RESUMO
Water use efficiency (WUE) is crucial for apple tree fitness and survival, especially in response to climatic changes. The receptor-like kinase FERONIA is reportedly an essential regulator of plant stress responses, but its role in regulating WUE under water deficit conditions is unclear. Here, we found that overexpressing the apple FERONIA receptor kinase gene, MdMRLK2, enhanced apple WUE under long-term water deficit conditions. Under drought treatment, 35S::MdMRLK2 apple plants exhibited higher photosynthetic capacity and antioxidant enzyme activities than wild-type (WT) plants. 35S::MdMRLK2 apple plants also showed increased biomass accumulation, root activity, and water potential compared to WT plants. Moreover, MdMRLK2 physically interacts with and phosphorylates cinnamoyl-CoA reductase 1, MdCCR1, an enzyme essential for lignin synthesis, at position Ser260. This interaction likely contributed to increased vessel density, vascular cylinder area, and lignin content in 35S::MdMRLK2 apple plants under drought conditions. Therefore, our findings reveal a novel function of MdMRLK2 in regulating apple WUE under water deficit conditions.
RESUMO
Tree growth and survival are dependent on their ability to perceive signals, integrate them, and trigger timely and fitted molecular and growth responses. While ectomycorrhizal symbiosis is a predominant tree-microbe interaction in forest ecosystems, little is known about how and to what extent it helps trees cope with environmental changes. We hypothesized that the presence of Laccaria bicolor influences abiotic cue perception by Populus trichocarpa and the ensuing signaling cascade. We submitted ectomycorrhizal or non-ectomycorrhizal P. trichocarpa cuttings to short-term cessation of watering or ozone fumigation to focus on signaling networks before the onset of any physiological damage. Poplar gene expression, metabolite levels, and hormone levels were measured in several organs (roots, leaves, mycorrhizas) and integrated into networks. We discriminated the signal responses modified or maintained by ectomycorrhization. Ectomycorrhizas buffered hormonal changes in response to short-term environmental variations systemically prepared the root system for further fungal colonization and alleviated part of the root abscisic acid (ABA) signaling. The presence of ectomycorrhizas in the roots also modified the leaf multi-omics landscape and ozone responses, most likely through rewiring of the molecular drivers of photosynthesis and the calcium signaling pathway. In conclusion, P. trichocarpa-L. bicolor symbiosis results in a systemic remodeling of the host's signaling networks in response to abiotic changes. In addition, ectomycorrhizal, hormonal, metabolic, and transcriptomic blueprints are maintained in response to abiotic cues, suggesting that ectomycorrhizas are less responsive than non-mycorrhizal roots to abiotic challenges.
Assuntos
Micorrizas , Ozônio , Populus , Micorrizas/fisiologia , Simbiose , Sinais (Psicologia) , Raízes de Plantas/metabolismo , Ecossistema , Populus/genéticaRESUMO
BACKGROUND: Drought poses a major threat to agricultural production and thus food security. Understanding the processes shaping plant responses to water deficit is essential for global food safety. Though many studies examined the effect of water deficit on the whole-root level, the distinct functions of each root zone and their specific stress responses remain masked by this approach. RESULTS: In this study, we investigated the effect of water deficit on root development of the spring barley (Hordeum vulgare L.) cultivar Morex and examined transcriptomic responses at the level of longitudinal root zones. Water deficit significantly reduced root growth rates after two days of treatment. RNA-sequencing revealed root zone and temporal gene expression changes depending on the duration of water deficit treatment. The majority of water deficit-regulated genes were unique for their respective root zone-by-treatment combination, though they were associated with commonly enriched gene ontology terms. Among these, we found terms associated with transport, detoxification, or cell wall formation affected by water deficit. Integration of weighted gene co-expression analyses identified differential hub genes, that highlighted the importance of modulating energy and protein metabolism and stress response. CONCLUSION: Our findings provide new insights into the highly dynamic and spatiotemporal response cascade triggered by water deficit and the underlying genetic regulations on the level of root zones in the barley cultivar Morex, providing potential targets to enhance plant resilience against environmental constraints. This study further emphasizes the importance of considering spatial and temporal resolution when examining stress responses.
