The MAPK-Alfin-like 7 module negatively regulates ROS scavenging genes to promote NLR-mediated immunity.

Nucleotide-binding leucine-rich repeat (NLR) receptor-mediated immunity includes rapid production of reactive oxygen species (ROS) and transcriptional reprogramming, which is controlled by transcription factors (TFs). Although some TFs have been reported to participate in NLR-mediated immune response, most TFs are transcriptional activators, and whether and how transcriptional repressors regulate NLR-mediated plant defenses remains largely unknown. Here, we show that the Alfin-like 7 (AL7) interacts with N NLR and functions as a transcriptional repressor. Knockdown and knockout of AL7 compromise N NLR-mediated resistance against tobacco mosaic virus, whereas AL7 overexpression enhances defense, indicating a positive regulatory role for AL7 in immunity. AL7 binds to the promoters of ROS scavenging genes to inhibit their transcription during immune responses. Mitogen-activated protein kinases (MAPKs), salicylic acid-induced protein kinase (SIPK), and wound-induced protein kinase (WIPK) directly interact with and phosphorylate AL7, which impairs the AL7-N interaction and enhances its DNA binding activity, which promotes ROS accumulation and enables immune activation. In addition to N, AL7 is also required for the function of other Toll interleukin 1 receptor/nucleotide-binding/leucine-rich repeats (TNLs) including Roq1 and RRS1-R/RPS4. Our findings reveal a hitherto unknown MAPK-AL7 module that negatively regulates ROS scavenging genes to promote NLR-mediated immunity.

A robust high-throughput functional screening assay for plant pathogen effectors using the TMV-GFP vector.

Uncovering the function of phytopathogen effectors is crucial for understanding mechanisms of pathogen pathogenicity and for improving our ability to protect plants from diseases. An increasing number of effectors have been predicted in various plant pathogens. Functional characterization of these effectors has become a major focus in the study of plant-pathogen interactions. In this study, we designed a novel screening system that combines the TMV (tobacco mosaic virus)-GFP vector and Agrobacterium-mediated transient expression in the model plant Nicotiana benthamiana. This system enables the rapid identification of effectors that interfere with plant immunity. The biological function of these effectors can be easily evaluated by observing the GFP fluorescence signal using a UV lamp within just a few days. To evaluate the TMV-GFP system, we initially tested it with well-described virulence and avirulence type III effectors from the bacterial pathogen Ralstonia solanacearum. After proving the accuracy and efficiency of the TMV-GFP system, we successfully screened a novel virulence effector, RipS1, using this approach. Furthermore, using the TMV-GFP system, we reproduced consistent results with previously known cytoplasmic effectors from a diverse array of pathogens. Additionally, we demonstrated the effectiveness of the TMV-GFP system in identifying apoplastic effectors. The easy operation, time-saving nature, broad effectiveness, and low technical requirements of the TMV-GFP system make it a promising approach for high-throughput screening of effectors with immune interference activity from various pathogens.

In Vivo Delivery of Spherical and Cylindrical In Vitro Reconstituted Virus-like Particles Containing the Same Self-Amplifying mRNA.

