Defining bone fide effectors of RAS GTPases.

RAS GTPases play essential roles in normal development and are direct drivers of human cancers. Three decades of study have failed to wholly characterize pathways stimulated by activated RAS, driven by engagement with 'effector' proteins that have RAS binding domains (RBDs). Bone fide effectors must bind directly to RAS GTPases in a nucleotide-dependent manner, and this interaction must impart a clear change in effector activity. Despite this, for most proteins currently deemed effectors there is little mechanistic understanding of how binding to the GTPase alters protein function. There has also been limited effort to comprehensively resolve the specificity of effector binding to the full array of RAS superfamily GTPase proteins. This review will summarize what is known about RAS-driven activation for an array of potential effector proteins, focusing on structural and mechanistic effects and highlighting how little is still known regarding this key paradigm of cellular signal transduction.

Electrostatic plasma membrane targeting contributes to Dlg function in cell polarity and tumorigenesis.

Discs large (Dlg) is an essential polarity protein and a tumor suppressor originally characterized in Drosophila but also well conserved in vertebrates. Like the majority of polarity proteins, plasma membrane (PM)/cortical localization of Dlg is required for its function in polarity and tumorigenesis, but the exact mechanisms targeting Dlg to the PM remain to be fully elucidated. Here, we show that, similar to recently discovered polybasic polarity proteins such as Lgl and aPKC, Dlg also contains a positively charged polybasic domain that electrostatically binds the PM phosphoinositides PI4P and PI(4,5)P2 Electrostatic targeting by the polybasic domain contributes significantly to the PM localization of Dlg in follicular and early embryonic epithelial cells, and is crucial for Dlg to regulate both polarity and tumorigenesis. The electrostatic PM targeting of Dlg is controlled by a potential phosphorylation-dependent allosteric regulation of its polybasic domain, and is specifically enhanced by the interactions between Dlg and another basolateral polarity protein and tumor suppressor, Scrib. Our studies highlight an increasingly significant role of electrostatic PM targeting of polarity proteins in regulating cell polarity.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Designing of disruptor molecules to restrain the protein-protein interaction network of VANG1/SCRIB/NOS1AP using fragment-based drug discovery techniques.

Governing protein-protein interaction networks are the cynosure of cell signaling and oncogenic networks. Multifarious processes when aligned with one another can result in a dysregulated output which can result in cancer progression. In the current research, one such network of proteins comprising VANG1/SCRIB/NOS1AP, which is responsible for cell migration, is targeted. The proteins are modeled using in-silico approaches, and the interaction is visualized utilizing protein-protein docking. Designing drugs for the convoluted protein network can serve as a challenging task that can be overcome by fragment-based drug designing, a recent game-changer in the computational drug discovery strategy for protein interaction networks. The model is exposed to the extraction of hotspots, also known as the restrained regions for small molecular hits. The hotspot regions are subjected to a library of generated fragments, which are then recombined and rejoined to develop small molecular disruptors of the macromolecular assemblage. Rapid screening methods using pharmacokinetic tools and 2D interaction studies resulted in four molecules that could serve the purpose of a disruptor. The final validation is executed by long-range simulations of 100 ns and exploring the stability of the complex using several parameters leading to the emergence of two novel molecules VNS003 and VNS005 that could be used as the disruptors of the protein assembly VANG1/SCRIB/NOS1AP. Also, the molecules were explored as single protein targets approbated via molecular docking and 100 ns molecular dynamics simulation. This concluded VNS003 as the most suitable inhibitor module capable of acting as a disruptor of a macromolecular assembly as well as acting on individual protein chains, thus leading to the primary hindrance in the formation of the protein interaction complex.

Distinct activities of Scrib module proteins organize epithelial polarity.

A polarized architecture is central to both epithelial structure and function. In many cells, polarity involves mutual antagonism between the Par complex and the Scribble (Scrib) module. While molecular mechanisms underlying Par-mediated apical determination are well-understood, how Scrib module proteins specify the basolateral domain remains unknown. Here, we demonstrate dependent and independent activities of Scrib, Discs-large (Dlg), and Lethal giant larvae (Lgl) using the Drosophila follicle epithelium. Our data support a linear hierarchy for localization, but rule out previously proposed protein-protein interactions as essential for polarization. Cortical recruitment of Scrib does not require palmitoylation or polar phospholipid binding but instead an independent cortically stabilizing activity of Dlg. Scrib and Dlg do not directly antagonize atypical protein kinase C (aPKC), but may instead restrict aPKC localization by enabling the aPKC-inhibiting activity of Lgl. Importantly, while Scrib, Dlg, and Lgl are each required, all three together are not sufficient to antagonize the Par complex. Our data demonstrate previously unappreciated diversity of function within the Scrib module and begin to define the elusive molecular functions of Scrib and Dlg.

The PDZ protein SCRIB regulates sodium/iodide symporter (NIS) expression at the basolateral plasma membrane.

