationships were inferred using the OrthoFinder and MEGA 10.1 software, respectively. The CCT family genes' expression level in photoperiod-sensitive and insensitive genotypes was compared using RNA-seq data and qRT-PCR analysis. RESULTS: We identified 33 CCT family genes in C. cajan distributed on ten chromosomes and nine genomic scaffolds. They were classified into CMF-type, COL-type, PRR-type, and GTCC- type. The CCT family genes of legumes exhibited an extensive orthologous relationship. Glycine max showed the maximum similarity of CCT family genes with C. cajan. The expression analysis of CCT family genes using photoperiod insensitive (ICP20338) and photoperiod sensitive (MAL3) genotypes of C. cajan demonstrated that CcCCT4 and CcCCT23 are the active CONSTANS in ICP20338. In contrast, only CcCCT23 is active in MAL3. CONCLUSION: The CCT family genes in C. cajan vary considerably in structure and domain types. They are maximally similar to soybean's CCT family genes. The differential photoperiod response of pigeonpea genotypes, ICP20338 and MAL3, is possibly due to the difference in the number and types of active CONSTANS in them.

Genome-wide analysis of tandem duplicated genes and their contribution to stress resistance in pigeonpea (Cajanus cajan).

Pigeonpea is the main protein source for more than one billion people, and it shows a strong adaptation to biotic stress and abiotic stress. Gene duplication is a fundamental process in genome evolution. Although the draft sequence of the pigeonpea genome has been available since 2011, further analysis of tandem duplicated genes (TDGs) and their contribution to the evolution of pigeonpea has not been reported. In this study, we identify 3211 TDGs in the pigeonpea genome and KEGG enrichment analysis of these genes shows that the TDGs are significantly enriched in resistance-related pathways. In addition, we find that TDGs are more abundant in retrotransposon-related genes in pigeonpea than in the other species included in our study. These results indicate that stress resistance in pigeonpea may be ascribed to resistance-related pathways and retrotransposons originating from tandem duplications. Our study will provide an important basis for further research in pigeonpea breeding.

Amenability of Maruca vitrata (Lepidoptera: Crambidae) to gene silencing through exogenous administration and host-delivered dsRNA in pigeonpea (Cajanus cajan L.).

Insect pests are one of the major biotic stresses limiting yield in commercially important crops. The lepidopteran polyphagous spotted pod borer, Maruca vitrata causes significant economic losses in legumes including pigeonpea. RNA interference (RNAi)-based gene silencing has emerged as one of the potential biotechnological tools for crop improvement. We report in this paper, RNAi in M. vitrata through exogenous administration of dsRNA with sequence specificity to three functionally important genes, Alpha-amylase (α-amylase), Chymotrypsin-like serine protease (CTLP) and Tropomyosin (TPM) into the larval haemolymph and their host-delivered RNAi in pigeonpea. Significant decline in the expression of selected genes supported by over-expression of DICER and generation of siRNA indicated the occurrence of RNAi in the dsRNA-injected larvae. Additionally, the onset of RNAi in the herbivore was demonstrated in pigeonpea, one of the prominent hosts, by host-delivered dsRNA. Transgenics in pigeonpea (cv. Pusa 992), a highly recalcitrant crop, were developed through a shoot apical meristem-targeted in planta transformation strategy and evaluated. Plant level bioassays in transgenic events characterized and selected at molecular level showed mortality of M. vitrata larvae as well as reduced feeding when compared to wild-type. Furthermore, molecular evidence for down regulation of target genes in the insects that fed on transgenic plants authenticated RNAi. Considering the variability of gene silencing in lepidopteran pests, this study provided corroborative proof for the possibility of gene silencing in M. vitrata through both the strategies. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s12298-022-01133-3.

Comprehensive analysis and identification of drought-responsive candidate NAC genes in three semi-arid tropics (SAT) legume crops.