The dramatic effectiveness of recent mRNA (mRNA)-based COVID vaccines delivered in lipid nanoparticles has highlighted the promise of mRNA therapeutics in general. In this report, we extend our earlier work on self-amplifying mRNAs delivered in spherical in vitro reconstituted virus-like particles (VLPs), and on drug delivery using cylindrical virus particles. In particular, we carry out separate in vitro assemblies of a self-amplifying mRNA gene in two different virus-like particles: one spherical, formed with the capsid protein of cowpea chlorotic mottle virus (CCMV), and the other cylindrical, formed from the capsid protein of tobacco mosaic virus (TMV). The mRNA gene is rendered self-amplifying by genetically fusing it to the RNA-dependent RNA polymerase (RdRp) of Nodamura virus, and the relative efficacies of cell uptake and downstream protein expression resulting from their CCMV- and TMV-packaged forms are compared directly. This comparison is carried out by their transfections into cells in culture: expressions of two self-amplifying genes, enhanced yellow fluorescent protein (EYFP) and Renilla luciferase (Luc), packaged alternately in CCMV and TMV VLPs, are quantified by fluorescence and chemiluminescence levels, respectively, and relative numbers of the delivered mRNAs are measured by quantitative real-time PCR. The cellular uptake of both forms of these VLPs is further confirmed by confocal microscopy of transfected cells. Finally, VLP-mediated delivery of the self-amplifying-mRNA in mice following footpad injection is shown by in vivo fluorescence imaging to result in robust expression of EYFP in the draining lymph nodes, suggesting the potential of these plant virus-like particles as a promising mRNA gene and vaccine delivery modality. These results establish that both CCMV and TMV VLPs can deliver their in vitro packaged mRNA genes to immune cells and that their self-amplifying forms significantly enhance in situ expression. Choice of one VLP (CCMV or TMV) over the other will depend on which geometry of nucleocapsid is self-assembled more efficiently for a given length and sequence of RNA, and suggests that these plant VLP gene delivery systems will prove useful in a wide variety of medical applications, both preventive and therapeutic.

Design, synthesis, and biological activities of arecoline derivatives containing 1,3,4-oxadiazole structure.

Pesticides play an important role in the development of agriculture, as they can prevent and control crop diseases and pests, improve crop yield and quality. However, the abuse and improper use of pesticides can lead to negative impacts such as environmental pollution and pest resistance issues. There is an urgent need to develop green, safe, and efficient pesticides. In this work, natural product arecoline was selected as parent structure, a series of arecoline derivatives were designed, synthesized, and systematically investigated antiviral activities against tobacco mosaic virus (TMV). These compounds were found to have good to excellent anti-TMV activities for the first time. The antiviral activities of 4a, 4 h, 4 l, 4p, 6a, 6c, and 6f are higher than that of ningnanmycin. Compounds 4 h (EC50 value 146 µg/mL) and 4p (EC50 value 161 µg/mL) with simple structures and excellent activities emerged as new antiviral candidates. We chose 4 h to further investigate the antiviral mechanism, which revealed that it can cause virus fragmentation by acting on the viral coat protein (CP). We further validated this result through molecular docking. These compounds also displayed broad-spectrum fungicidal activities against 8 plant pathogenic fungi. This work lays the theoretical foundation for the application of arecoline derivatives in the agricultural field.

Novel flavonol derivatives containing benzoxazole as potential antiviral agents: design, synthesis, and biological evaluation.

A series of flavonol derivatives containing benzoxazole were designed and synthesized, and the structures of all the target compounds were determined by nuclear magnetic resonance (NMR) and high-resolution mass spectrometry (HRMS). The structure of X2 was further confirmed by single crystal X-ray diffraction analysis. The results of the bioactivity tests showed that some of the target compounds possessed excellent antiviral activity against tobacco mosaic virus (TMV) in vivo. In particular, the median effective concentration (EC50) values for the curative and protective activities of X17 against TMV were 127.6 and 101.2 µg/mL, respectively, which were superior to those of ningnanmycin (320.0 and 234.6 µg/mL). The results of preliminary mechanism study indicated that X17 had a strong binding affinity for TMV coat protein (TMV-CP), which might hinder the self-assembly and replication of TMV particles. In addition, X17 was able to effectively inhibit tobacco leaf membrane lipid peroxidation and facilitate the removal of O2- from the body, thereby improving the disease resistance of tobacco plants. Therefore, the design and synthesis of flavonol derivatives containing benzoxazole provides value for the development of new antiviral drugs.

Separation of anti-TMV active components and modes of action of Omphalia lapidescens.

