The P1 protein of wheat yellow mosaic virus exerts RNA silencing suppression activity to facilitate virus infection in wheat plants.

Wheat yellow mosaic virus (WYMV) causes severe wheat viral disease in Asia. However, the viral suppressor of RNA silencing (VSR) encoded by WYMV has not been identified. Here, the P1 protein encoded by WYMV RNA2 was shown to suppress RNA silencing in Nicotiana benthamiana. Mutagenesis assays revealed that the alanine substitution mutant G175A of P1 abolished VSR activity and mutant Y10A VSR activity remained only in younger leaves. P1, but not G175A, interacted with gene silencing-related protein, N. benthamiana calmodulin-like protein (NbCaM), and calmodulin-binding transcription activator 3 (NbCAMTA3), and Y10A interacted with NbCAMTA3 only. Competitive Bimolecular fluorescence complementation and co-immunoprecipitation assays showed that the ability of P1 disturbing the interaction between NbCaM and NbCAMTA3 was stronger than Y10A, Y10A was stronger than G175A. In vitro transcript inoculation of infectious WYMV clones further demonstrated that VSR-defective mutants G175A and Y10A reduced WYMV infection in wheat (Triticum aestivum L.), G175A had a more significant effect on virus accumulation in upper leaves of wheat than Y10A. Moreover, RNA silencing, temperature, and autophagy have significant effects on the accumulation of P1 in N. benthamiana. Taken together, WYMV P1 acts as VSR by interfering with calmodulin-associated antiviral RNAi defense to facilitate virus infection in wheat, which has provided clear insights into the function of P1 in the process of WYMV infection.

Multi-GWAS reveals significant genomic regions for Mungbean yellow mosaic India virus resistance in urdbean (Vigna mungo (L.) across multiple environments.

KEY MESSAGE: Unraveling genetic markers for MYMIV resistance in urdbean, with 8 high-confidence marker-trait associations identified across diverse environments, provides crucial insights for combating MYMIV disease, informing future breeding strategies. Globally, yellow mosaic disease (YMD) causes significant yield losses, reaching up to 100% in favorable environments within major urdbean cultivating regions. The introgression of genomic regions conferring resistance into urdbean cultivars is crucial for combating YMD, including resistance against mungbean yellow mosaic India virus (MYMIV). To uncover the genetic basis of MYMIV resistance, we conducted a genome-wide association study (GWAS) using three multi-locus models in 100 diverse urdbean genotypes cultivated across six individual and two combined environments. Leveraging 4538 high-quality single nucleotide polymorphism (SNP) markers, we identified 28 unique significant marker-trait associations (MTAs) for MYMIV resistance, with 8 MTAs considered of high confidence due to detection across multiple GWAS models and/or environments. Notably, 4 out of 28 MTAs were found in proximity to previously reported genomic regions associated with MYMIV resistance in urdbean and mungbean, strengthening our findings and indicating consistent genomic regions for MYMIV resistance. Among the eight highly significant MTAs, one localized on chromosome 6 adjacent to previously identified quantitative trait loci for MYMIV resistance, while the remaining seven were novel. These MTAs contain several genes implicated in disease resistance, including four common ones consistently found across all eight MTAs: receptor-like serine-threonine kinases, E3 ubiquitin-protein ligase, pentatricopeptide repeat, and ankyrin repeats. Previous studies have linked these genes to defense against viral infections across different crops, suggesting their potential for further basic research involving cloning and utilization in breeding programs. This study represents the first GWAS investigation aimed at identifying resistance against MYMIV in urdbean germplasm.

Series of Resistance Genes in Barley (Hordeum vulgare) that Control Barley Yellow Mosaic Virus Multiplication and the Root-to-Leaf Systemic Movement.

The infection of young winter barley (Hordeum vulgare L.) root system in winter by barley yellow mosaic virus (BaYMV) can lead to high yield losses. Resistance breeding is critical for managing this virus, but there are only a few reports on resistance genes that describe how the genes control BaYMV propagation and the systemic movement from the roots to the leaves. Here we report a real-time quantitative PCR analysis of the virus in barley roots and leaves carrying BaYMV resistance genes (rym1 to rym15 and an unknown gene) to elucidate the molecular mechanisms underlying the barley response to BaYMV. The resistance mechanism directly targets the virus. Moreover, the resistance genes/cultivars were classified into the following three groups according to their BaYMV titer: (i) immune (BaYMV was undetectable in the roots or leaves), (ii) partially immune (BaYMV was detected in the roots but not in the leaves), and (iii) susceptible (BaYMV was detected in the roots and leaves). Our results clarified the functions of the resistance genes in barley roots and leaves following a BaYMV infection. We anticipate our analysis to be a starting point for more understanding of the correspondence between resistance genes of Triticeae and the soil-borne viruses.