BACKGROUND: Chickpea, pigeonpea, and groundnut are the primary legume crops of semi-arid tropics (SAT) and their global productivity is severely affected by drought stress. The plant-specific NAC (NAM - no apical meristem, ATAF - Arabidopsis transcription activation factor, and CUC - cup-shaped cotyledon) transcription factor family is known to be involved in majority of abiotic stresses, especially in the drought stress tolerance mechanism. Despite the knowledge available regarding NAC function, not much information is available on NAC genes in SAT legume crops. RESULTS: In this study, genome-wide NAC proteins - 72, 96, and 166 have been identified from the genomes of chickpea, pigeonpea, and groundnut, respectively, and later grouped into 10 clusters in chickpea and pigeonpea, while 12 clusters in groundnut. Phylogeny with well-known stress-responsive NACs in Arabidopsis thaliana, Oryza sativa (rice), Medicago truncatula, and Glycine max (soybean) enabled prediction of putative stress-responsive NACs in chickpea (22), pigeonpea (31), and groundnut (33). Transcriptome data revealed putative stress-responsive NACs at various developmental stages that showed differential expression patterns in the different tissues studied. Quantitative real-time PCR (qRT-PCR) was performed to validate the expression patterns of selected stress-responsive, Ca_NAC (Cicer arietinum - 14), Cc_NAC (Cajanus cajan - 15), and Ah_NAC (Arachis hypogaea - 14) genes using drought-stressed and well-watered root tissues from two contrasting drought-responsive genotypes of each of the three legumes. Based on expression analysis, Ca_06899, Ca_18090, Ca_22941, Ca_04337, Ca_04069, Ca_04233, Ca_12660, Ca_16379, Ca_16946, and Ca_21186; Cc_26125, Cc_43030, Cc_43785, Cc_43786, Cc_22429, and Cc_22430; Ah_ann1.G1V3KR.2, Ah_ann1.MI72XM.2, Ah_ann1.V0X4SV.1, Ah_ann1.FU1JML.2, and Ah_ann1.8AKD3R.1 were identified as potential drought stress-responsive candidate genes. CONCLUSION: As NAC genes are known to play role in several physiological and biological activities, a more comprehensive study on genome-wide identification and expression analyses of the NAC proteins have been carried out in chickpea, pigeonpea and groundnut. We have identified a total of 21 potential drought-responsive NAC genes in these legumes. These genes displayed correlation between gene expression, transcriptional regulation, and better tolerance against drought. The identified candidate genes, after validation, may serve as a useful resource for molecular breeding for drought tolerance in the SAT legume crops.

Comparative transcriptome analyses revealed different heat stress responses in pigeonpea (Cajanus cajan) and its crop wild relatives.

KEY MESSAGE: Comparative transcriptome analyses accompanied by biochemical assays revealed high variability in heat stress response in Cajanus species. Among the studied species, C. scarabaeoides was the most thermotolerant followed by C. cajanifolius, C. cajan, and C. acutifolius. Pigeonpea is one of the climate-resilient grain legumes. Though the optimum temperature for cultivated pigeonpea is ~ 25-35 °C, its wild relatives grow in temperatures ranging between 18 and 45 °C. To gain insight into molecular mechanisms responsible for the heat stress tolerance in pigeonpea, we conducted time-series transcriptome analysis of one pigeonpea cultivar (Cajanus cajan) and two wild relatives, Cajanus acutifolius, and Cajanus scarabaeoides subjected to heat stress at 42 ± 2 ºC for 30 min and 3 h. A total of 9521, 12,447, and 5282 identified transcripts were differentially expressed in C. cajan, C. acutifolius, and C. scarabaeoides, respectively. In this study, we observed that a significant number of genes undergo alternative splicing in a species-specific pattern during heat stress. Gene expression profiling analysis, histochemical assay, chlorophyll content, and electrolyte leakage assay showed that C. scarabaeoides has adaptive features for heat stress tolerance. The gene set enrichment analyses of differentially expressed genes in these Cajanus species during heat stress revealed that oxidoreductase activity, transcription factor activity, oxygen-evolving complex, photosystem-II, thylakoid, phenylpropanoid biosynthetic process, secondary metabolic process, and flavonoid biosynthetic process were highly affected. The histochemical assay showed more lipid peroxidation in C. acutifolius compared to other Cajanus species inferring the presence of higher quantities of polyunsaturated fatty acids in the plasma membrane which might have led to severe damage of membrane-bound organelles like chloroplast, and high electrolyte leakage during heat stress. This study paves the way for the identification of candidate genes, which can be useful for the development of thermo-tolerant pigeonpea cultivars.

Arbuscular mycorrhizae and silicon alleviate arsenic toxicity by enhancing soil nutrient availability, starch degradation and productivity in Cajanus cajan (L.) Millsp.