BACKGROUND: Omphalia lapidescens is a saprophytic and parasitic fungus belonging to the Polypora genus of Tricholomataceae. It has repellent, insecticidal, anti-inflammatory and immunomodulatory effects. RESULT: This study found that the extract of O. lapidescens had significant anti-TMV activity, and the main active component was homopolysaccharide LW-1 by Bioassay-guided fractionation. LW-1 is a glucan with ß-(1,3) glucoside bond as the main chain and ß-(1,6) glucoside bond as the branch chain, with molecular weight in the range of 172,916-338,827 Da. The protective and inactive efficacies of LW-1(100 mg/L) against TMV were 78.10% and 48.20%, but had no direct effect on the morphology of TMV particles. The results of mechanism of action showed that LW-1 induced the increase of the activity of defense enzymes such as POD, SOD and PAL in Nicotiana glutinosa. The overexpression of resistance genes such as NPR1, PR1 and PR5, and the increase of SA content. Further transcriptome sequencing showed that LW-1 activated MAPK signaling pathway, plant-pathogen interaction pathway and glucosinolide metabolic pathway in Arabidopsis thaliana. Besides, LW-1 induced crops resistance against plant pathogenic fungi. CONCLUSION: Taken together, the anti-TMV mechanism of LW-1 was to activate MAPK signaling pathway, inducing overexpression of resistance genes, activating plant immune system, and improving the synthesis and accumulation of plant defencins such as glucosinolide. LW-1-induced plant disease resistance has the advantages of broad spectrum and long duration, which has the potential to be developed as a new antiviral agent or plant immune resistance inducer.

Flavonol Derivatives Containing a Quinazolinone Moiety: Design, Synthesis, and Antiviral Activity.

A series of flavonol derivatives containing quinazolinone were designed and synthesized, and their antiviral activities against tobacco mosaic virus (TMV) were evaluated. The results of the half maximal effective concentration (EC50 ) test against TMV showed that the EC50 value of curative activity of K5 was 139.6 µg/mL, which was better than that of the commercial drug ningnanmycin (NNM) 296.0 µg/mL, and the EC50 value of protective activity of K5 was 120.6 µg/mL, which was superior to that of NNM 207.0 µg/mL. The interaction of K5 with TMV coat protein (TMV-CP) was investigated using microscale thermophoresis (MST) and molecular docking and the results showed that K5 can combine with TMV-CP more strongly to TMV-CP than that NNM can. Furthermore, the assay measuring malondialdehyde (MDA) content indicated that K5 had the ability to improve the disease resistance of tobacco. Hence, this study offers strong evidence that flavonol derivatives have potential as novel antiviral agents.

Transient Expression Vector Construction, Subcellular Localisation, and Evaluation of Antiviral Potential of Flagellin BP8-2.

This study used the DNA of Bacillus amyloliquefaciens Ba168 as a template to amplify the flagellin BP8-2 gene and ligate it into the fusion expression vector pCAMBIA1300-35S-EGFP after digestion for the construction of the expression vector pCAMBIA1300-EGFP-BP8-2. Next, using Nicotiana benthamiana as receptor material, transient expression was carried out under the mediation of Agrobacterium tumefaciens C58C1. Finally, the transient expression and subcellular localisation of flagellin BP8-2 protein were analysed using the imaging of co-transformed GFP under laser confocal microscopy. The results showed that flagellin BP8-2 was localised in the cell membrane and nucleus, and the RT-PCR results showed that the BP8-2 gene could be stably expressed in tobacco leaf cells. Furthermore, there was stronger antiviral activity against tobacco mosaic virus (TMV) infection in Nicotiana glutinosa than in BP8-2 and ningnanmycin, with an inhibitory effect of 75.91%, protective effect of 77.45%, and curative effect of 68.15%. TMV movement and coat protein expression were suppressed, and there was a high expression of PR-1a, PAL, and NPR1 in BP8-2-treated tobacco leaf. These results suggest that flagellin BP8-2 inhibits TMV by inducing resistance. Moreover, BP8-2 has low toxicity and is easily biodegradable and eco-friendly. These results further enrich our understanding of the antiviral mechanisms of proteins and provide alternatives for controlling viral diseases in agriculture.

The Impact of Tobamovirus Infection on Root Development Involves Induction of Auxin Response Factor 10a in Tomato.

