A Jasmonate Signaling Network Activates Root Stem Cells and Promotes Regeneration.

Plants are sessile and have to cope with environmentally induced damage through modification of growth and defense pathways. How tissue regeneration is triggered in such responses and whether this involves stem cell activation is an open question. The stress hormone jasmonate (JA) plays well-established roles in wounding and defense responses. JA also affects growth, which is hitherto interpreted as a trade-off between growth and defense. Here, we describe a molecular network triggered by wound-induced JA that promotes stem cell activation and regeneration. JA regulates organizer cell activity in the root stem cell niche through the RBR-SCR network and stress response protein ERF115. Moreover, JA-induced ERF109 transcription stimulates CYCD6;1 expression, functions upstream of ERF115, and promotes regeneration. Soil penetration and response to nematode herbivory induce and require this JA-mediated regeneration response. Therefore, the JA tissue damage response pathway induces stem cell activation and regeneration and activates growth after environmental stress.

Root-knot nematodes produce functional mimics of tyrosine-sulfated plant peptides.

Root-knot nematodes (Meloidogyne spp.) are highly evolved obligate parasites threatening global food security. These parasites have a remarkable ability to establish elaborate feeding sites in roots, which are their only source of nutrients throughout their life cycle. A wide range of nematode effectors have been implicated in modulation of host pathways for defense suppression and/or feeding site development. Plants produce a diverse array of peptide hormones including PLANT PEPTIDE CONTAINING SULFATED TYROSINE (PSY)-family peptides, which promote root growth via cell expansion and proliferation. A sulfated PSY-like peptide RaxX (required for activation of XA21 mediated immunity X) produced by the biotrophic bacterial pathogen (Xanthomonas oryzae pv. oryzae) has been previously shown to contribute to bacterial virulence. Here, we report the identification of genes from root-knot nematodes predicted to encode PSY-like peptides (MigPSYs) with high sequence similarity to both bacterial RaxX and plant PSYs. Synthetic sulfated peptides corresponding to predicted MigPSYs stimulate root growth in Arabidopsis. MigPSY transcript levels are highest early in the infection cycle. Downregulation of MigPSY gene expression reduces root galling and egg production, suggesting that the MigPSYs serve as nematode virulence factors. Together, these results indicate that nematodes and bacteria exploit similar sulfated peptides to hijack plant developmental signaling pathways to facilitate parasitism.

Overexpression of NtEXPA7 promotes seedling growth and resistance to root-knot nematode in tobacco.

Root-knot nematode (RKN) is one of the most damaging plant pathogen in the world. They exhibit a wide host range and cause serious crop losses. The cell wall, encasing every plant cell, plays a crucial role in defending of RKN invasion. Expansins are a group of cell wall proteins inducing cell wall loosening and extensibility. They are widely involved in the regulation of plant growth and the response to biotic and abiotic stresses. In this study, we have characterized the biological function of tobacco (Nicotiana tabacum) NtEXPA7, the homologue of Solyc08g080060.2 (SlEXPA18), of which the transcription level was significantly reduced in susceptible tomato upon RKN infection. The expression of NtEXPA7 was up-regulated after inoculation of RKNs. The NtEXPA7 protein resided in the cell wall. Overexpression of NtEXPA7 promoted the seedling growth of transgenic tobacco. Meanwhile the increased expression of NtEXPA7 was beneficial to enhance the resistance against RKNs. This study expands the understanding of biological role of expansin in coordinate plant growth and disease resistance.

Brown planthopper infestation on rice reduces plant susceptibility to Meloidogyne graminicola by reducing root sugar allocation.

Plants are simultaneously attacked by different pests that rely on sugars uptake from plants. An understanding of the role of plant sugar allocation in these multipartite interactions is limited. Here, we characterized the expression patterns of sucrose transporter genes and evaluated the impact of targeted transporter gene mutants and brown planthopper (BPH) phloem-feeding and oviposition on root sugar allocation and BPH-reduced rice susceptibility to Meloidogyne graminicola. We found that the sugar transporter genes OsSUT1 and OsSUT2 are induced at BPH oviposition sites. OsSUT2 mutants showed a higher resistance to gravid BPH than to nymph BPH, and this was correlated with callose deposition, as reflected in a different effect on M. graminicola infection. BPH phloem-feeding caused inhibition of callose deposition that was counteracted by BPH oviposition. Meanwhile, this pivotal role of sugar allocation in BPH-reduced rice susceptibility to M. graminicola was validated on rice cultivar RHT harbouring BPH resistance genes Bph3 and Bph17. In conclusion, we demonstrated that rice susceptibility to M. graminicola is regulated by BPH phloem-feeding and oviposition on rice through differences in plant sugar allocation.