Arsenic (As) pollution of soil reduces the growth and reproductive potential of plants. Silicon (Si) and arbuscular mycorrhizal (AM) fungi play significant roles in alleviating adverse effects of As stress. However, studies are scant regarding alleviative effects of Si in pigeonpea (Cajanus cajan L. Millsp.) because legumes are considered low Si-accumulators. We investigated the individual as well as synergistic potential of Si with two AM species (M1-Claroideoglomus etunicatum and M2-Rhizoglomus intraradices) in modulating soil properties, thereby improving growth and productivity of pigeonpea genotype Pusa 2001 grown in AsV and AsIII challenged soils. Both As species hampered the establishment of AM symbiosis, thus, reducing nutrient uptake, growth and yield, with AsIII more toxic than AsV. Exogenously applied Si and AM species enhanced soil glomalin and phosphatases activity, hence decreased metal bioavailability in soil, increased plant nutrient acquisition, biomass and chlorophylls; with maximum benefits provided by M2, closely followed by Si and least by M1. These amendments boosted the activities of starch hydrolytic enzymes (α-, ß-amylase, starch phosphorylase) in plants, along with a simultaneous increase in total soluble sugars (TSS). This enhanced sugar accumulation directly led to improved reproductive attributes, more efficiently by M2 and Si than by M1. Moreover, there was a substantial increase in proline biosynthesis due to significantly enhanced activities of its biosynthetic enzymes. Additionally, combined applications of Si and AM, especially +Si+M2, complemented each other where AM enhanced Si uptake, while Si induced mycorrhization, suggesting their mutual and beneficial roles in ameliorating metal(loid) toxicity and achieving sustainability in pigeonpea production under As stress.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Comparative TMT Proteomic Analysis Unveils Unique Insights into Helicoverpa armigera (Hübner) Resistance in Cajanus scarabaeoides (L.) Thouars.

Pigeonpea [Cajanus cajan (L.) Millspaugh] is an economically important legume playing a crucial role in the semi-arid tropics. Pigeonpea is susceptible to Helicoverpa armigera (Hübner), which causes devastating yield losses. This pest is developing resistance to many commercially available insecticides. Therefore, crop wild relatives of pigeonpea, are being considered as potential sources of genes to expand the genetic base of cultivated pigeonpea to improve traits such as host plant resistance to pests and pathogens. Quantitative proteomic analysis was conducted using the tandem mass tag platform to identify differentially abundant proteins between IBS 3471 and ICPL 87 tolerant accession and susceptible variety to H. armigera, respectively. Leaf proteome were analysed at the vegetative and flowering/podding growth stages. H. armigera tolerance in IBS 3471 appeared to be related to enhanced defence responses, such as changes in secondary metabolite precursors, antioxidants, and the phenylpropanoid pathway. The development of larvae fed on an artificial diet with IBS 3471 lyophilised leaves showed similar inhibition with those fed on an artificial diet with quercetin concentrations with 32 mg/25 g of artificial diet. DAB staining (3,3'-diaminobenzidine) revealed a rapid accumulation of reactive oxygen species in IBS 3471. We conclude that IBS 3471 is an ideal candidate for improving the genetic base of cultivated pigeonpea, including traits for host plant resistance.

Alteration of proteome in germinating seedlings of piegonpea (Cajanus cajan) after salt stress.

Pigeonpea (Cajanus cajan) is an important crop in semi-arid regions and a significant source of dietary proteins in India. The plant is sensitive to salinity stress, which adversely affects its productivity. Based on the dosage-dependent influence of salinity stress on the growth and ion contents in the young seedlings of pigeonpea, a comparative proteome analysis of control and salt stressed (150 mM NaCl) plants was conducted using 7 days-old seedlings. Among various amino acids, serine, aspartate and asparagine were the amino acids that showed increment in the root, whereas serine, aspartate and phenylalanine showed an upward trend in shoots under salt stress. Furthermore, a label-free and gel-free comparative Q-Tof, Liquid Chromatography-Mass spectrometry (LC-MS) revealed total of 118 differentially abundant proteins in roots and shoots with and without salt stress conditions. Proteins related to DNA-binding with one finger (Dof) transcription factor family and glycine betaine (GB) biosynthesis were differentially expressed in the shoot and root of the salinity-stressed seedlings. Exogenous application of choline on GB accumulation under salt stress showed the increase of GB pathway in C. cajan. Gene expression analysis for differentially abundant proteins revealed the higher induction of ethanolamine kinase (CcEthKin), choline-phosphate cytidylyltransferase 1-like (CcChoPh), serine hydroxymethyltransferase (CcSHMT) and Dof protein (CcDof29). The results indicate the importance of, choline precursor, serine biosynthetic pathways and glycine betaine synthesis in salinity stress tolerance. The glycine betaine protects plant from cellular damages and acts as osmoticum under stress condition. Protein interaction network (PIN) analysis demonstrated that 61% of the differentially expressed proteins exhibited positive interactions and 10% of them formed the center of the PIN. Further, The PIN analysis also highlighted the potential roles of the cytochrome c oxidases in sensing and signaling cascades governing salinity stress responses in pigeonpea. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s12298-021-01116-w.