Plant viruses cause systemic diseases that severely impair plant growth and development. While the accumulation of viruses in the root system has long been established, little is known as to how viruses affect root architecture. Here, we examined how the emerging tobamovirus, tomato brown rugose fruit virus (ToBRFV), alters root development in tomato. We found that ToBRFV and tobacco mosaic virus both invaded root systems during the first week of infection. ToBRFV infection of tomato plants resulted in a significant decrease in root biomass and elongation and root-to-shoot ratio and a marked suppression of root branching. Mutation in RNA-dependent RNA polymerase 6 increased the susceptibility of tomato plants to ToBRFV, resulting in severe reduction of various root growth parameters including root branching. Viral root symptoms were associated with the accumulation of auxin response factor 10a (SlARF10a) transcript, a homolog of Arabidopsis ARF10, a known suppressor of lateral root development. Interestingly, loss-of-function mutation in SlARF10a moderated the effect of ToBRFV on root branching. In contrast, downregulation of sly-miR160a, which targets SlARF10a, was associated with constitutive suppression root branching independent of viral infection. In addition, overexpression of a microRNA-insensitive mutant of SlARF10a mimicked the effect of ToBRFV on root development, suggesting a specific role for SlARF10a in ToBRFV-mediated suppression of root branching. Taken together, our results provide new insights into the impact of tobamoviruses on root development and the role of ARF10a in the suppression of root branching in tomato.

Identification and characterization of TMV-induced volatile signals in Nicotiana benthamiana: evidence for JA/ET defense pathway priming in congeneric neighbors via airborne (E)-2-octenal.

Plants release a mixture of volatile compounds when subjects to environmental stress, allowing them to transmit information to neighboring plants. Here, we find that Nicotiana benthamiana plants infected with tobacco mosaic virus (TMV) induces defense responses in neighboring congeners. Analytical screening of volatiles from N. benthamiana at 7 days post inoculation (dpi) using an optimized SPME-GC-MS method showed that TMV triggers the release of several volatiles, such as (E)-2-octenal, 6-methyl-5-hepten-2-one, and geranylacetone. Exposure to (E)-2-octenal enhances the resistance of N. benthamiana plants to TMV and triggers the immune system with upregulation of pathogenesis-related genes, such as NbPR1a, NbPR1b, NbPR2, and NbNPR1, which are related to TMV resistance. Furthermore, (E)-2-octenal upregulates jasmonic acid (JA) that levels up to 400-fold in recipient N. benthamiana plants and significantly affects the expression pattern of key genes in the JA/ET signaling pathway, such as NbMYC2, NbERF1, and NbPDF1.2, while the salicylic acid (SA) level is not significantly affected. Our results show for the first time that the volatile (E)-2-octenal primes the JA/ET pathway and then activates immune responses, ultimately leading to enhanced TMV resistance in adjacent N. benthamiana plants. These findings provide new insights into the role of airborne compounds in virus-induced interplant interactions.

CRISPR/Cas9-mediated seamless gene replacement in protoplasts expands the resistance spectrum to TMV-U1 strain in regenerated Nicotiana tabacum.

CRISPR/Cas-based genome editing is now extensively used in plant breeding and continues to evolve. Most CRISPR/Cas current applications in plants focus on gene knock-outs; however, there is a pressing need for new methods to achieve more efficient delivery of CRISPR components and gene knock-ins to improve agronomic traits of crop cultivars. We report here a genome editing system that combines the advantages of protoplast technologies with recent CRISPR/Cas advances to achieve seamless large fragment insertions in the model Solanaceae plant Nicotiana tabacum. With this system, two resistance-related regions of the N' gene were replaced with homologous fragments from the N'alata gene to confer TMV-U1 resistance in the T0 generation of GMO-free plants. Our study establishes a reliable genome-editing tool for efficient gene modifications and provides a detailed description of the optimization process to assist other researchers adapt this system for their needs.

A chitosan-coated lentinan-loaded calcium alginate hydrogel induces broad-spectrum resistance to plant viruses by activating Nicotiana benthamiana calmodulin-like (CML) protein 3.