Assuntos
Hordeum , Água , Água/metabolismo , Hordeum/metabolismo , Raízes de Plantas/metabolismo , Perfilação da Expressão Gênica , Transcriptoma , SecasRESUMO
BACKGROUND: Water deficiency stress reduces yield in grain legumes, primarily due to a decrease in the pods number. Melatonin (ML) and 24-epibrassinolide (EBL) are recognized for their hormone-like properties that improve plant tolerance to abiotic stresses. This study aimed to assess the impact of different concentrations of ML (0, 100, and 200 µM) and EBL (0, 3, and 6 µM) on the growth, biochemical, and physiological characteristics of chickpea plants under water-stressed conditions. RESULTS: The study's findings indicated that under water-stressed conditions, a decrease in seed (30%) and pod numbers (31%), 100-seed weight (17%), total chlorophyll content (46%), stomatal conductance (33%), as well as an increase in H2O2 (62%), malondialdehyde content (40%), and electrolyte leakage index (40%), resulted in a 40% reduction in chickpea plants grain yield. Our findings confirmed that under water-stressed conditions, seed oil, seed oil yield, and seed protein yield dropped by 20%, 55%, and 36%, respectively. The concurrent exogenous application of ML and EBL significantly reduces oxidative stress, plasma membrane damage, and reactive oxygen species (ROS) content. This treatment also leads to increased yield and its components, higher pigment content, enhanced oil and protein yield, and improved enzymatic and non-enzymatic antioxidant activities such as catalase, superoxide dismutase, polyphenol oxidase, ascorbate peroxidase, guaiacol peroxidase, flavonoid, and carotenoid. Furthermore, it promotes the accumulation of osmoprotectants such as proline, total soluble protein, and sugars. CONCLUSIONS: Our study found that ML and EBL act synergistically to regulate plant growth, photosynthesis, osmoprotectants accumulation, antioxidant defense systems, and maintain ROS homeostasis, thereby mitigating the adverse effects of water deficit conditions. ML and EBL are key regulatory network components in stressful conditions, with significant potential for future research and practical applications. The regulation metabolic pathways of ML and EBL in water-stressed remains unknown. As a result, future research should aim to elucidate the molecular mechanisms by employing genome editing, RNA sequencing, microarray, transcriptomic, proteomic, and metabolomic analyses to identify the mechanisms involved in plant responses to exogenous ML and EBL under water deficit conditions. Furthermore, the economical applications of synthetic ML and EBL could be an interesting strategy for improving plant tolerance.
Assuntos
Brassinosteroides , Cicer , Desidratação , Melatonina , Esteroides Heterocíclicos , Brassinosteroides/farmacologia , Brassinosteroides/metabolismo , Cicer/efeitos dos fármacos , Cicer/fisiologia , Cicer/genética , Cicer/crescimento & desenvolvimento , Cicer/metabolismo , Melatonina/farmacologia , Esteroides Heterocíclicos/farmacologia , Estresse Oxidativo/efeitos dos fármacos , Sinergismo Farmacológico , Reguladores de Crescimento de Plantas/metabolismo , Reguladores de Crescimento de Plantas/farmacologia , Espécies Reativas de Oxigênio/metabolismo , Antioxidantes/metabolismo , Sementes/efeitos dos fármacos , Sementes/crescimento & desenvolvimento , Sementes/fisiologiaRESUMO
BACKGROUND: Fructans are water-soluble carbohydrates that accumulate in wheat and are thought to contribute to a pool of stored carbon reserves used in grain filling and tolerance to abiotic stress. RESULTS: In this study, transgenic wheat plants were engineered to overexpress a fusion of two fructan biosynthesis pathway genes, wheat sucrose: sucrose 1-fructosyltransferase (Ta1SST) and wheat sucrose: fructan 6-fructosyltransferase (Ta6SFT), regulated by a wheat ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (TaRbcS) gene promoter. We have shown that T4 generation transgene-homozygous single-copy events accumulated more fructan polymers in leaf, stem and grain when compared in the same tissues from transgene null lines. Under water-deficit (WD) conditions, transgenic wheat plants showed an increased accumulation of fructan polymers with a high degree of polymerisation (DP) when compared to non-transgenic plants. In wheat grain of a transgenic event, increased deposition of particular fructan polymers such as, DP4 was observed. CONCLUSIONS: This study demonstrated that the tissue-regulated expression of a gene fusion between Ta1SST and Ta6SFT resulted in modified fructan accumulation in transgenic wheat plants and was influenced by water-deficit stress conditions.
