Dynamic relationship among extracellular matrix and body wall cells in Hirudo verbana morphogenesis.

A great bulk of recent experimental evidence suggests the key role of the complex crosstalk between the extracellular matrix (ECM) and the cellular component of tissues during morphogenesis and embryogenesis. In particular, remodeling of the ECM and of its physical interactions pattern with surrounding cells represent two crucial processes that might be involved in muscle development. However, little information is available on this topic, especially on invertebrate species. To obtain new insights on how tuning the ECM microenvironment might drive cellular fate during embryonic development, we used the invertebrate medicinal leech Hirudo verbana as a valuable experimental model, due to its simple anatomy and the recapitulation of many aspects of the basic biological processes of vertebrates. Our previous studies on leech post-embryonic development have already shown the pivotal role of ECM changes during the growth of the body wall and the role of Yes-associated protein 1 (YAP1) in mechanotransduction. Here, we suggest that the interactions between stromal cell telocytes and ECM might be crucial in driving the organization of muscle layers during embryogenesis. Furthermore, we propose a possible role of the pleiotropic enzyme HvRNASET2 as a possible modulator of collagen deposition and ECM remodeling not only during regenerative processes (as previously demonstrated) but also in embryogenesis.

Characterization of a Fatty Acid Amide Hydrolase (FAAH) in Hirudo Verbana.

The endocannabinoid system plays a critical role in modulating both peripheral and central nervous system function. Despite being present throughout the animal kingdom, there has been relatively little investigation of the endocannabinoid system beyond traditional animal models. In this study, we report on the identification and characterization of a putative fatty acid amide hydrolase (FAAH) in the medicinal leech, Hirudo verbana. FAAH is the primary enzyme responsible for metabolizing the endocannabinoid signaling molecule arachidonoyl ethanolamide (anandamide or AEA) and therefore plays a critical role in regulating AEA levels in the nervous system. mRNA encoding Hirudo FAAH (HirFAAH) is expressed in the leech central nervous system (CNS) and sequence analysis suggests that this is an orthologue of FAAH-2 observed in vertebrates. Functionally, HirFAAH has serine hydrolase activity based on activity-based protein profiling (ABPP) studies using the fluorophosphonate probe TAMRA-FP. HirFAAH also hydrolyzes arachidonyl 7-amino, 4-methyl coumarin amide (AAMCA), a substrate specific to FAAH. Hydrolase activity during both the ABPP and AAMCA assays was eliminated by a mutation at a conserved catalytic serine. Activity was also blocked by the known FAAH inhibitor, URB597. Treatment of Hirudo ganglia with URB597 potentiated synapses made by the pressure-sensitive mechanosensory neuron (P cell), mimicking the effects of exogenously applied AEA. The Hirudo CNS has been a useful system in which to study properties of endocannabinoid modulation of nociception relevant to vertebrates. Therefore, this characterization of HirFAAH is an important contribution to comparative studies of the endocannabinoid system.

Transgenesis enables mapping of segmental ganglia in the leech Helobdella austinensis.

The analysis of how neural circuits function in individuals and change during evolution is simplified by the existence of neurons identified as homologous within and across species. Invertebrates, including leeches, have been used for these purposes in part because their nervous systems comprise a high proportion of identified neurons, but technical limitations make it challenging to assess the full extent to which assumptions of stereotypy hold true. Here, we introduce Minos plasmid-mediated transgenesis as a tool for introducing transgenes into the embryos of the leech Helobdella austinensis (Spiralia; Lophotrochozoa; Annelida; Clitellata; Hirudinida; Glossiphoniidae). We identified an enhancer driving pan-neuronal expression of markers, including histone2B:mCherry, which allowed us to enumerate neurons in segmental ganglia. Unexpectedly, we found that the segmental ganglia of adult transgenic H. austinensis contain fewer and more variable numbers of neurons than in previously examined leech species.