Control of plant virus diseases largely depends on the induced plant defence achieved by the external application of synthetic chemical inducers with the ability to modify defence-signalling pathways. However, most of the molecular mechanisms underlying these chemical inducers remain unknown. Here, we developed a chitosan-coated lentinan-loaded hydrogel and discovered how it protects plants from different virus infections. The hydrogel was synthesized by coating chitosan on the surface of the calcium alginate-lentinan (LNT) hydrogel (SL-gel) to form a CSL-gel. CSL-gels exhibit the capacity to prolong the stable release of lentinan and promote Ca2+ release. Application of CSL-gels on the root of plants induces broad-spectrum resistance against plant viruses (TMV, TRV, PVX and TuMV). RNA-seq analysis identified that Nicotiana benthamiana calmodulin-like protein gene 3 (NbCML3) is upregulated by the sustained release of Ca2+ from the CSL-gel, and silencing and overexpression of NbCML alter the susceptibility and resistance of tobacco to TMV. Our findings provide evidence that this novel and synthetic CSL-gel strongly inhibits the infection of plant viruses by the sustainable release of LNT and Ca2+ . This study uncovers a novel mode of action by which CSL-gels trigger NbCML3 expression through the stable and sustained release of Ca2+ .

Editing of TOM1 gene in tobacco using CRISPR/Cas9 confers resistance to Tobacco mosaic virus.

BACKGROUND: Genome editing technology has become one of the excellent tools for precise plant breeding to develop novel plant germplasm. The Tobacco mosaic virus (TMV) is the most prominent pathogen that infects several Solanaceae plants, such as tobacco, tomato, and capsicum, which requires critical host factors for infection and replication of its genomic RNA in the host. The Tobamovirus multiplication (TOM) genes, such as TOM1, TOM2A, TOM2B, and TOM3, are involved in the multiplication of Tobamoviruses. TOM1 is a transmembrane protein necessary for efficient TMV multiplication in several plant species. The TOM genes are crucial recessive resistance genes that act against the tobamoviruses in various plant species. METHODS AND RESULTS: The single guided RNA (sgRNA) was designed to target the first exon of the NtTOM1 gene and cloned into the pHSE401 vector. The pHSE401-NtTOM1 vector was introduced into Agrobacterium tumefaciens strain LBA4404 and then transformed into tobacco plants. The analysis on T0 transgenic plants showed the presence of the hptII and Cas9 transgenes. The sequence analysis of the NtTOM1 from T0 plants showed the indels. Genotypic evaluation of the NtTOM1 mutant lines displayed the stable inheritance of the mutations in the subsequent generations of tobacco plants. The NtTOM1 mutant lines successfully conferred resistance to TMV. CONCLUSIONS: CRISPR/Cas genome editing is a reliable tool for investigating gene function and precision breeding across different plant species, especially the species in the Solanaceae family.

Design, synthesis, antiviral and fungicidal activities of novel polycarpine simplified analogues.

Fungal and viral diseases account for 70-80% of agricultural production losses caused by microbial diseases. Synthetic fungicides and antiviral agents have been used to treat plant diseases caused by plant pathogenic fungi and viruses, but their use has been criticized due to their adverse side effects. As alternative strategies, natural fungicides and antiviral agents have attracted many researchers' interest in recent years. Herein, we designed and synthesized a series of novel polycarpine simplified analogues. Antiviral activity research against tobacco mosaic virus (TMV) revealed that most of the designed compounds have good antiviral activities. The virucidal activities of 4, 6d, 6f, 6h, and 8c are higher than that of polycarpine and similar to that of ningnanmycin. The structure simplified compound 8c was selected for further antiviral mechanism research which showed that compound 8c could inhibit the formation of 20S protein discs by acting on TMV coat protein. These compounds also displayed broad-spectrum fungicidal activities against 7 kinds of plant fungi. This work lays the foundation for the application of polycarpine simplified analogues in crop protection.