Eco-friendly management of Meloidogyne incognita in cadmium-contaminated soil by using nematophagous fungus Purpureocillium lavendulum YMF1.683: Efficacy and mechanism.

Root-knot nematodes (RKNs) are distributed globally, including in agricultural fields contaminated by heavy metals (HM), and can cause serious crop damages. Having a method that could control RKNs in HM-contaminated soil while limit HM accumulation in crops could provide significant benefits to both farmers and consumers. In this study, we showed that the nematophagous fungus Purpureocillium lavendulum YMF1.683 exhibited a high nematocidal activity against the RKN Meloidogyne incognita and a high tolerance to CdCl2. Comparing to the P. lavendulum YMF1.838 which showed low tolerance to Cd2+, strain YMF1.683 effectively suppressed M. incognita infection and significantly reduced the Cd2+ uptake in tomato root and fruit in soils contaminated by 100 mg/kg Cd2+. Transcriptome analyses and validation of gene expression by RT-PCR revealed that the mechanisms contributed to high Cd-resistance in YMF1.683 mainly included activating autophagy pathway, increasing exosome secretion of Cd2+, and activating antioxidation systems. The exosomal secretory inhibitor GW4869 reduced the tolerance of YMF1.683 to Cd2+, which firstly demonstrated that fungal exosome was involved in HM tolerance. The up-regulation of glutathione synthesis pathway, increasing enzyme activities of both catalase and superoxide dismutase also played important roles in Cd2+ tolerance of YMF1.683. In Cd2+-contaminated soil, YMF1.683 limited Cd2+-uptake in tomato by up-regulating the genes of ABCC family in favor of HM sequestration in plant, and down-regulating the genes of ZIP, HMA, NRAMP, YSL families associated with HM absorption, transport, and uptake in plant. Our results demonstrated that YMF1.683 could be a promising bio-agent in eco-friendly management of M. incognita in Cd2+ contaminated soils.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

First Report of the Root-Knot Nematode Meloidogyne incognita on Bletilla striata Rchb.f. (Orchidaceae) in China.