Assuntos
Proteínas de Bactérias , Frutanos , Hexosiltransferases , Plantas Geneticamente Modificadas , Triticum , Triticum/genética , Triticum/metabolismo , Plantas Geneticamente Modificadas/genética , Frutanos/metabolismo , Frutanos/biossíntese , Hexosiltransferases/genética , Hexosiltransferases/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Regulação da Expressão Gênica de Plantas , Fusão GênicaRESUMO
MAIN CONCLUSION: The Arabidopsis Pentatricopeptide repeat 40 (PPR40) insertion mutants have increased tolerance to water deficit compared to wild-type plants. Tolerance is likely the consequence of ABA hypersensitivity of the mutants. Plant growth and development depend on multiple environmental factors whose alterations can disrupt plant homeostasis and trigger complex molecular and physiological responses. Water deficit is one of the factors which can seriously restrict plant growth and viability. Mitochondria play an important role in cellular metabolism, energy production, and redox homeostasis. During drought and salinity stress, mitochondrial dysfunction can lead to ROS overproduction and oxidative stress, affecting plant growth and survival. Alternative oxidases (AOXs) and stabilization of mitochondrial electron transport chain help mitigate ROS damage. The mitochondrial Pentatricopeptide repeat 40 (PPR40) protein was implicated in stress regulation as ppr40 mutants were found to be hypersensitive to ABA and high salinity during germination. This study investigated the tolerance of the knockout ppr40-1 and knockdown ppr40-2 mutants to water deprivation. Our results show that these mutants display an enhanced tolerance to water deficit. The mutants had higher relative water content, reduced level of oxidative damage, and better photosynthetic parameters in water-limited conditions compared to wild-type plants. ppr40 mutants had considerable differences in metabolic profiles and expression of a number of stress-related genes, suggesting important metabolic reprogramming. Tolerance to water deficit was also manifested in higher survival rates and alleviated growth reduction when watering was suspended. Enhanced sensitivity to ABA and fast stomata closure was suggested to lead to improved capacity for water conservation in such environment. Overall, this study highlights the importance of mitochondrial functions and in particular PPR40 in plant responses to abiotic stress, particularly drought.