An Interspecies Recombinant Sida Yellow Mosaic China Virus Isolate and Betasatellite Cause a Leaf Curl Disease in Tobacco in Hainan, China.

Tobacco (Nicotiana tabacum) is an herbaceous crop. Cigar tobacco, a group of tobacco cultivars, has recently been planted in a few provinces in China. Since its introduction, symptoms such as leaf curling and vein thickening have appeared. Here we report a begomovirus, Sida yellow mosaic China virus-Hainan isolate (designated SiYMCNV-HN), associated with the betasatellite (designated SiYMCNB-HN) as the causal agent of a leaf curl disease in cigar tobacco (N. tabacum cv. Haiyan101) in Hainan Province, China. Phylogenetic and recombination analyses indicate that SiYMCNV-HN is an interspecies recombinant with a SiYMCNV isolate as the major parent and a Sida yellow vein Vietnam virus isolate as the minor parent. Full-length infectious clones of SiYMCNV-HN and SiYMCNB-HN were generated, which were highly infectious and induced high pathogenicity through agroinfiltration in Nicotiana benthamiana and N. tabacum. This newly reported recombinant begomovirus poses potential threats to tobacco plantations in the region.

Molecular insights into the responses of barley to yellow mosaic disease through transcriptome analysis.

BACKGROUND: Barley (Hordeum vulgare L.) represents the fourth most essential cereal crop in the world, vulnerable to barley yellow mosaic virus (BaYMV) and/or barley mild mosaic virus (BaMMV), leading to the significant yield reduction. To gain a better understanding of the mechanisms regarding barley crop tolerance to virus infection, we employed a transcriptome sequencing approach and investigated global gene expression among three barley varieties under both infected and control conditions. RESULTS: High-throughput sequencing outputs revealed massive genetic responses, reflected by the barley transcriptome after BaYMV and/or BaMMV infection. Significant enrichments in peptidase complex and protein processing in endoplasmic reticulum were clustered through Gene ontology and KEGG analysis. Many genes were identified as transcription factors, antioxidants, disease resistance genes and plant hormones and differentially expressed between infected and uninfected barley varieties. Importantly, general response genes, variety-specific and infection-specific genes were also discovered. Our results provide useful information for future barley breeding to resist BaYMV and BaMMV. CONCLUSIONS: Our study elucidates transcriptomic adaptations in barley response to BaYMV/BaMMV infection through high-throughput sequencing technique. The analysis outcome from GO and KEGG pathways suggests that BaYMV disease induced regulations in multiple molecular-biology processes and signalling pathways. Moreover, critical DEGs involved in defence and stress tolerance mechanisms were displayed. Further functional investigations focusing on these DEGs contributes to understanding the molecular mechanisms of plant response to BaYMV disease infection, thereby offering precious genetic resources for breeding barley varieties resistant to BaYMV disease.

Exogenous delivery of dsRNA for management of mungbean yellow mosaic virus on blackgram.

MAIN CONCLUSION: Exogenous application of dsRNA molecules targeting MYMV genes offers a promising approach to effectively mitigate yellow mosaic disease in blackgram, demonstrating potential for sustainable plant viral disease management. The exogenous application of double-stranded RNA (dsRNA) molecules to control plant viral diseases is gaining traction due to its advantages over conventional methods, such as target specificity, non-polluting nature, and absence of residue formation. Furthermore, this approach does not involve genome modification. In this study, dsRNA molecules targeting the coat protein gene (dsCP) and replication initiator protein gene (dsRep) of mungbean yellow mosaic virus (MYMV) were synthesised using an in vitro transcription method. To evaluate the effectiveness of dsRNA treatment, blackgram plants exhibiting MYMV symptoms at the first trifoliate stage were subjected to exogenous application of dsRNA. Second, third, and fourth trifoliate leaves, which emerged at 7, 15, and 21 days after dsRNA application, respectively, were monitored for MYMV symptoms. Remarkably, a significant reduction in yellow mosaic disease (YMD) symptoms was observed in the newly emerged trifoliate leaves of MYMV-infected blackgram plants after treatment with dsRNA targeting both gene regions. This reduction was evident as a decrease in the intensity of yellow mosaic coverage on the leaf lamina compared to control. dsCP effectively reduced the MYMV titre in the treated plants for up to 15 days. However, dsRep demonstrated greater efficiency in conferring resistance to MYMV at 15 days post-application. These findings were supported by quantitative real-time PCR analysis, where the observed Ct values for DNA extracted from dsRep-treated plants were significantly higher compared to the Ct values of DNA from dsCP-treated plants at 15 days post-application. Similarly, higher viral copy numbers were observed in dsCP-treated plants 15 days after dsRNA treatment, in contrast to plants treated with dsRep.