High resolution mapping of restoration of fertility (Rf) by combining large population and high density genetic map in pigeonpea [Cajanus cajan (L.) Millsp].

BACKGROUND: Restoration of fertility (Rf) is an important trait for pigeonpea hybrid breeding. Few coarse quantitative trait locus (QTL) studies conducted in the past identified QTLs with large confidence intervals on the genetic map and could not provide any information on possible genes responsible for Rf in pigeonpea. Therefore, a larger population comprising of 369 F2s derived from ICPA 2039 × ICPL 87119 was genotyped with high density Axiom Cajanus SNP Array with 56 K single nucleotide polymorphism (SNPs) for high resolution mapping of Rf. RESULTS: A genetic map with 4867 markers was developed and a total of four QTLs for Rf were identified. While one major effect QTL (qRf8.1) was co-localized with the QTL identified in two previous studies and its size was refined from 1.2 Mb to 0.41 Mb. Further analysis of qRf8.1 QTL with genome sequence provided 20 genes including two genes namely flowering locus protein T and 2-oxoglutarate/Fe (II)-dependent dioxygenases (2-ODDs) superfamily protein with known function in the restoration of fertility. CONCLUSION: The qRf8.1 QTL and the potential candidate genes present in this QTL will be valuable for genomics-assisted breeding and identification of causal genes/nucleotides for the restoration of fertility in the hybrid breeding program of pigeonpea.

Genome-wide analysis of epigenetic and transcriptional changes associated with heterosis in pigeonpea.

Hybrids are extensively used in agriculture to deliver an increase in yield, yet the molecular basis of heterosis is not well understood. Global DNA methylation analysis, transcriptome analysis and small RNA profiling were aimed to understand the epigenetic effect of the changes in gene expression level in the two hybrids and their parental lines. Increased DNA methylation was observed in both the hybrids as compared to their parents. This increased DNA methylation in hybrids showed that majority of the 24-nt siRNA clusters had higher expression in hybrids than the parents. Transcriptome analysis revealed that various phytohormones (auxin and salicylic acid) responsive hybrid-MPV DEGs were significantly altered in both the hybrids in comparison to MPV. DEGs associated with plant immunity and growth were overexpressed whereas DEGs associated with basal defence level were repressed. This antagonistic patterns of gene expression might contribute to the greater growth of the hybrids. It was also noticed that some common as well as unique changes in the regulatory pathways were associated with heterotic growth in both the hybrids. Approximately 70% and 67% of down-regulated hybrid-MPV DEGs were found to be differentially methylated in ICPH 2671 and ICPH 2740 hybrid, respectively. This reflected the association of epigenetic regulation in altered gene expressions. Our findings also revealed that miRNAs might play important roles in hybrid vigour in both the hybrids by regulating their target genes, especially in controlling plant growth and development, defence and stress response pathways. The above finding provides an insight into the molecular mechanism of pigeonpea heterosis.

Superior haplotypes for haplotype-based breeding for drought tolerance in pigeonpea (Cajanus cajan L.).