Assuntos
Proteínas de Arabidopsis , Arabidopsis , Arabidopsis/metabolismo , Proteínas de Arabidopsis/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Água/metabolismo , Ácido Abscísico/farmacologia , Ácido Abscísico/metabolismo , Estresse Fisiológico/genética , Mutação , Regulação da Expressão Gênica de Plantas , Secas , Plantas Geneticamente Modificadas/metabolismoRESUMO
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Assuntos
Regulação da Expressão Gênica de Plantas , Plantas Geneticamente Modificadas , Populus , Regiões Promotoras Genéticas , Populus/genética , Populus/metabolismo , Regiões Promotoras Genéticas/genética , Plantas Geneticamente Modificadas/genética , Desidratação/genética , Estresse Fisiológico/genética , Especificidade de Órgãos/genética , Folhas de Planta/genética , Folhas de Planta/metabolismoRESUMO
The phytohormone abscisic acid (ABA) is synthesised by plants during drought to close stomata and regulate desiccation tolerance pathways. Conifers and some angiosperms with embolism-resistant xylem show a peaking-type (p-type) response in ABA levels, in which ABA levels increase early in drought then decrease as drought progresses, declining to pre-stressed levels. The mechanism behind this dynamic remains unknown. Here, we sought to characterise the mechanism driving p-type ABA dynamics in the conifer Callitris rhomboidea and the highly drought-resistant angiosperm Umbellularia californica. We measured leaf water potentials (Ψl ), stomatal conductance, ABA, conjugates and phaseic acid (PA) levels in potted plants during a prolonged but non-fatal drought. Both species displayed a p-type ABA dynamic during prolonged drought. In branches collected before and after the peak in endogenous ABA levels in planta, that were rehydrated overnight and then bench dried, ABA biosynthesis was deactivated beyond leaf turgor loss point. Considerable conversion of ABA to conjugates was found to occur during drought, but not catabolism to PA. The mechanism driving the decline in ABA levels in p-type species may be conserved across embolism-resistant seed plants and is mediated by sustained conjugation of ABA and the deactivation of ABA accumulation as Ψl becomes more negative than turgor loss.
Assuntos
Embolia , Magnoliopsida , Traqueófitas , Estômatos de Plantas/fisiologia , Secas , Folhas de Planta/metabolismo , Ácido Abscísico/metabolismo , Água/metabolismo , Magnoliopsida/fisiologiaRESUMO
Climate change is predicted to increase atmospheric vapor pressure deficit, exacerbating soil drought, and thus enhancing tree evaporative demand and mortality. Yet, few studies have addressed the longer-term drought acclimation strategy of trees, particularly the importance of morphological versus hydraulic plasticity. Using a long-term (20 years) irrigation experiment in a natural forest, we investigated the acclimation of Scots pine (Pinus sylvestris) morpho-anatomical traits (stomatal anatomy and crown density) and hydraulic traits (leaf water potential, vulnerability to cavitation (Ψ50), specific hydraulic conductivity (Ks), and tree water deficit) to prolonged changes in soil moisture. We found that low water availability reduced twig water potential and increased tree water deficit during the growing season. Still, the trees showed limited adjustments in most branch-level hydraulic traits (Ψ50 and Ks) and needle anatomy. In contrast, trees acclimated to prolonged irrigation by increasing their crown density and hence the canopy water demand. This study demonstrates that despite substantial canopy adjustments, P. sylvestris may be vulnerable to extreme droughts because of limited adjustment potential in its hydraulic system. While sparser canopies reduce water demand, such shifts take decades to occur under chronic water deficits and might not mitigate short-term extreme drought events.
Assuntos
Aclimatação , Florestas , Pinus sylvestris , Água , Pinus sylvestris/fisiologia , Pinus sylvestris/anatomia & histologia , Pinus sylvestris/crescimento & desenvolvimento , Água/metabolismo , Água/fisiologia , Folhas de Planta/fisiologia , Folhas de Planta/anatomia & histologia , Irrigação Agrícola , Secas , Árvores/fisiologia , Árvores/anatomia & histologiaRESUMO
Barley is a staple crop of major global importance and relatively resilient to a wide range of stress factors in the field. Transgenic reporter lines to investigate physiological parameters during stress treatments remain scarce. We generated and characterized transgenic homozygous barley lines (cv. Golden Promise Fast) expressing the genetically encoded biosensor Grx1-roGFP2, which indicates the redox potential of the major antioxidant glutathione in the cytosol. Our results demonstrated functionality of the sensor in living barley plants. We determined the glutathione redox potential (EGSH) of the cytosol to be in the range of -308 mV to -320 mV. EGSH was robust against a combined NaCl (150 mM) and water deficit treatment (-0.8 MPa) but responded with oxidation to infiltration with the phytotoxic secretome of the necrotrophic fungus Botrytis cinerea. The generated reporter lines are a novel resource to study biotic and abiotic stress resilience in barley, pinpointing that even severe abiotic stress leading to a growth delay does not automatically induce cytosolic EGSH oxidation, while necrotrophic pathogens can undermine this robustness.