Wheat yellow mosaic virus NIb targets TaVTC2 to elicit broad-spectrum pathogen resistance in wheat.

GDP-L-galactose phosphorylase (VTC2) catalyses the conversion of GDP-L-galactose to L-galactose-1-P, a vital step of ascorbic acid (AsA) biosynthesis in plants. AsA is well known for its function in the amelioration of oxidative stress caused by most pathogen infection, but its function against viral infection remains unclear. Here, we have identified a VTC2 gene in wheat named as TaVTC2 and investigated its function in association with the wheat yellow mosaic virus (WYMV) infection. Our results showed that overexpression of TaVTC2 significantly increased viral accumulation, whereas knocking down TaVTC2 inhibited the viral infection in wheat, suggesting a positive regulation on viral infection by TaVTC2. Moreover, less AsA was produced in TaVTC2 knocking down plants (TaVTC2-RNAi) which due to the reduction in TaVTC2 expression and subsequently in TaVTC2 activity, resulting in a reactive oxygen species (ROS) burst in leaves. Furthermore, the enhanced WYMV resistance in TaVTC2-RNAi plants was diminished by exogenously applied AsA. We further demonstrated that WYMV NIb directly bound to TaVTC2 and inhibited TaVTC2 enzymatic activity in vitro. The effect of TaVTC2 on ROS scavenge was suppressed by NIb in a dosage-dependent manner, indicating the ROS scavenging was highly regulated by the interaction of TaVTC2 with NIb. Furthermore, TaVTC2 RNAi plants conferred broad-spectrum disease resistance. Therefore, the data indicate that TaVTC2 recruits WYMV NIb to down-regulate its own enzymatic activity, reducing AsA accumulation to elicit a burst of ROS which confers the resistance to WYMV infection. Thus, a new mechanism of the formation of plant innate immunity was proposed.

Cajanus Scarabaeoides Yellow Mosaic Virus, a New Bipartite Begomovirus Causing Yellow Mosaic Disease in Cajanus scarabaeoides in India.

Yellow mosaic disease of Cajanus scarabaeoides (L.) Thouars (CsYMD) was observed in up to 46% of C. scarabaeoides plants in the mungbean, urdbean, and pigeon pea fields from 22 districts of Chhattisgarh State, India, during 2017 to 2019. The symptoms were characterized by yellow mosaic on green leaves and yellow discoloration of leaves in advanced stages of the disease. Severely infected plants showed shortened internodal length and reduced leaf size. CsYMD was transmissible to healthy C. scarabaeoides and C. cajan by whitefly (Bemisia tabaci). The infected plants developed typical yellow mosaic symptoms on their leaves within 16 and 22 days of inoculation, respectively, suggesting a begomovirus etiology. Molecular analysis revealed that this begomovirus has a bipartite genome composed of DNA-A (2,729 nucleotides) and DNA-B (2,630 nucleotides). Sequence and phylogenetic analyses revealed that the nucleotide sequence of the DNA-A component had the highest identity of 81.1% with DNA-A of Rhynchosia yellow mosaic virus (RhYMV; NC_038885), followed by mungbean yellow mosaic virus (MN602427; 75.3%). DNA-B had the highest identity of 74.0% with DNA-B of RhYMV (NC_038886). As per ICTV guidelines, this isolate had <91% nucleotide identity with DNA-A of any of the begomoviruses reported; so, it is proposed as a new begomovirus species, tentatively named C. scarabaeoides yellow mosaic virus (CsYMV). After agroinoculation with DNA-A and DNA-B clones of CsYMV, all Nicotiana benthamiana plants developed leaf curl symptoms along with light yellowing symptoms 8 to 10 days after inoculation (DAI), while ∼60% of the C. scarabaeoides plants developed yellow mosaic symptoms similar to those observed in the field 18 DAI, thus fulfilling Koch's postulates. From these agro-infected C. scarabaeoides plants, CsYMV was transmissible to healthy C. scarabaeoides plants by B. tabaci. Apart from these hosts, CsYMV also infected and caused symptoms in mungbean and pigeon pea.