Bletilla striata Rchb.f., is a perennial herbaceous bulbous plant known as the Chinese ground or hyacinth orchid classified in the Orchidaceae. It is native to southeast Asia and mainly distributed in China, Japan and northern Myanmar (He et al. 2017). It has the functions of astringent hemostasis and analgesia, and can also be used to treat traumatic bleeding, ulcers, swelling and chapped skin. Therefore, it occupies an important position in traditional Chinese medicine (Xu et al. 2019). In June 2023, three farmers in Mengzi (103.39°N, 23.21°E), Yunnan Province, China, observed that some Bletilla striata Rchb.f. plants grew poorly with small and chlorotic leaves (Figure 1 A). We suspected that these symptoms were caused by root-knot nematode infection, but the galls on the roots were small and inconspicuous (Figure 1 A). The presence of nematode females in both the galled regions and the normal roots (Figure 1 B), revealed by fuchsin staining (Byrd et al. 1983), indicated that the symptoms were probably caused by root-knot nematode infection. To estimate the incidence rates, we randomly selected 100 B. striata Rchb.f. plants from each of five fields representing a total area of 3000 m2. In these fields, the occurrence of stained root-knot nematodes were 19.3%, 17%, 18.3%, 15%, and 13%, respectively. The gall rating of the infected plants in the B striata Rchb.f. samples collected from the five fields was 2 (rating scale of 0 to 5). Females (n=20), second-stage juveniles (J2s, n=20) and egg masses (n=20) were extracted and collected from roots and soil for morphological and molecular identification. The females had a white, pyriform body and their perineal patterns exhibited a high and square dorsal arch, lacking distinct lateral line (Figure 1. C & D). Measurements of females (n = 20) were: body length (BL) = 708.64±89.6 µm (554.36 to 844.51 µm); maximum body width (BW) = 461.73±47.44 µm (365.25 to 561.49 µm); stylet length (ST) = 15.49±3.15 µm (10.55 to 19.78 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO) = 3.33±0.27 µm (2.77 to 3.93 µm). Measurements of J2s (n=20) were BL = 417.7±47.67 µm (342.16 to 499.68 µm); BW = 15.74±2.66 µm (11.05 to 25.63 µm); ST = 12.49±1.12 µm (10.19 to 15.02 µm); DGO = 2.64±0.59 µm (40.17 to 68.74 µm); tail length = 51.93±8.55 µm (10.43 to 27.22 µm); hyaline tail terminus = 18.23±3.99 µm (1.48 to 3.98 µm). These morphological features match the description of Meloidogyne incognita (Eisenback et al. 1981). To further confirm the species, we selected three infected plants from each field for molecular identification, the ITS region amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3',5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) . A 729 bp PCR product of ITS region (accession nos. OR463907) was obtained from all infected plants. The amplicons from 18S/26S primer pair were sequenced and the sequences showed 95.29% homology with sequences of M. incognita (accession nos. MT209948.1). Moreover, a 835 bp DNA fragment (accession nos. OR469000) was obtained using the specific primers Mi-F/Mi-R (5'-GTGAGGATTCAGCTCCCCAG-3',5'-ACGAGGAACATACTTCTCCGTCC-3') for M. incognita (Meng et al. 2004), the sequence showed 99.28% homology with sequences of M. incognita (accession nos. ON416569). The morphological features and molecular data confirmed the identification of the root-knot nematode on B. striata Rchb.f. as M. incognita. To confirm the pathogenicity, ten healthy B. striata Rchb.f. seedlings were each inoculated with 500 freshly hatched J2s isolated from field Bletilla striata Rchb.f.. Five healthy seedlings without J2 inoculation were used as controls. At 60 days after inoculation, most of the inoculated plants exhibited similar symptoms to those initially observed by farmers in the field. On average, 1532 J2s were recovered from each inoculated plant, yielding a reproductive factor of 2.1. The gall rating for these inoculated plants was 2. Fuchsin staining revealed the presence of root-knot nematode females within the roots, with an average of 17 females detected per inoculated plant. No symptoms were observed in the control plants. This is the first report of M. incognita infecting B. striata Rchb.f. in China. M. incognita can cause severe infection and damage to some crops, resulting in serious economic losses (Eisenback, 2022). The growers need to take measures to prevent the spread of this nematode.

First report of the barley root-knot nematode, Meloidogyne naasi Franklin, 1965 from Pennsylvania, with new host report.

Meloidogyne naasi Franklin, 1965, the barley root-knot nematode, was originally found in field crops such as cereals, grasses, and sugar beet (Beta vulgaris L.) in England and Wales, (Franklin,1965). This nematode is one of the most significant root-knot nematodes impacting grains in European countries (Santos et al. 2020). Among root-knot nematode species, M. naasi, exhibits a distinct preference for grasses, with documented impacts on turfgrasses leading to reduced growth and vigor (Skantar et al., 2023; Cook and Yeates, 1993). In September 2022, root-knot nematode females and second-stage juveniles (J2) were recovered from roots of fowl manna grass, Glyceria striata (Lam.) Hitchc., during a nematode survey on natural vegetation at the Allegheny National Forest (41°30'13.8"N 79°09'46.2"W). Second-stage juvenile specimens were recovered from soil using sugar centrifugal flotation (Jenkins, 1964). Small galls with egg masses were dissected from fowl manna grass roots originally collected from the surveyed areas. In parallel, five plants of non-infected fowl manna grass were placed in a pot in the greenhouse using naturally nematode-infested soil collected from the same forested area. Small galls and female specimens recovered from these plants were dissected and processed for further analyses. Female and J2 were fixed in 3% formaldehyde solution and processed to glycerin (Golden, 1990; Hooper, 1970). The specimens were examined by light microscopy, morphometric measurements, and molecular markers, which included the D2-D3 region of the large ribosomal subunit 28S, and the rDNA internal transcribed spacer region (ITS). The perennial pattern of five females analyzed morphologically were consistent to the patterns observed for M. naasi. The perennial patterns had coarse ridges on the cuticle in dorsal region forming broken irregular lines around anal and phasmid area. We also noted a prominent fold that covered some of the anus and showed a curved line between vulval slit and phasmids, typical of M. naasi. The area around the vulval area had a few or no striae except for a few lines radiating from the vulval slit as in the original description. Measurements of ten J2 had a body length ranged between 380 and 410 µm, stylet 11-13 µm, tail 50-70 µm long with a hyaline tail terminus between 12-22 µm in length, 4 lines in the lateral field, a and c ratio between 29.23-35.91 and 5.79-7.9 fitting the original description by Franklin, 1965 and others populations found in the USA (Skantar et al., 2023). The matrix codes for the female specimes are A32, B324, C3, D3 and for J2's A2, B21, C123, D1, E3, F12 (Subbotin et al., 2021). The amplified DNA fragments were sequenced, resulting in an 726 bp fragment flanked by the D2-D3 primers (PP097762), while for the ITS primers an 634 bp fragment was obtained (PP092043). Both generated sequences for the specimens collected in Pennsylvania revealed >99% similarity to M. naasi sequences deposited at GenBank, and therefore, validating the morphological analyses. Based on both morphological and molecular analyses the specimens collected in the state of Pennsylvania were identified as M.naasi. To our knowledge, this is the first report of this species from this state and being associated with naturally infected fowl manna grass.