The sodium/iodide symporter (NIS) expresses at the basolateral plasma membrane of the thyroid follicular cell and mediates iodide accumulation required for normal thyroid hormonogenesis. Loss-of-function NIS variants cause congenital hypothyroidism due to impaired iodide accumulation in thyroid follicular cells underscoring the significance of NIS for thyroid physiology. Here we report novel findings derived from the thorough characterization of the nonsense NIS mutant p.R636* NIS-leading to a truncated protein missing the last eight amino acids-identified in twins with congenital hypothyroidism. R636* NIS is severely mislocalized into intracellular vesicular compartments due to the lack of a conserved carboxy-terminal type 1 PDZ-binding motif. As a result, R636* NIS is barely targeted to the plasma membrane and therefore iodide transport is reduced. Deletion of the PDZ-binding motif causes NIS accumulation into late endosomes and lysosomes. Using PDZ domain arrays, we revealed that the PDZ-domain containing protein SCRIB binds to the carboxy-terminus of NIS by a PDZ-PDZ interaction. Furthermore, in CRISPR/Cas9-based SCRIB deficient cells, NIS expression at the basolateral plasma membrane is compromised, leading to NIS localization into intracellular vesicular compartments. We conclude that the PDZ-binding motif is a plasma membrane retention signal that participates in the polarized expression of NIS by selectively interacting with the PDZ-domain containing protein SCRIB, thus retaining the transporter at the basolateral plasma membrane. Our data provide insights into the molecular mechanisms that regulate NIS expression at the plasma membrane, a topic of great interest in the thyroid cancer field considering the relevance of NIS-mediated radioactive iodide therapy for differentiated thyroid carcinoma.

An antisense circular RNA circSCRIB enhances cancer progression by suppressing parental gene splicing and translation.

Circular RNAs (circRNAs) represent a large group of non-coding RNAs that are widely detected in mammalian cells. Although most circRNAs are generated in a sense orientation, there is a group of circRNAs that are synthesized in an antisense orientation. High-throughput analysis of breast cancer specimens revealed a significant enrichment of 209 antisense circRNAs. The tumor suppressor SCRIB was shown to potentially produce thirteen circRNAs, three of which are in an antisense orientation. Among these three circRNAs, circSCRIB (hsa_circ_0001831) was the most enriched in the breast cancer panel. This antisense SCRIB circRNA was shown to span one intron and two exons. We hypothesized that this circRNA could decrease pre-mRNA splicing and mRNA translation. To test this, we generated a hsa_circ_0001831 expression construct. We found that there was decreased SCRIB mRNA production but increased cancer cell proliferation, migration, and invasion. In comparison, an exonic sequence construct did not affect mRNA splicing but decreased protein translation, leading to increased E-cadherin expression and decreased expression of N-cadherin and vimentin. Thus, there was increased cell migration, invasion, proliferation, colony formation, and tumorigenesis. Our study suggests a novel modulatory role of antisense circRNAs on their parental transcripts. This may represent a promising approach for developing circRNA-directed therapy.

Endocytosis at the Crossroad of Polarity and Signaling Regulation: Learning from Drosophila melanogaster and Beyond.

Cellular trafficking through the endosomal-lysosomal system is essential for the transport of cargo proteins, receptors and lipids from the plasma membrane inside the cells and across membranous organelles. By acting as sorting stations, vesicle compartments direct the fate of their content for degradation, recycling to the membrane or transport to the trans-Golgi network. To effectively communicate with their neighbors, cells need to regulate their compartmentation and guide their signaling machineries to cortical membranes underlying these contact sites. Endosomal trafficking is indispensable for the polarized distribution of fate determinants, adaptors and junctional proteins. Conversely, endocytic machineries cooperate with polarity and scaffolding components to internalize receptors and target them to discrete membrane domains. Depending on the cell and tissue context, receptor endocytosis can terminate signaling responses but can also activate them within endosomes that act as signaling platforms. Therefore, cell homeostasis and responses to environmental cues rely on the dynamic cooperation of endosomal-lysosomal machineries with polarity and signaling cues. This review aims to address advances and emerging concepts on the cooperative regulation of endocytosis, polarity and signaling, primarily in Drosophila melanogaster and discuss some of the open questions across the different cell and tissue types that have not yet been fully explored.

Scribble downregulation in adenomyosis compromises endometrial stromal decidualization by decreasing FOXO1 expression.