Assuntos
Técnicas Biossensoriais , Hordeum , Citosol/metabolismo , Hordeum/genética , Hordeum/metabolismo , Estresse Fisiológico , Oxirredução , Glutationa/metabolismo , Técnicas Biossensoriais/métodosRESUMO
The growth and yield of crop plants are threatened by environmental challenges such as water deficit, soil flooding, high salinity, and extreme temperatures, which are becoming increasingly severe under climate change. Stomata contribute greatly to plant adaptation to stressful environments by governing transpirational water loss and photosynthetic gas exchange. Increasing evidence has revealed that stomata formation is shaped by transcription factors, signaling peptides, and protein kinases, which could be exploited to improve crop stress resistance. The past decades have seen unprecedented progress in our understanding of stomata formation, but most of these advances have come from research on model plants. This review highlights recent research in stomata formation in crops and its multifaceted functions in abiotic stress tolerance. Current strategies, limitations, and future directions for harnessing stomatal development to improve crop stress resistance are discussed.
Assuntos
Estômatos de Plantas , Plantas , Estômatos de Plantas/fisiologia , Plantas/metabolismo , Fotossíntese/fisiologia , Estresse Fisiológico , Água/metabolismoRESUMO
Climate change presents a challenge for plants to acclimate their water relations under changing environmental conditions, and may increase the risks of hydraulic failure under stress. In this study, maize plants were acclimated to two different CO2 concentrations ([CO2]; 400 ppm and 700 ppm) while under either water stress (WS) or soil salinity (SS) treatments, and their growth and hydraulic traits were examined in detail. Both WS and SS inhibited growth and had significant impacts on hydraulic traits. In particular, the water potential at 50% loss of stem hydraulic conductance (P50) decreased by 1 MPa in both treatments at 400 ppm. When subjected to elevated [CO2], the plants under both WS and SS showed improved growth by 7-23%. Elevated [CO2] also significantly increased xylem vulnerability (measured as loss of conductivity with decreasing xylem pressure), resulting in smaller hydraulic safety margins. According to the plant desiccation model, the critical desiccation degree (time×vapor pressure deficit) that the plants could tolerate under drought was reduced by 43-64% under elevated [CO2]. In addition, sensitivity analysis showed that P50 was the most important trait in determining the critical desiccation degree. Thus, our results demonstrated that whilst elevated [CO2] benefited plant growth under WS or SS, it also interfered with hydraulic acclimation, thereby potentially placing the plants at a higher risk of hydraulic failure and increased mortality.
Assuntos
Dióxido de Carbono , Zea mays , Dióxido de Carbono/farmacologia , Solo , Salinidade , Desenvolvimento Vegetal , Xilema , Secas , Folhas de PlantaRESUMO
Drought stress poses a serious threat to grain formation in wheat. Nitrogen (N) plays crucial roles in plant organ development; however, the physiological mechanisms by which drought stress affects plant N availability and mediates the formation of grains in spikes of winter wheat are still unclear. In this study, we determined that pre-reproductive drought stress significantly reduced the number of fertile florets and the number of grains formed. Transcriptome analysis demonstrated that this was related to N metabolism, and in particular, the metabolism pathways of arginine (the main precursor for synthesis of polyamine) and proline. Continuous drought stress restricted plant N accumulation and reallocation rates, and plants preferentially allocated more N to spike development. As the activities of amino acid biosynthesis enzymes and catabolic enzymes were inhibited, more free amino acids accumulated in young spikes. The expression of polyamine synthase genes was down-regulated under drought stress, whilst expression of genes encoding catabolic enzymes was enhanced, resulting in reductions in endogenous spermidine and putrescine. Treatment with exogenous spermidine optimized N allocation in young spikes and leaves, which greatly alleviated the drought-induced reduction in the number of grains per spike. Overall, our results show that pre-reproductive drought stress affects wheat grain numbers by regulating N redistribution and polyamine metabolism.