Host Suitability of Summer Cover Crops and Peach Rootstocks to the Peach Root-Knot Nematode, Meloidogyne floridensis.

Greenhouse experiments were conducted to determine the host suitability of ten summer cover crops and two peach rootstocks to Meloidogyne floridensis by inoculating them with 10,000 M. floridensis eggs. Brown top millet and sunn hemp were nonhosts as they did not support nematode reproduction. Buckwheat, cowpea, pearl millet, Japanese millet, and sunflower supported more than 25,000 eggs/pot, which indicated that these crops are good hosts to M. floridensis. The crops that supported poor nematode reproduction were sesame, grain sorghum, and sorghum-sudangrass, with their reproduction ranging from 219 to 7,750 eggs/pot. In addition to having many galls on the roots, the peach rootstock Guardian had 10,100 eggs on the roots and 450 second-stage juveniles in the pot, which indicated that 'Guardian' is a good host to M. floridensis. Although the nematode reproduction on MP-29 rootstock was relatively lower, the presence of many large galls on the roots indicates MP-29 is susceptible to M. floridensis. Results from the current study suggest that the employment of nonhost cover crops and poor-host rootstocks could aid in effective nematode management programs for peaches.

A Comparison Between Meloidogyne floridensis and M. incognita from California on Susceptible and Resistant Sweetpotato Cultivars.

The reproduction and ability to cause root-galling of a California isolate of the peach root-knot nematode Meloidogyne floridensis was evaluated on seven sweetpotato (Ipomea batatas) cultivars and compared with an M. incognita race 3 and an M. incognita Mi-gene resistance-breaking isolate. The susceptible tomato (Solanum lycopersicum) cultivar Daniela and the Mi-gene-carrying resistant cultivar Celebrity were included as controls. Repeated trials were done in pots in a nematode-quarantine greenhouse at the University of California, Riverside. The three Meloidogyne isolates reproduced equally well on susceptible tomato. On Mi-gene resistant tomato, the reproduction and root-galling by M. floridensis was intermediate between the avirulent M. incognita race 3 and the resistance-breaking M. incognita isolate. The sweetpotato cultivars 'Beauregard' and 'Diane' were excellent hosts for all three Meloidogyne isolates. Cultivars Bellevue, Burgundy, and Covington were resistant to these isolates. The cultivars Bonita and Murasaki-29 were hosts for the M. floridensis and the resistance-breaking M. incognita isolate, which allowed an increase in nematode levels, but they were poor hosts, resulting in a decrease in nematode levels for the M. incognita race 3 isolate. The study showed that M. floridensis can reproduce on tomato and some sweetpotato cultivars that are considered resistant to M. incognita.

Effect of Temperature on the Embryogenesis of Three Geographically Distinct Populations of Meloidogyne incognita Is Driven by Intrinsic Thermal Acclimation Reaction.