STUDY QUESTION: Does Scribble (SCRIB) contribute to aberrant decidualization of endometrial stromal cells (ESC) in adenomyosis? SUMMARY ANSWER: SCRIB knockdown impairs decidualization of ESC by decreasing Fork-head box O1A (FOXO1) expression through the protein kinase B (AKT) and atypical protein kinase C (aPKC) activated pathways. WHAT IS KNOWN ALREADY: Stromal SCRIB is required for primary decidual zone formation and pregnancy success in mice. In our previous studies, decidualization was dampened in ESC isolated from adenomyosis patients, yet the underlying molecular mechanisms remain elusive. STUDY DESIGN, SIZE, DURATION: Eutopic endometrium tissue samples from diffuse adenomyosis and non-adenomyosis patients in proliferative, early-secretory and mid-secretory phase (n = 10 per phase for each group) were explored. In parallel, in vitro decidualization studies were carried out in ESC isolated from non-adenomyosis women (n = 8). PARTICIPANTS/MATERIALS, SETTING, METHODS: The endometrial SCRIB expression was analyzed using immunohistochemistry staining and western blot. Quantitative RT-PCR (qRT-PCR), western blot and immunofluorescence staining were used to explore the expression of SCRIB in ESC during in vitro decidualization. siRNA-mediated SCRIB knockdown followed by decidual markers expression analysis, flow cytometry for cell cycle analysis and phalloidin staining for morphological analysis were performed to examine the function of SCRIB in ESC decidualization. RNA-sequencing was performed to examine the SCRIB-mediated transcriptional changes in decidualized ESC (DSC). Rescue experiments using an AKT inhibitor MK2206 and aPKC inhibitor NSC37044 were used to investigate the signaling pathways through which could mediate SCRIB-regulated FOXO1 protein expression and ESC decidualization. MAIN RESULTS AND THE ROLE OF CHANCE: We found that the expression of SCRIB in the mid-secretory phase eutopic endometrial stroma of adenomyosis patients was significantly lower than that of non-adenomyosis. SCRIB knockdown reduced the expression of decidual markers, abrogated the epithelioid-like morphological changes, inhibited the mesenchymal-to-epithelial transitions process and promoted the cell cycle progression of ESC during in vitro decidualization. SCRIB knockdown-induced decidualization defects were attributed to a decrease in expression of transcription factor FOXO1, known to regulate decidualization. Furthermore, we found that SCRIB knockdown induced the aberrant activation of AKT and aPKC, which led to FOXO1 phosphorylation and degradation. Rescue assay confirmed that restoring the expression of FOXO1 effectively reversed the decidualization defects and cell cycle progression caused by SCRIB knockdown. LARGE SCALE DATA: N/A. LIMITATIONS, REASONS FOR CAUTION: In this study, it was demonstrated that SCRIB knockdown mediated the activation of AKT and aPKC, contributing to FOXO1 degradation and aberrant decidualization, however, the molecular link between AKT and aPKC signaling was not determined, and still requires further exploration. WIDER IMPLICATIONS OF THE FINDINGS: Our findings support the hypothesis that adenomyosis interferes with embryo implantation due to insufficient endometrial receptivity. Abnormal decidualization of the endometrial stroma may clarify the possible association between adenomyosis and infertility. Our findings may be clinically useful for counseling and treatment of infertile adenomyosis patients. STUDY FUNDING/COMPETING INTEREST(S): This study was supported by the National Natural Science Foundation of China (82001523 and 82171639). The authors have no conflicts of interest to disclose. TRIAL REGISTRATION NUMBER: N/A.

Genetic variants in Hippo signalling pathway-related genes affect the risk of colorectal cancer.

The Hippo signalling pathway plays a crucial role in carcinogenesis. Therefore, we hypothesized that genetic variants in genes related to this pathway are associated with the colorectal cancer risk. A case-control study including 1150 patients and 1342 controls was performed to assess the association of genetic variants of genes involved in the Hippo signalling pathway with the risk of colorectal cancer. The results were corrected for multiple comparisons using the false discovery rate (FDR). We used a regression model to determine the effects of single-nucleotide polymorphisms (SNPs) on the survival of patients with colorectal cancer in The Cancer Genome Atlas (TCGA) datasets. An expression quantitative trait loci (eQTL) analysis was performed using TCGA datasets and the Genotype-Tissue Expression (GTEx) project. Gene Expression Omnibus (GEO) datasets were used to provide additional data on the expression of genes in colorectal cancer. The SCRIB rs13251492 G allele was associated with a significantly decreased risk of colorectal cancer (odds ratio (OR) = 0.79, 95% confidence interval (CI) = 0.70-0.89, P = 7.76 × 10-5, P(FDR) = 6.98 × 10-4). Patients with the rs13251492 AG/GG allele experienced a longer recurrence-free survival (RFS) time (hazard ratio (HR) = 0.64, 95% CI = 0.42-0.99, P = 0.049) than patients with the rs13251492 A allele. The eQTL analysis revealed a significant association between rs13251492 and the expression of the SCRIB mRNA in colorectal tumors. Dual-luciferase reporter assays in DLD-1 and HCT116 cells revealed a lower enhancer activity of the rs13251492 G allele than the A allele. In addition, the SCRIB mRNA was expressed at markedly higher levels in colorectal cancer tissues than in normal tissues. Therefore, we identified the SCRIB rs13251492 variant as a novel colorectal cancer susceptibility locus and provided evidence of its functional relevance.