Haplotype-based breeding, a recent promising breeding approach to develop tailor-made crop varieties, deals with identification of superior haplotypes and their deployment in breeding programmes. In this context, whole genome re-sequencing data of 292 genotypes from pigeonpea reference set were mined to identify the superior haplotypes for 10 drought-responsive candidate genes. A total of 83, 132 and 60 haplotypes were identified in breeding lines, landraces and wild species, respectively. Candidate gene-based association analysis of these 10 genes on a subset of 137 accessions of the pigeonpea reference set revealed 23 strong marker-trait associations (MTAs) in five genes influencing seven drought-responsive component traits. Haplo-pheno analysis for the strongly associated genes resulted in the identification of most promising haplotypes for three genes regulating five component drought traits. The haplotype C. cajan_23080-H2 for plant weight (PW), fresh weight (FW) and turgid weight (TW), the haplotype C. cajan_30211-H6 for PW, FW, TW and dry weight (DW), the haplotype C. cajan_26230-H11 for FW and DW and the haplotype C. cajan_26230-H5 for relative water content (RWC) were identified as superior haplotypes under drought stress condition. Furthermore, 17 accessions containing superior haplotypes for three drought-responsive genes were identified. The identified superior haplotypes and the accessions carrying these superior haplotypes will be very useful for deploying haplotype-based breeding to develop next-generation tailor-made better drought-responsive pigeonpea cultivars.

Genomics-assisted breeding for pigeonpea improvement.

KEY MESSAGE: The review outlines advances in pigeonpea genomics, breeding and seed delivery systems to achieve yield gains at farmers' field. Pigeonpea is a nutritious and stress-tolerant grain legume crop of tropical and subtropical regions. Decades of breeding efforts in pigeonpea have resulted in development of a number of high-yielding cultivars. Of late, the development of CMS-based hybrid technology has allowed the exploitation of heterosis for yield enhancement in this crop. Despite these positive developments, the actual on-farm yield of pigeonpea is still well below its potential productivity. Growing needs for high and sustainable pigeonpea yields motivate scientists to improve the breeding efficiency to deliver a steady stream of cultivars that will provide yield benefits under both ideal and stressed environments. To achieve this objective in the shortest possible time, it is imperative that various crop breeding activities are integrated with appropriate new genomics technologies. In this context, the last decade has seen a remarkable rise in the generation of important genomic resources such as genome-wide markers, high-throughput genotyping assays, saturated genome maps, marker/gene-trait associations, whole-genome sequence and germplasm resequencing data. In some cases, marker/gene-trait associations are being employed in pigeonpea breeding programs to improve the valuable yield and market-preferred traits. Embracing new breeding tools like genomic selection and speed breeding is likely to improve genetic gains. Breeding high-yielding pigeonpea cultivars with key adaptation traits also calls for a renewed focus on systematic selection and utilization of targeted genetic resources. Of equal importance is to overcome the difficulties being faced by seed industry to take the new cultivars to the doorstep of farmers.

Bradyrhizobium ivorense sp. nov. as a potential local bioinoculant for Cajanus cajan cultures in Côte d'Ivoire.

For many smallholder farmers of Sub-Saharan Africa, pigeonpea (Cajanus cajan) is an important crop to make ends meet. To ascertain the taxonomic status of pigeonpea isolates of Côte d'Ivoire previously identified as bradyrhizobia, a polyphasic approach was applied to strains CI-1BT, CI-14A, CI-19D and CI-41S. Phylogeny of 16S ribosomal RNA (rRNA) genes placed these nodule isolates in a separate lineage from current species of the B. elkanii super clade. In phylogenetic analyses of single and concatenated partial dnaK, glnII, gyrB, recA and rpoB sequences, the C. cajan isolates again formed a separate lineage, with strain CI-1BT sharing the highest sequence similarity (95.2 %) with B. tropiciagri SEMIA 6148T. Comparative genomic analyses corroborated the novel species status, with 86 % ANIb and 89 % ANIm as the highest average nucleotide identity (ANI) values with B. elkanii USDA 76T. Although CI-1BT, CI-14A, CI-19D and CI-41S shared similar phenotypic and metabolic properties, growth of CI-41S was slower in/on various media. Symbiotic efficacy varied significantly between isolates, with CI-1BT and CI-41S scoring on the C. cajan 'Light-Brown' landrace as the most and least proficient bacteria, respectively. Also proficient on Vigna radiata (mung bean), Vigna unguiculata (cowpea, niébé) and additional C. cajan cultivars, CI-1BT represents a potential bioinoculant adapted to local soil conditions and capable of fostering the growth of diverse legume crops in Côte d'Ivoire. Given the data presented here, we propose the 19 C. cajan isolates to belong to a novel species called Bradyrhizobium ivorense sp. nov., with CI-1BT (=CCOS 1862T=CCMM B1296T) as a type strain.