Limonene anti-TMV activity and its mode of action.

The main component of orange peel essential oil is limonene. Limonene is a natural active monoterpene with multiple functions, such as antibacterial, antiseptic and antitumor activity, and has important development value in agriculture. This study found that limonene exhibited excellent anti-tobacco mosaic virus (TMV) bioactivity, with results showing that its protection activity, inactivation activity, and curative activity at 800 µg/mL were 84.93%, 59.28%, and 58.89%, respectively-significantly higher than those of chito-oligosaccharides. A direct effect of limonene on TMV particles was not observed, but limonene triggered the hypersensitive response (HR) in tobacco. Further determination of the induction activity of limonene against TMV demonstrated that it displayed good induction activity at 800 µg/mL, with a value of 60.59%. The results of physiological and biochemical experiments showed that at different treatment days, 800 µg/mL limonene induced the enhancement of defense enzymes activity in tobacco, including of SOD, CAT, POD, and PAL, which respectively increased by 3.2, 4.67, 4.12, and 2.33 times compared with the control (POD and SOD activities reached highest on the seventh day, and PAL and CAT activities reached highest on the fifth day). Limonene also enhanced the relative expression levels of pathogenesis related (PR) genes, including NPR1, PR1, and PR5, which were upregulated 3.84-fold, 1.86-fold and 1.71-fold, respectively. Limonene induced the accumulation of salicylic acid (SA), and increased the relative expression levels of genes related to SA biosynthesis (PAL) and reactive oxygen species (ROS) burst (RBOHB), which respectively increased by 2.76 times and 4.23 times higher than the control. Systemic acquired resistance (SAR) is an important plant immune defense against pathogen infection. The observed accumulation of SA, the enhancement of defense enzymes activity and the high-level expression of defense-related genes suggested that limonene may induce resistance to TMV in tobacco by activating SAR mediated by the SA signaling pathway. Furthermore, the experimental results demonstrated that the expression level of the chlorophyll biosynthesis gene POR1 was increased 1.72-fold compared to the control in tobacco treated with 800 µg/mL limonene, indicating that limonene treatment may increase chlorophyll content in tobacco. The results of pot experiment showed that 800 µg/mL limonene induced plant resistance against Sclerotinia sclerotiorum (33.33%), Phytophthora capsici (54.55%), Botrytis cinerea (50.00%). The bioassay results indicated that limonene provided broad-spectrum and long-lasting resistance to pathogen infection. Therefore, limonene has good development and utilization value, and is expected to be developed into a new botanical-derived anti-virus agent and plant immunity activator in addition to insecticides and fungicides.

Extraction and characterization of anti-virus anthraquinones from Nicotiana tabacum-derived Aspergillus oryzae YNCA1220.

In this study, seven novel anthraquinones (1-7) and four described anthraquinones (8-11) were purified from Nicotiana tabacum-derived Aspergillus oryzae YNCA1220. It is worth noting that only analogs of 4 and 5 have been reported as natural products to date, while the nuclei of compounds 1-3, 6 and 7 were isolated for the first time in nature. Among them, compounds 1-3 bear an unusual anthra[2,3-b]furan-9,10-dione nucleus, 4 and 5 possess a rare 3-methyl-1H-pyrrol-2-yl substituent, and 6 and 7 are new framework anthraquinones bearing a 6-methyl-1,7-dihydro-2H-azepin-2-one ring. Interestingly, the in vivo assays indicated that 1, 4 and 5 had inactivation effects against tobacco mosaic virus (TMV) with inhibition rates of 41.6%, 55.4% and 38.6%, respectively, at a concentration of 50 µg/mL, which were better than that of the positive control agent, ningnanmycin (33.8%). Compounds 1, 4 and 5 also had protective effects with inhibition rates of 48.7%, 60.2% and 43.5% at the same concentration, while 4 had a better curative effect than ningnanmycin at a concentration of 100 µg/mL. In addition, mechanistic studies also revealed that a potent direct effect on TMV, the induction of SAR in tobacco plants, and the effective regulation of defense enzymes, defense genes, and defense hormones may be the reasons for the significant effects of 4 against TMV. At the same time, downregulation of the expression of total NtHsp70 protein by inhibiting the related Hsp70 genes may also be involved in tobacco resistance to TMV. To evaluate whether compounds have broader antiviral activities, the antirotavirus activities of new isolates were also evaluated and found to be highly effective with a therapeutic index (TI) value ranging from 11.6 to 17.7. This study suggests that the above anthraquinone compounds, particularly 4, have broad spectrum antiviral activities. The successful isolation and structure identification of the above anthraquinones provide new materials for the screening of anti-TMV agents and contribute to the improved utilization of N. tabacum-derived fungi.