Research interest in the mechanisms enabling plant-parasitic nematodes to adjust their physiological performance and cope with changing temperatures has intensified in light of global warming. Here, we show that geographically distinct populations of the root-knot nematode Meloidogyne incognita, which is prevalent in the three main pepper-growing regions in Israel-Carmel Valley (Carmel), Jordan Valley (JV), and Arava Rift (Arava)-possess persistent differences in their thermal acclimation capacity, which affect pre- and postembryonic development. The optimal temperature for embryonic growth completion was 25°C for the Carmel population; 25 and 30°C for the JV population; and 30°C for the Arava population. Cumulative hatching percentages showed variations among populations; relative to hatching at 25°C, the Carmel population experienced hatching reduction at the higher studied temperatures 30 and 33°C, while the JV and Arava populations exhibited an increase in hatching at 30 and 33°C, respectively. Juvenile survival indicates that at the lowest temperature (20°C), the Carmel population gained the highest survival rates throughout the experimental duration, while at the same duration at 33°C, the Arava population gained the highest survival rate. Infective juveniles of the Carmel population demonstrated increased penetration of tomato roots at 25°C compared to the JV and Arava populations. Inversely, at 33°C, increased penetration was observed for the Arava compared to the Carmel and JV populations. Altogether, the Arava population's performance at 33°C might incur distinct fitness costs, resulting in consistent attenuation compared to the Carmel population at 25°C. Precisely defining a population's thermal acclimation response might provide essential information for models that predict the impact of future climate change on these populations.

Sensitivity of Meloidogyne incognita and Rotylenchulus reniformis to cyclobutrifluram.

Cyclobutrifluram, a succinate dehydrogenase inhibitor fungicide, is being evaluated as a seed-applied nematicide in cotton and soybean to manage plant-parasitic nematodes. Currently, there is no information on the toxicity, ovicidal activity, nematode recovery, or effects on nematode infection for Meloidogyne incognita or Rotylenchulus reniformis after exposure to low concentrations of cyclobutrifluram. Nematode toxicity assays were performed in aqueous solutions of cyclobutrifluram, while root infection assays were conducted on tomato. Nematode paralysis was observed after 2 h of exposure to 0.5 µg/ml cyclobutrifluram for both nematode species. Based on an assay of nematode motility, the 2-hr EC50 value for M. incognita and R. reniformis was 0.48 and 1.07 µg/ml, respectively. In a comparable assay with a similar nematicide, continuous exposure to 0.5 µg/ml cyclobutrifluram for 24 h resulted in at least 45% more immotile nematodes for both species compared to those treated with 0.5 µg/ml fluopyram. Continuous exposure to concentrations >1.0 µg/ml suppressed hatching for both species compared to the water control. Nematode recovery from paralysis was greater than 80% for M. incognita and R. reniformis 24 h after nematodes were rinsed and removed from a 1-h treatment to their respective 2-hr EC50 concentrations. Nematode infection of tomato roots was reduced following a 1-h treatment with aqueous solutions of cyclobutrifluram, ranging from 0.12 to 0.48 µg/ml for M. incognita and 0.27 to 1.07 µg/ml for R. reniformis. Overall, the toxicity of cyclobutrifluram to these nematode species was greater than that of fluopyram and although the effects of cyclobutrifluram were reversible, low concentrations were effective at reducing the ability of both nematodes to infect tomato roots.

Response of the Symbiotic Microbial Community of Dioscorea opposita Cultivar Tiegun to Root-Knot Nematode Infection.

Yam is an important medicinal and edible dual-purpose plant with high economic value. However, nematode damage severely affects its yield and quality. One of the major effects of nematode infestations is the secondary infection of pathogenic bacteria or fungi through entry wounds made by the nematodes. Understanding the response of the symbiotic microbial community of yam plants to nematodes is crucial for controlling such a disease. In this study, we investigated the rhizosphere and how endophytic microbiomes shift after nematode infection during the tuber expansion stage in the Dioscorea opposita Thunb. cultivar Tiegun. Our results revealed that soil depth affected the abundance of nematodes, and the relative number of Meloidogyne incognita was higher in the diseased soil at a depth of 16 to 40 cm than those at a depth of 0 to 15 and 41 to 70 cm. The abundance of and interactions among soil microbiota members were significantly correlated with root-knot nematode (RKN) parasitism at various soil depths. However, the comparison of the microbial α-diversity and composition between healthy and diseased rhizosphere soil showed no difference. Compared with healthy soils, the co-occurrence networks of M. incognita-infested soils included a higher ratio of positive correlations linked to plant health. In addition, we detected a higher abundance of certain taxonomic groups belonging to Chitinophagaceae and Xanthobacteraceae in the rhizosphere of RKN-infested plants. The nematodes, besides causing direct damage to plants, also possess the ability to act synergistically with other pathogens, especially Ramicandelaber and Fusarium, leading to the development of disease complexes. In contrast to soil samples, RKN parasitism specifically had a significant effect on the composition and assembly of the root endophytic microbiota. The RKN colonization impacted a wide variety of endophytic microbiomes, including Pseudomonas, Sphingomonas, Rhizobium, Neocosmospora, and Fusarium. This study revealed the relationship between RKN disease and changes in the rhizosphere and endophytic microbial community, which may provide novel insights that help improve biological management of yam RKNs.