Experimental host and vector ranges of the emerging maize yellow mosaic polerovirus.

Maize yellow mosaic virus (MaYMV) is an emerging polerovirus that has been detected in maize, other cereal crops and weedy grass species in Asia, Africa, and the Americas. Disease symptoms in maize include prominent leaf tip reddening and stunting. Infection by MaYMV has been reported to reduce plant growth and yields by 10-30% in some instances. In this study, an experimental host range for MaYMV among agronomically important cereal crops and common grasses was established. Additional aphid species were assessed as potential vectors for MaYMV and their transmission efficiencies were determined. Here we report oats, foxtail millet, barley, and rye as new experimental cereal crop hosts of MaYMV in addition to confirming the previously reported hosts of corn, sorghum, wheat, and broom millet. Four of the nine other grass species evaluated were also identified as suitable experimental hosts for MaYMV: ryegrass, switchgrass, green foxtail, and sand love grass. Interestingly, no visible symptoms were present in any of the infected hosts besides the susceptible maize control. Vector range studies identified the greenbug aphid, Schizaphis graminum, as a new vector of MaYMV, though transmission efficiency was lower than the previously reported Rhopalosiphum maidis vector and similar to the other known aphid vector, R. padi. Given MaYMV's global ubiquity, ability to evade detection, and broad host range, further characterization of yield impacts and identification of viable control strategies are desirable.

Characterization of Mungbean yellow mosaic India virus genome with a recombinant DNA-B in Southern Peninsular India.

BACKGROUND: Mungbean yellow mosaic India virus (MYMIV) is a representative of the genus begomovirus/Begomoviridae, which is prevalent in the northern part of Indian subcontinent causing yellow mosaic disease (YMD). This virus is rapidly evolving and breaking the resistance in the advanced lines causing huge economic losses in the pulse production. In this context, the present investigation on characterization of the causal organism of YMD was undertaken METHODS AND RESULTS: A novel recombinant isolate (YMV-BG-BPT) causing YMD was identified from blackgram in Andhra Pradesh, southern peninsular region of India. The association of a bipartite begomovirus with the disease was done by sequence analyses of the cloned full-length genome. The full length genome sequences were submitted in NCBI GenBank with accession numbers MZ235792 (DNA-A) and MZ356197 (DNA-B). The sequence analysis of DNA-A of YMV-BG-BPT showed maximum of 99.12% similarity at nucleotide level with Mungbean yellow mosaic India virus (MYMIV) isolate reported from Tamil Nadu (KC911719), India which is also confirmed by clustering pattern in phylogenic analysis and DNA-B showed 95.79% with Mungbean yellow mosaic virus (MYMV) isolate reported from Tamil Nadu (KP319016) and 95.05% with MYMIV isolate reported from Karnataka (MT027037). The huge variation in DNA-B lead us to suspect a recombination in DNA-B, where a recombination event in the CR, region coding for nuclear shuttle protein and movement protein of DNA B was detected in which MYMV-BG-AP-IND (KF928962) and MYMIV-GG-CH-IND (MN020536) have been identified as major and minor parents, respectively. CONCLUSION: Overall, the present study revealed occurrence of MYMIV with recombinant DNA B component in southern peneinsular India.

In-silico evolutionary analysis of plant-OBERON proteins during compatible MYMV infection in respect of improving host resistance.

Yellow mosaic disease (YMD) of pulses caused by mungbean yellow mosaic virus is a major threat to crop production. An infection that is compatible with regulating and interacting host proteins and the virus causes YMD. Oberon families of proteins OBE1-4 and VIN1-4 are imperative for plants, functions in meristem and vascular development, and were also regulated during compatible disease infection. Furthermore, in-silico expression results suggested the involvement of OBE1 and OBE2 proteins during virus infection of Vigna, Arabidopsis and soybean. Moreover, a common ancestor for the meristem and virus movement related Oberons was inferred through phylogenetic analysis. Protein interaction studies showed three amino acids (Aspartate, glutamate and lysine) in the plant homeodomain (PHD), involved in interaction with the N-terminal region of the virus movement protein and were also conserved in both monocot and dicots. Additionally, major differences in the nuclear localization signal (NLS) showing clade specific conservation and significant variation between dicots and monocots were ascertained in meristem and virus movement related Oberons. Consequently, a combination of PHD, CCD and their interactions with the VPg viral domain increases the susceptibility to YMD. Further, modification in the NLS regions of the viral movement clade Oberons, to knock out allele generation in the OBE1 and OBE2 homologs through genome-editing approaches could be established as alternate strategies for the improvement of host resistance and control yellow mosaic disease in plants, especially in pulse crops.