Assuntos
Poliaminas , Espermidina , Poliaminas/metabolismo , Poliaminas/farmacologia , Espermidina/metabolismo , Espermidina/farmacologia , Triticum/metabolismo , Nitrogênio/metabolismo , Secas , Grão Comestível/metabolismoRESUMO
Droughts have been implicated as the main driver behind recent vegetation die-off and are projected to drive greater mortality under future climate change. Understanding the coupling relationship between vegetation and drought has been of great global interest. Currently, the coupling relationship between vegetation and drought is mainly evaluated by correlation coefficients or regression slopes. However, the optimal drought timescale of vegetation response to drought, as a key indicator reflecting vegetation sensitivity to drought, has largely been ignored. Here, we apply the optimal drought timescale identification method to examine the change in coupling between vegetation and drought over the past three decades (1982-2015) with long-term satellite-derived Normalized Difference Vegetation Index and Standardized Precipitation-Evapotranspiration Index data. We find substantial increasing response of vegetation to drought timescales globally, and the correlation coefficient between vegetation and drought under optimal drought timescale overall declines between 1982 and 2015. This decrease in vegetation-drought coupling is mainly observed in regions with water deficit, although its initial correlation is relatively high. However, vegetation in water-surplus regions, with low coupling in earlier stages, is prone to show an increasing trend. The observed changes may be driven by the increasing trend of atmospheric CO2 . Our findings highlight more pressing drought risk in water-surplus regions than in water-deficit regions, which advances our understanding of the long-term vegetation-drought relationship and provides essential insights for mapping future vegetation sensitivity to drought under changing climate conditions.
Assuntos
Mudança Climática , Secas , Água , Ecossistema , ChinaRESUMO
Globally, soil acidification is a serious environmental issue that reduces commercial agricultural production. Rice is subjected to nutritional stress due to acidic soil, which is a major impediment to rice production. Since acid soil threatens rice plants with soil compaction, nutrient loss, and plant stress-induced oxidative cell damage that results in affecting the photosynthetic system, restricting the availability of water, and reducing overall plant growth and productivity. Since contemporary soil acidification management strategies provide mediocre results, the use of Sargassum wightii seaweed-based biostimulants (BS) and soil amendments is sought as an environmentally friendly alternative strategy, and therefore its potential isevaluated in this study. BS was able to mediate soil quality by improving soil pH and structure along with facilitating nitrogen phytoavailability. BS also increased the activity of the antioxidant enzyme system, superoxide dismutase ((48%), peroxidase (76.6%), and ascorbate peroxidase (63.5%), aggregating the monaldehyde-mediating accumulation of osmoprotective proline in roots, that was evident from rapid initiation of root hair growth in treated seedlings. BS was also able to physiologically modulate photosynthetic activities and chlorophyll production (24.31%) in leaves, maintaining the efficiency of plant water use by regulating the stomatal conductance (0.91 mol/m/s) and the transpiration rate (13.2 mM/m/s). The BS compounds were also successful in facilitating nitrogen uptake resulting in improved plant growth (59%), tiller-panicle number, and yield (52.57%), demonstrating a resourceful nitrogen use efficiency (71.96%) previously affected by stress induced by acid soil. Therefore, the study affirms the competent potential of S. wightii-based soil amendment to be applied not only to improve soil quality, but also to increase plant production and yield.