First report of the damaging pest Meloidogyne enterolobii parasitizing mulberry (Morus alba L.) in Vietnam.

Mulberry (Morus alba L.) is highly important crop in Vietnam, playing a key role in the country's economy through sericulture, food supply, pharmaceuticals, and beverage industries (Nguyen et al., 2018; Rohela et al., 2020). Recently, many mulberry-growing areas in Lam Dong, Vietnam have reported severe symptoms associated with nematode infection, including yellowing leaves, stunted growth, and severe root galling, leading to a significant decline in mulberry productivity. From April to December 2022, twenty soil and root samples from mulberry-growing areas in Lam Dong (Da Teh: 11°28'48.11"N; 107°28'23.74"E elevation: 133m; Lam Ha 11°48'25.13"N; 108°14'7.13"E elevation: 848m) were collected to uncover the presence of Meloidogyne enterolobii parasitizing mulberry in Vietnam. One nematode population was randomly selected for characterizing in this study among analyzed nematode populations. Females were extracted from heavily galled roots (Fig. S1) from a single mulberry tree in Lam Dong, Vietnam, using a needle and forceps (Subbotin et al., 2021). The perineal patterns of adult females (n = 10) have an oval shape, with clearly visible phasmids, along with a prominently high and squared dorsal arch. The striae are smooth and coarse, while the perivulval region remains devoid of striae. The lateral lines appear indistinct, and the tail tip is easily observable. Morphometric measurements were as follows: body length = 585 ± 78 (464-724) µm, body width = 367 ± 75 (271-529) µm, neck length = 221.5 ± 30.7 (167-269.6) µm, stylet length = 13.1 ± 1.2 (11.4-15.1) µm, vulva-slit length 16.3±2.3 (10.4-18) µm, vulva-anus distance = 16.8±3.0 (11.4-18) µm, anus-tail tip distance = 10.3±2.1 (6.9-14.2) µm, interphasmidial distance = 15.9 ± 3.7 (10.3-23.4) µm. The morphology of this nematode population is highly in agreement with the original description of M. enterolobii (Yang & Eisenback, 1983). This population was also identified using the D2-D3 of 28S rRNA and 18S rRNA (Powers et al., 2017; Subbotin et al., 2006) regions. The D2-D3 of 28S rRNA sequences from this study (accession numbers: OR889633) exhibited 99.5-99.8% similarity to the sequences of M. enterolobii from GenBank (accession numbers: OR214950 and ON496981). While the 18S rRNA sequences (accession numbers: OR896547) showed 99.2-99.3% similarity to the sequences of M. enterolobii from GenBank (accession numbers: MZ955995, MZ531901, and MW488150). To carry out Koch's postulates, 2000 J2s from collected M. enterolobii egg masses (initial population) were inoculated on two-month-old plantlets of mulberry (n = 6), planted on 2L pots within a screenhouse, non-inoculated plantlets (n=6) served as negative controls. After 90 days post-inoculation, nematode reproduction factors (RF = final density (nematodes were extracted from the whole root system and corresponding soil samples (Subbotin et al., 2021)) / initial population) and root damage symptoms were evaluated. The inoculated plantlets exhibited consistent yellowing leaves, stunting, and root galling symptoms (Fig. S1), mirroring observations from the field, with an average RF of 11.5. Control plants displayed no symptoms. Root-knot nematodes extracted from the roots were identified as M. enterolobii through molecular analyses of D2-D3 of 28S and 18S rRNA regions (GenBank accession numbers: OR889634 (D2-D3 of 28S) and OR896548 (18S)), thereby confirming that mulberry acts as a host for M. enterolobii. Currently, this nematode has been reported to be associated with two different host plants, including guava (Trinh et al., 2022) and pomelo (Le et al., 2023). Our discovery marks the first documented case of Meloidogyne enterolobii parasitizing mulberry in Vietnam. While the impact on mulberry productivity remains to be really important for sericulture food supply, pharmaceuticals, and beverage industries; the aggressive nature of M. enterolobii, as observed in the field and confirmed by the screenhouse tests, raises concerns about potential economic losses in mulberry production. Therefore, further investigations are needed to assess the extent of M. enterolobii infestation in mulberry orchards and to develop effective control measures to safeguard the sustainability of mulberry cultivation in Vietnam.