Molecular epidemiology on seasonal variation of yellow mosaic disease incidence in blackgram (Vigna mungo L. Hepper) with its vector Bemisia tabaci.

The yellow mosaic disease (YMD) of blackgram caused by Mungbean yellow mosaic virus has emerged as a serious threat to grain legume production, especially in Southeastern Asia. Seasonal incidence of YMD with its vector population was assessed in three different agroclimatic zones of Tamil Nadu in India for three consecutive cropping seasons namely, Rabi 2018 (October-December), Summer 2019 (March-May), and Kharif 2019 (June-August) at three different time intervals viz., 20, 40, and 60 days after sowing (DAS). For all three seasons, disease incidence and whitefly count were recorded for a resistant and susceptible variety of blackgram in fields without any vector control intervention. The highest disease incidence (87%) was observed in the Panpozhi location during the summer season followed by Vamban and Coimbatore locations. The whitefly count was made through both visual count and yellow sticky traps. The whitefly population was highest at 20 DAS and decreased with the increasing age of crop for all the three locations assessed. Molecular epidemiology was analyzed by determining latent infection of mungbean yellow mosaic virus (MYMV) using molecular diagnosis. Latent infection was found to be well pronounced in the Coimbatore location during the Kharif season, where the crop was asymptomatic in both the resistant and susceptible varieties for all the three time periods assessed. The latent infection of MYMV observed in Coimbatore and Vamban ranged from 16.6 to 83.3% in both resistant and susceptible varieties for all three seasons. In Panpozhi, the latent infection of MYMV ranged from 16.6 to 66.6% for the susceptible variety (CO-5) for all three seasons observed. However, in the Panpozhi location, the resistant variety (VBN-8) failed to record any latent infection.

Wheat yellow mosaic virus resistant line, 'Kitami-94', developed by introgression of two resistance genes from the cultivar 'Madsen'.

'Kitahonami' is a soft red winter wheat (Triticum aestivum L.) cultivar that has high yield, good agronomic performance and good quality characteristics. It currently accounts for 73% of the wheat cultivation area of Hokkaido the northern island in Japan and 42% of Japan's overall wheat cultivation. However, this cultivar is susceptible to Wheat yellow mosaic virus (WYMV). WYMV has become widespread recently, with serious virus damage reported in Tokachi and Ohotsuku districts, which are the main wheat production areas in Hokkaido. Here, we report a new wheat breeding line 'Kitami-94', which was developed over four years by repeated backcrossing with 'Kitahonami' using DNA markers for WYMV resistance linked to the Qym1 and Qym2 from 'Madsen'. Basic maps of Qym1 and Qym2 were created and used to confirm that 'Kitami-94' reliably carried the two resistance genes. 'Kitami-94' demonstrated WYMV resistance, and had agronomic traits and quality equivalent to 'Kitahonami' except for higher polyphenol oxidase activity and lower thousand grain weight. 'Kitami-94' may be useful for elucidating the mechanism of WYMV resistance in the background of 'Kitahonami', and for developing new cultivars.

First report of zucchini yellow mosaic virus infecting bitter melon (Momordica charantia) in South Korea.