Assuntos
Oryza , Solo , Fotossíntese/fisiologia , Antioxidantes/metabolismo , Nitrogênio , Verduras , ÁguaRESUMO
KEY MESSAGE: Overexpression of rice A20/AN1 zinc-finger protein, OsSAP10, improves water-deficit stress tolerance in Arabidopsis via interaction with multiple proteins. Stress-associated proteins (SAPs) constitute a class of A20/AN1 zinc-finger domain containing proteins and their genes are induced in response to multiple abiotic stresses. The role of certain SAP genes in conferring abiotic stress tolerance is well established, but their mechanism of action is poorly understood. To improve our understanding of SAP gene functions, OsSAP10, a stress-inducible rice gene, was chosen for the functional and molecular characterization. To elucidate its role in water-deficit stress (WDS) response, we aimed to functionally characterize its roles in transgenic Arabidopsis, overexpressing OsSAP10. OsSAP10 transgenics showed improved tolerance to water-deficit stress at seed germination, seedling and mature plant stages. At physiological and biochemical levels, OsSAP10 transgenics exhibited a higher survival rate, increased relative water content, high osmolyte accumulation (proline and soluble sugar), reduced water loss, low ROS production, low MDA content and protected yield loss under WDS relative to wild type (WT). Moreover, transgenics were hypersensitive to ABA treatment with enhanced ABA signaling and stress-responsive genes expression. The protein-protein interaction studies revealed that OsSAP10 interacts with proteins involved in proteasomal pathway, such as OsRAD23, polyubiquitin and with negative and positive regulators of stress signaling, i.e., OsMBP1.2, OsDRIP2, OsSCP and OsAMTR1. The A20 domain was found to be crucial for most interactions but insufficient for all interactions tested. Overall, our investigations suggest that OsSAP10 is an important candidate for improving water-deficit stress tolerance in plants, and positively regulates ABA and WDS signaling via protein-protein interactions and modulation of endogenous genes expression in ABA-dependent manner.
Assuntos
Ácido Abscísico , Arabidopsis , Regulação da Expressão Gênica de Plantas , Oryza , Proteínas de Plantas , Plantas Geneticamente Modificadas , Complexo de Endopeptidases do Proteassoma , Transdução de Sinais , Arabidopsis/genética , Arabidopsis/fisiologia , Oryza/genética , Oryza/fisiologia , Oryza/metabolismo , Ácido Abscísico/metabolismo , Ácido Abscísico/farmacologia , Transdução de Sinais/genética , Complexo de Endopeptidases do Proteassoma/metabolismo , Complexo de Endopeptidases do Proteassoma/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Estresse Fisiológico/genética , Germinação/genética , Germinação/efeitos dos fármacos , Secas , Água/metabolismo , Desidratação , Plântula/genética , Plântula/fisiologiaRESUMO
The objective of this study was to evaluate the diversity and population dynamics of mites in soybean crops with different cultivars and management practices. The study was conducted in two soybean production fields in the municipalities of Mato Queimado (L1) and Três de Maio (L2), Rio Grande do Sul state, Brazil. Two transgenic cultivars were used, and insecticide applications varied among treatments. Sampling began at the V2 stage, with 60 leaves/area/collection that were sorted, mites were collected and identified using dichotomous keys. A total of 18,100 mites belonging to 12 species were found. Among the species, Tetranychus urticae Koch, Mononychellus planki (McGregor), and Tetranychus ludeni Zacher (Tetranychidae) were the most abundant, whereas the most abundant predatory mites were the phytoseiids Neoseiulus californicus McGregor and Neoseiulus idaeus Denmark and Muma, with N. idaeus being more abundant and present in all areas. The acarofauna was influenced by environmental conditions and management practices. Neoseiulus idaeus was commonly associated with populations of M. planki, T. ludeni, and T. urticae. Neoseiulus californicus tolerated pesticide use but was affected by severe water stress, whereas N. idaeus tolerated periods of low relative humidity and high temperatures.