Evaluation of Weed Species for Host Status to the Root-Knot Nematodes Meloidogyne enterolobii and M. incognita Race 4.

Weeds that compete with valuable crops can also host plant-parasitic nematodes, acting as a source of nematode inoculum in a field and further damaging crops. The host status of 10 weed species commonly found in North Carolina, USA, was determined for the root-knot nematodes Meloidogyne enterolobii and M. incognita race 4 in the greenhouse. Each weed species was challenged with 5,000 eggs/plant of either M. enterolobii or M. incognita race 4, with five replicate plants per treatment in two separate greenhouse trials. Root galling severity and total number of nematode eggs per root system were recorded 60 days after inoculation. Reproduction factor (Rf = final nematode population/initial nematode population) was calculated to determine the host status of each weed species to M. enterolobii and M. incognita race 4. Four weed species (Datura stramonium, Digitaria sanguinalis, Senna obtusifolia, and Cyperus esculentus) were poor hosts (Rf < 1) to both nematode species, and roots of these weed plants did not display galling. Four weed species (Ipomoea hederacea, Amaranthus palmeri, Portulaca pilosa, and Ipomoea lacunosa) were hosts (Rf > 1) to both nematode species, and all had observable root gall formation. Sida rhombifolia and Cyperus rotundus were poor hosts to M. enterolobii but susceptible hosts to M. incognita. This study documents a differential host status of some common weeds to M. enterolobii and M. incognita race 4, and these results highlight the necessity of managing root-knot nematodes through controlling weeds in order to protect valuable crops.

Host status of melon, carrot, and Meloidogyne incognita-susceptible and -resistant cotton, cowpea, pepper, and tomato for M. floridensis from California.

The host status of carrot, melon, and susceptible and resistant cultivars of tomato, cotton, cowpea, and pepper for a California isolate of the peach root-knot nematode Meloidogyne floridensis was determined in greenhouse pot experiments. It was compared to a race 3 isolate of M. incognita. Melon was an excellent host for both isolates and roots were heavily galled after the 8-week trial. Carrot was a host for M. incognita, but a poor host for M. floridensis, although both isolates caused similar levels of galling. Susceptible cotton was a good host for M. incognita race 3, but a poor host for M. floridensis. Susceptible tomato, cowpea, and pepper were good hosts for both isolates. The M. incognita resistance in tomato and pepper was broken by M. floridensis. Resistant cowpea was a maintenance host as population levels of M. floridensis remained virtually unchanged over the trial period. We conclude that M. floridensis poses a risk to some important vegetable crops in California, as it reproduces on most vegetable crops, including some cultivars that are resistant to M. incognita. On susceptible crops, the reproduction of M. floridensis was always significantly less than that of M. incognita, and we hypothesize that in mixed species field populations, M. incognita will outcompete M. floridensis. This study demonstrates that efforts to limit the spread and prevent further introductions of M. floridensis in California are important to maintain the effectiveness of plant resistance as a nematode management strategy in vegetable crops.

First report of Meloidogyne hapla on hemp (Cannabis sativa) in Oregon.

Hemp is a crop that has gained interest in Washington and Oregon. As with other crops, hemp production faces challenges due to biotic factors, including plant-parasitic nematodes. During a survey for plant-parasitic nematodes associated with hemp, Meloidogyne sp. was found in a composite root sample collected in Oregon. Morphological characterization of second-stage juveniles identified the nematode as Meloidogyne hapla. Molecular identification confirmed the population as M. hapla. To our knowledge, this is the first report of M. hapla on hemp in the Pacific Northwest of the United States.

Depth distribution of plant-parasitic nematodes on bentgrass golf greens in Missouri and Indiana.