Bitter melon (Momordica charantia L., family Cucurbitaceae) is used in traditional medicine for diabetes, cancer, and inflammation-associated diseases due to bioactive compounds in Asia and tropical Africa (Bortolotti et al. 2019). In July 2021, approximately 10% of bitter melon plants in the field showed symptoms such as mosaic, yellowing, and leaf deformation on the leaves, in Samchcuk, South Korea. Cucumber and zucchini plants growing in the same field exhibited symptoms like those of bitter melon plants (Ali et al. 2012). To investigate the causative virus, leaf dip preparations from three symptomatic bitter melon leaf samples with symptoms were analyzed by transmission electron microscopy (TEM). Potyvirus-like particles (approximately 680-730 nm in length and 11-13 nm in diameter) were observed in all samples. To further identify the causal viral pathogens, leaf extracts from five symptomatic bitter melon plants were tested by DAS-ELISA using specific antibodies (Agdia, Elkhart, IN, USA) against cucumber mosaic virus, zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus, and papaya ring spot virus. Positive controls from commercial kits and negative controls from healthy bitter melon plants were included in ELISA assay. The serological assay revealed that all five symptomatic samples positively reacted with the antiserum against ZYMV, but not for other viruses. Total RNA extracted from the five ELISA-positive samples and two healthy bitter melon plants (as negative controls), using Clear-S Total RNA extraction kit (InVirusTech Co., Gwangju, Korea), was tested by RT-PCR with ZYMV-specific primers as previously described (Cho et al. 2011). All amplicons of the expected size (~822 bp) were individually cloned into the pGEM-T Easy Vector (Promega, Madison, WI), and sequenced in both orientations. Thereafter, all the sequenced clones shared 100% nucleotide identity. The sequence of ZYMV-MC1 isolated from bitter melon was deposited in the GenBank (accession no. LC652434). Pairwise comparison of the nucleotide sequence with that of ZYMV isolates in the GenBank revealed 99% sequence identity with ZYMV-chk (MG020559) from Korea, 98% with ZYMV-14-HY-SCS (KU743321) from China, 97% with ZYMV-Y21 (MW345249) from Turkey, 96% with ZYMV-AUIKTPK (KR261951) from Pakstan. Leaf saps from the ZYMV-positive bitter melon samples, prepared in 10 mM phosphate buffer (pH 7.0), were mechanically inoculated in five young, healthy bitter melon plants to fulfil Koch's postulates. ZYMV-MC1 isolate caused mosaic and leaf deformation on bitter melon plants 10 days post-inoculation. The presence of ZYMV in the symptomatic leaves was confirmed by RT-PCR using the mentioned above primers mentioned above followed by nucleotide sequencing of the amplicons. Several cotton aphids (Aphis gossypii) were observed in the bitter melon field, which indicated that they might transmit the virus from ZYMV-infected cucumber or zucchini plants. ZYMV is one of the economically important viruses of cucurbits worldwide and has been recently reported from various crops as natural hosts, including Chayote (Yoon et al. 2018) and balloon flowers (Kim et al. 2021). To the best of our knowledge, this is the first report of ZYMV naturally infecting bitter melon in South Korea. Further large -scale surveys are required to determine its incidence, yield losses, and management in bitter melon in Korea.

First report of maize yellow mosaic virus (MaYMV) naturally infecting wheat in China.