Assuntos
Ácaros , Tetranychidae , Animais , Glycine max , Controle Biológico de Vetores , Comportamento Predatório , Produtos Agrícolas , Dinâmica PopulacionalRESUMO
Sorghum production system in the semi-arid region of Africa is characterized by low yields which are generally attributed to high rainfall variability, poor soil fertility, and biotic factors. Production constraints must be well understood and quantified to design effective sorghum-system improvements. This study uses the state-of-the-art in silico methods and focuses on characterizing the sorghum production regions in Mali for drought occurrence and its effects on sorghum productivity. For this purpose, we adapted the APSIM-sorghum module to reproduce two cultivated photoperiod-sensitive sorghum types across a latitude of major sorghum production regions in Western Africa. We used the simulation outputs to characterize drought stress scenarios. We identified three main drought scenarios: (i) no-stress; (ii) early pre-flowering drought stress; and (iii) drought stress onset around flowering. The frequency of drought stress scenarios experienced by the two sorghum types across rainfall zones and soil types differed. As expected, the early pre-flowering and flowering drought stress occurred more frequently in isohyets < 600 mm, for the photoperiod-sensitive, late-flowering sorghum type. In isohyets above 600 mm, the frequency of drought stress was very low for both cultivars. We quantified the consequences of these drought scenarios on grain and biomass productivity. The yields of the highly-photoperiod-sensitive sorghum type were quite stable across the higher rainfall zones > 600 mm, but was affected by the drought stress in the lower rainfall zones < 600 mm. Comparatively, the less photoperiod-sensitive cultivar had notable yield gain in the driest regions < 600 mm. The results suggest that, at least for the tested crop types, drought stress might not be the major constraint to sorghum production in isohyets > 600 mm. The findings from this study provide the entry point for further quantitative testing of the Genotype × Environment × Management options required to optimize sorghum production in Mali. Supplementary Information: The online version contains supplementary material available at 10.1007/s13593-023-00909-5.
RESUMO
Global agriculture is dominated by a handful of species that currently supply a huge proportion of our food and feed. It additionally faces the massive challenge of providing food for 10 billion people by 2050, despite increasing environmental deterioration. One way to better plan production in the face of current and continuing climate change is to better understand how our domestication of these crops included their adaptation to environments that were highly distinct from those of their centre of origin. There are many prominent examples of this, including the development of temperate Zea mays (maize) and the alteration of day-length requirements in Solanum tuberosum (potato). Despite the pre-eminence of some 15 crops, more than 50 000 species are edible, with 7000 of these considered semi-cultivated. Opportunities afforded by next-generation sequencing technologies alongside other methods, including metabolomics and high-throughput phenotyping, are starting to contribute to a better characterization of a handful of these species. Moreover, the first examples of de novo domestication have appeared, whereby key target genes are modified in a wild species in order to confer predictable traits of agronomic value. Here, we review the scale of the challenge, drawing extensively on the characterization of past agriculture to suggest informed strategies upon which the breeding of future climate-resilient crops can be based.
Assuntos
Adaptação Fisiológica , Mudança Climática , Produtos Agrícolas/genética , Abastecimento de Alimentos , Agricultura , Produtos Agrícolas/fisiologia , Domesticação , Edição de Genes , Melhoramento Vegetal , IncertezaRESUMO
Drought significantly limits apple fruit production and quality. Decoding the key genes involved in drought stress tolerance is important for breeding varieties with improved drought resistance. Here, we identified GRETCHEN HAGEN3.6 (GH3.6), an indole-3-acetic acid (IAA) conjugating enzyme, to be a negative regulator of water-deficit stress tolerance in apple. Overexpressing MdGH3.6 reduced IAA content, adventitious root number, root length and water-deficit stress tolerance, whereas knocking down MdGH3.6 and its close paralogs increased IAA content, adventitious root number, root length and water-deficit stress tolerance. Moreover, MdGH3.6 negatively regulated the expression of wax biosynthetic genes under water-deficit stress and thus negatively regulated cuticular wax content. Additionally, MdGH3.6 negatively regulated reactive oxygen species scavengers, including antioxidant enzymes and metabolites involved in the phenylpropanoid and flavonoid pathway in response to water-deficit stress. Further study revealed that the homolog of transcription factor AtMYB94, rather than AtMYB96, could bind to the MdGH3.6 promoter and negatively regulated its expression under water-deficit stress conditions in apple. Overall, our results identify a candidate gene for the improvement of drought resistance in fruit trees.