Design, Synthesis, Biological Activity Evaluation and Action Mechanism of Myricetin Derivatives Containing Thiazolebisamide.

The plant diseases caused by a variety of pathogens such as viruses, bacteria and fungi pose a great threat to global food production and food safety. Therefore, the search for green, efficient and pollution-free pesticides has become an important task. In this article, 23 myricetin derivatives containing thiazolebisamides active groups have been designed and synthesized. Their activities were evaluated by performing in vitro antibacterial and in vivo antiviral assays, microscale thermophoresis (MST) and molecular docking assays. The results of in vivo antiviral assays showed that compounds A4 and A23 exhibited good antiviral activity with EC50 values of 79.0 and 54.1 µg/mL for therapeutic activity and 103.3 and 91.2 µg/mL for protective activity, respectively. The dissociation constants (Kd) values of compounds A4 and A23 against TMV-CP were 0.021 and 0.018 µM, respectively, determined by microscale thermophoresis (MST), which were much smaller than those of the commercial drug ningnanmycin (NNM), which were 2.84 µM. The interaction of compounds A4, A23 with TMV-CP was further verified at the molecular level. In addition, in vitro antifungal assays of this series of compounds showed that they exhibited some inhibitory activity against a variety of fungi, especially against the phytophthora capsici. Among them, A13 and A20 showed similar inhibitory activity to the control drug azoxystrobin at 100 µg/mL against the phytophthora capsici.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Linalool Induces Resistance Against Tobacco Mosaic Virus in Tobacco Plants.

The essential oil of Cinnamomum camphora is the most widely consumed and used spice in the world today. It has therapeutic effects in medicine and has been shown to have good antibacterial and bacteriostatic effects in agriculture. This study found that C. camphora oil significantly induced plant disease resistance activity. Linalool, its main active component, significantly induced plant disease resistance activity (67.49% at a concentration of 800 µg/ml) over the same concentration of the chitosan oligosaccharide positive control but had no direct effect on tobacco mosaic virus (TMV). In this study of its antiviral mechanism, linalool induced hypersensitive reaction (HR); the overexpression of related defense enzymes SOD, CAT, POD, and PAL; and the accumulation of H2O2 and SA content in N. glutinosa. Besides, linalool induced crops resistance against Colletotrichum lagenarium, Botrytis cinerea, Sclerotinia sclerotiorum, and Phytophthora capsica. Taken together, the anti-TMV mechanism of linalool involved the induction of plant disease resistance through activation of a plant immune response mediated by salicylic acid. Linalool-induced plant disease resistance activity has a long duration, broad spectrum, and rich resources; linalool thus has the potential to be developed as a new plant-derived antiviral agent and plant immune activator.

Two new isoflavones from the roots of Sophora tonkinensis.

Two new isoflavones (1 and 2), as well as eight known ones were isolated from the roots of Sophora tonkinensis Gagnep. Compound 1 represents an unprecedented polymerization pattern constructed by isoflavone and cytisine. Their structures were elucidated by comprehensive spectroscopic data analysis, combined with ECD calculations. Compound 1 displayed significant anti-tobacco mosaic virus (TMV) activity compared with the positive control ningnanmycin. Moreover, compound 6 exhibited potent α-glucosidase inhibitory activity with IC50 value of 47.4 mg/L.