Maize yellow mosaic virus (MaYMV), a new species in the genus Polerovirus (family Solemoviridae), was reported in maize for the first time in China in 2016 (Chen et al., 2016). Later, MaYMV was found in other gramineous species including sugarcane (Saccharum spp.), itch grass (Rottboellia cochinchinensis), millet (Panicum miliaceum) and sorghum (Sorghum bicolor) in several countries in Asia, Africa, and South America (Yahaya et al. 2017; Lim et al. 2018; Sun et al. 2019; Nithya et al. 2021). Here, we report its presence in cultivated wheat (Triticum aestivum), detected using high-throughput sequencing (HTS). In 2021 in Henan Province, China, wheat plants with virus-like symptoms such as yellowing, stunting, and vein clearing were collected from fields in Luoyang (three plants, cv. Luohan 6), Nanyang (two plants, cv. Xinong 979), and Anyang (one plant, cv. Bainong 207). RNA was extracted from symptomatic leaves of each plant sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). From each sample, 1 µg of RNA was mixed into a single pool to construct an rRNA-depleted RNA-seq library using a TruSeq RNA Sample Prep Kit for sequencing on the HiSeq X-Ten platform as 150-bp paired-end reads. A total of 88,892,804 clean reads were obtained after removing adaptor sequences and low-quality reads. Reads were mapped against the wheat genome database (IWGSC RefSeq v2.1) using the hisat2 v2.0.5 program. Remaining sequences were de novo assembled into contigs with Trinity program. Contigs from barley yellow dwarf virus PAV (BYDV-PAV), and BYDV-GAV were identified using a Blast search of the NCBI nr/nt database, all previously reported in wheat in China. Interestingly, four contigs with high similarity (>95%, at the nucleotide level) to MaYMV were also identified. Using the sequence of MaYMV isolate Yunnan 9 (KU291105) as reference, a total of 1,260 reads from HTS mapped to the virus genome with a coverage of 75.5% (average coverage: 33.5×). For verifying the presence of MaYMV in the source samples, MaYMV-specific primers MV-fw/MV-rev were designed to amplify the 513-bp fragment of the RdRp gene by a reverse transcription-polymerase chain reaction (RT-PCR) using the original total RNA. RT-PCR assay revealed that only 1 of the 6 samples tested positive for MaYMV, while the remaining plants were positive for other viruses (BYDV-PAV and BYDV-GAV that produce similar symptoms; viral-specific primers as previously described [Liu et al., 2020]). A subsequent survey of 17 winter wheat fields in 2021 confirmed that 6 of 286 wheat samples with virus symptoms were infected with MaYMV; 4 positives were from Linfen, Shanxi Province and 1 each from Yuanyang and Anyang, Henan Province. The full genome of wheat-infecting MaYMV isolate Anyang1 was then sequenced using RT-PCR with Sanger sequencing technology; the genomic sequence (5,642 nt) was deposited in GenBank as accession OK331995. BLASTn search showed that the complete genome sequence of this virus is 99.0%, 98.9% and 98.7% identical to isolate SC1 (MK652148), Guizhou1 (KU291107) and Yunnan 11 (KU248489), respectively. Also, the MaYMV isolate Anyang1 obtained in this study clustered with other MaYMV isolates in a phylogenetic analysis based on MaYMV full genomes. To the best of our knowledge, this is the first report of MaYMV in wheat worldwide. The presence of MaYMV in wheat is important because winter wheat could serve as an overwintering reservoir of MaYMV and perpetuate the virus in wheat-maize rotation systems in northern China.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Genomic and Pathogenic Diversity of Barley Yellow Mosaic Virus and Barley Mild Mosaic Virus Isolates in Fields of China and Their Compatibility with Resistance Genes of Cultivated Barley.

Plant viruses transmitted by the soilborne plasmodiophorid Polymyxa graminis constantly threaten global production of cereal crops. Although the yellow mosaic virus disease of barley has been known to be present for a long time in China, the understanding of the diversity of the viral pathogens and their interactions with host resistance remains limited. In this study, we conducted a nationwide survey of P. graminis and the barley yellow mosaic virus (BaYMV) and barley mild mosaic virus (BaMMV) it transmits, followed by genomic and pathogenic diversity analyses of both viruses. BaYMV and BaMMV were found exclusively in the region downstream of the Yangtze River, despite the national distribution of its transmission vector P. graminis. Analysis of the genomic variations of BaYMV and BaMMV revealed an elevated rate of nonsynonymous substitutions in the viral genome-linked protein (VPg), in which most substitutions were located in its interaction surface with the host eukaryotic translation initiation factor 4E (eIF4E). VPg sequence diversity was associated with the divergence in virus pathogenicity that was identified through multiple field trials. The majority of the resistance genes, including the widely applied rym4 and rym5 (alleles of eIF4E), as well as the combination of rym1/11 and rym5, are not sufficient to protect cultivated barley against viruses in China. Collectively, these results provide insights into virulence specificity and interaction mode with host resistance in cultivated barley, which has significant implications in breeding for the broad-spectrum resistance barley varieties.

Identification of novel QTL contributing to barley yellow mosaic resistance in wild barley (Hordeum vulgare spp. spontaneum).

BACKGROUND: Barley yellow mosaic disease (BYMD) caused by Barley yellow mosaic virus (BaYMV) and Barley mild mosaic virus (BaMMV) seriously threatens the production of winter barley. Cultivating and promoting varieties that carry disease-resistant genes is one of the most powerful ways to minimize the disease's effect on yield. However, as the BYMD virus mutates rapidly, resistance conferred by the two cloned R genes to the virus had been overcome by new virus strains. There is an urgent need for novel resistance genes in barley that convey sustainable resistance to newly emerging virus strains causing BYMD. RESULTS: A doubled haploid (DH) population derived from a cross of SRY01 (BYMD resistant wild barley) and Gairdner (BYMD susceptible barley cultivar) was used to explore for QTL of resistance to BYMD in barley. A total of six quantitative trait loci (qRYM-1H, qRYM-2Ha, qRYM-2Hb, qRYM-3H, qRYM-5H, and qRYM-7H) related to BYMD resistance were detected, which were located on chromosomes 1H, 2H, 3H, 5H, and 7H. Both qRYM-1H and qRYM-2Ha were detected in all environments. qRYM-1H was found to be overlapped with rym7, a known R gene to the disease, whereas qRYM-2Ha is a novel QTL on chromosome 2H originated from SRY01, explaining phenotypic variation from 9.8 to 17.8%. The closely linked InDel markers for qRYM-2Ha were developed which could be used for marker-assisted selection in barley breeding. qRYM-2Hb and qRYM-3H were stable QTL for specific resistance to Yancheng and Yangzhou virus strains, respectively. qRYM-5H and qRYM-7H identified in Yangzhou were originated from Gairdner. CONCLUSIONS: Our work is focusing on a virus disease (barley yellow mosaic) of barley. It is the first report on BYMD-resistant QTL from wild barley accessions. One novel major QTL (qRYM-2Ha) for the resistance was detected. The consistently detected new genes will potentially serve as novel sources for achieving pre-breeding barley materials with resistance to BYMD.