Control of plant-parasitic nematodes (PPNs) on golf putting greens with nematicides is dependent on the seasonal occurrence and depth distribution of target PPN populations. This study aimed to determine if plant-parasitic nematode populations on golf course putting greens in Missouri and Indiana peaked at a targetable depth at a specific time in the year, focusing primarily on lance (Hoplolaimus spp.) and root-knot (Meloidogyne spp.) nematodes. To elucidate species diversity in the region, rDNA from a subset of lance and root-knot nematodes was sequenced and analyzed, with additional micromorphology of a lance nematode assessed in scanning electron micrographs (SEM). Soil samples were taken to a depth of 25 cm and stratified into 5 cm increments during April, June, August and October at seven sites across Missouri, three in the Kansas City metro of Kansas in 2021 and in ten sites across Indiana in 2022. Samples were stratified in five-centimeter increments and aggregated for a total of 100 cm3 of soil at each depth for each sampling. Samples were processed using a semi-automatic elutriator followed by the sucrose-flotation method, and populations were counted using a hemocytometer and recorded. For molecular characterization, rDNA was extracted and analyzed from 31 individual lance nematodes from one site in Missouri and eight sites in Indiana, and 13 root-knot nematodes from nine sites across Indiana. A significant interaction occurred between sampling month and depth for lance and ring nematodes Missouri/KS, with both PPN populations peaking at the 0-5 cm depth during October, which is well after most targeted nematicide applications are applied. Ring nematodes in Indiana did not follow this trend and were most abundant in August at a depth of 0-5 cm. No significant interaction between depth and month occurred for lance or root-knot nematodes in Indiana, or root-knot nematodes in Missouri/KS. Hoplolaimus stephanus and H. magnistylus were the lance species identified on golf greens, and Meloidogyne naasi, M. graminicola and M. marylandi were the root-knot species identified. Scanning-electron micrographs confirmed morphological characteristics unique to H. stephanus.

In silico secretome analyses of the polyphagous root-knot nematode Meloidogyne javanica: a resource for studying M. javanica secreted proteins.

BACKGROUND: Plant-parasitic nematodes (PPNs) that cause most damage include root-knot nematodes (RKNs) which are a major impediment to crop production. Root-knot nematodes, like other parasites, secrete proteins which are required for parasite proliferation and survival within the host during the infection process. RESULTS: Here, we used various computational tools to predict and identify classically and non-classically secreted proteins encoded in the Meloidogyne javanica genome. Furthermore, functional annotation analysis was performed using various integrated bioinformatic tools to determine the biological significance of the predicted secretome. In total, 7,458 proteins were identified as secreted ones. A large percentage of this secretome is comprised of small proteins of ≤ 300 aa sequence length. Functional analyses showed that M. javanica secretome comprises cell wall degrading enzymes for facilitating nematode invasion, and migration by disintegrating the complex plant cell wall components. In addition, peptidases and peptidase inhibitors are an important category of M. javanica secretome involved in compatible host-nematode interactions. CONCLUSION: This study identifies the putative secretome encoded in the M. javanica genome. Future experimental validation analyses can greatly benefit from this global analysis of M. javanica secretome. Equally, our analyses will advance knowledge of the interaction between plants and nematodes.

The status of the CRISPR/Cas9 research in plant-nematode interactions.

MAIN CONCLUSION: As an important biotic stressor, plant-parasitic nematodes afflict global crop productivity. Deployment of CRISPR/Cas9 system that selectively knock out host susceptibility genes conferred improved nematode tolerance in crop plants. As an important biotic stressor, plant-parasitic nematodes cause a considerable yield decline in crop plants that eventually contributes to a negative impact on global food security. Being obligate plant parasites, the root-knot and cyst nematodes maintain an intricate and sophisticated relationship with their host plants by hijacking the host's physiological and metabolic pathways for their own benefit. Significant progress has been made toward developing RNAi-based transgenic crops that confer nematode resistance. However, the strategy of host-induced gene silencing that targets nematode effectors is likely to fail because the induced silencing of effectors (which interact with plant R genes) may lead to the development of nematode phenotypes that break resistance. Lately, the CRISPR/Cas9-based genome editing system has been deployed to achieve host resistance against bacteria, fungi, and viruses. In these studies, host susceptibility (S) genes were knocked out to achieve resistance via loss of susceptibility. As the S genes are recessively inherited in plants, induced mutations of the S genes are likely to be long-lasting and confer broad-spectrum resistance. A number of S genes contributing to plant susceptibility to nematodes have been identified in Arabidopsis thaliana, rice, tomato, cucumber, and soybean. A few of these S genes were targeted for CRISPR/Cas9-based knockout experiments to improve nematode tolerance in crop plants. Nevertheless, the CRISPR/Cas9 system was mostly utilized to interrogate the molecular basis of plant-nematode interactions rather than direct research toward achieving tolerance in crop plants. The current standalone article summarizes the progress made so far on CRISPR/Cas9 research in plant-nematode interactions.