Recombinant turnip yellow mosaic virus coat protein as a potential nanocarrier.

AIMS: To display a short peptide (GSRSHHHHHH) at the C-terminal end of turnip yellow mosaic virus coat protein (TYMVc) and to study its assembly into virus-like particles (TYMVcHis6 VLPs). METHODS AND RESULTS: In this study, recombinant TYMVcHis6 expressed in Escherichia coli self-assembled into VLPs of approximately 30-32 nm. SDS-PAGE and Western blot analysis of protein fractions from the immobilized metal affinity chromatography (IMAC) showed that TYMVcHis6 VLPs interacted strongly with nickel ligands in IMAC column, suggesting that the fusion peptide is protruding out from the surface of VLPs. These VLPs are highly stable over a wide pH range from 3·0 to 11·0 at different temperatures. At pH 11·0, specifically, the VLPs remained intact up to 75°C. Additionally, the disassembly and reassembly of TYMVcHis6 VLPs were studied in vitro. Dynamic light scattering and transmission electron microscopy analysis revealed that TYMVcHis6 VLPs were dissociated by 7 mol l-1 urea and 2 mol l-1 guanidine hydrochloride (GdnHCl) without impairing their reassembly property. CONCLUSIONS: A 10-residue peptide was successfully displayed on the surface of TYMVcHis6 VLPs. This chimera demonstrated high stability under extreme thermal conditions with varying pH and was able to dissociate and reassociate into VLPs by chemical denaturants. SIGNIFICANCE AND IMPACT OF THE STUDY: This is the first C-terminally modified TYMVc produced in E. coli. The C-terminal tail which is exposed on the surface can be exploited as a useful site to display multiple copies of functional ligands. The ability of the chimeric VLPs to self-assemble after undergo chemical denaturation indicates its potential role to serve as a nanocarrier for use in targeted drug delivery.

Genetic Variability and Molecular Evolution of Maize Yellow Mosaic Virus Populations from Different Geographic Origins.

Maize yellow mosaic virus (MaYMV) hosted in various gramineous plants was assigned to the genus Polerovirus (family Luteoviridae) in 2018. However, little is known about its genetic diversity and population structure. In this study, 509 sugarcane leaf samples with mosaic symptoms were collected in 2017 to 2019 from eight sugarcane-growing provinces in China. Reverse-transcription PCR results revealed that four positive-sense RNA viruses were found to infect sugarcane, and the incidence of MaYMV among samples from Fujian, Sichuan, and Guangxi Provinces was 52.1, 9.8, and 2.5%, respectively. Based on 82 partial MaYMV sequences and 46 whole-genome sequences from different host plants, phylogenetic analysis revealed that MaYMV populations are very closely associated with their source geographical regions (China, Africa, and South America). Pairwise identity analysis showed significant variability in genome sequences among MaYMV isolates with genomic nucleotide identities of 91.1 to 99.9%. In addition to codon mutations, insertions or deletions also contributed to genetic variability in individual coding regions, especially in the readthrough protein (P3-P5 fusion protein). Low gene flow and significant genetic differentiation of MaYMV were observed among the three geographical populations, suggesting that environmental adaptation is an important evolutionary force that shapes the genetic structure of MaYMV. Genes in the MaYMV genome were subject to strong negative or purification selection during evolution, except for the movement protein (MP), which was under positive selection pressure. This finding suggests that the MP may play an important role in MaYMV evolution. Taken together, our findings provide basic information for the development of an integrated disease management strategy against MaYMV.