Biomechanics of transduction by mechanosensory cilia for prey detection in aquatic organisms.

Surface-feeding aquatic animals navigate towards the source of water disturbances and must differentiate prey from other environmental stimuli. Medicinal leeches locate prey, in part, using a distribution of mechanosensory hairs along their body that deflect under fluid flow. Leech's behavioral responses to surface wave temporal frequency are well documented. However, a surface wave's temporal frequency depends on many underlying environmental and fluid properties that vary substantially in natural habitats (e.g., water depth, temperature). The impact of these variables on neural response and behavior is unknown. Here, we developed a physics-based leech mechanosensor model to examine the impact of environmental and fluid properties on neural response. Our model used the physical properties of a leech cilium and was verified against existing behavioral and electrophysiological data. The model's peak response occurred with waves where the effects of gravity and surface tension were nearly equal (i.e., the phase velocity minimum). This suggests that preferred stimuli are related to the interaction between fundamental properties of the surrounding medium and the mechanical properties of the sensor. This interaction likely tunes the sensor to detect the nondispersive components of the signal, filtering out irrelevant ambient stimuli, and may be a general property of cilia across the animal kingdom.

Molecular based identification and phylogenetic relationship of the leech Hirudinaria manillensis from India by using mitochondrial cytochrome c oxidase subunit I gene.

BACKGROUND: A molecular approach for the identification of unknown species by the using mitochondrial cox1 gene is an effective and reliable as compared with morphological-based identification. Hirudinaria manillensis referred to as Asian Buffalo Leech, is found in South Asia and traditionally used as medicine owing to its medicinal properties. METHODS AND RESULTS: The study aimed to isolate and identify the leech species using cox1 gene sequencing and their phylogenetic relationships. The nucleotide sequences of cytochrome c oxidase subunit I (cox1) mitochondrial genes were analyzed for species identification and the phylogenetic relationship of crucial therapeutic leech Hirudinaria manillensis. The isolated DNA from the leech sample was amplified with cox1 gene-specific primers. BLAST results with the H. manillensis sequence showed 89.24% homology with H. manillensis and phylogenetic tree analysis revealed the genetic relationship with other GenBank submitted sequences. CONCLUSION: The present study concluded that the cox1 gene could be an effective way to identify the leech H. manillensis and provided sufficient phylogenetic information to distinguish H. manillensis indicating a significant mtDNA-based approach to species identification.

Morphological data and DNA barcoding reveal the presence of the alien freshwater leech Helobdella octatestisaca (Hirudinida: Glossiphoniformes) in North Africa (Tunisia).

BACKGROUND: We hereby report the first occurrence of Helobdella octatestisaca in North Africa, specifically in Tunisia, as a likely introduced species from the Neotropical Region. Historically, leeches bearing a prominent chitinous scute on their dorsal surface were commonly diagnosed as H. stagnalis. Most probably, H. octatestisaca had previously been misidentified as H. stagnalis in Tunisia. METHODS AND RESULTS: The identification was primarily based on morphological evidence, supplemented by genetic data obtained from COI DNA barcoding. The morphology of the examined specimens was consistent with the original species description, notably characterized by the presence of four pairs of testisacs. To support our findings, we conducted a phylogenetic analysis using the Maximum Likelihood method based on COI alignment constructed with the newly obtained sequence from Tunisian specimens and complete or nearly complete 'Folmer fragment' sequences of congeners sourced from the GenBank database. CONCLUSIONS: This study highlights the first identification of H. octatestisaca in North Africa and suggests that previous records of H. stagnalis in Tunisia likely misidentified this species.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Pathogenicity associated with an infestation of the marine leech parasite Pterobdella arugamensis in farmed fish.

The marine leech Pterobdella arugamensis is a hematophagous parasite, and the extent of injury to the host largely depends on the number of attached leeches. This study aimed to assess the pathogenicity of marine leeches in Asian seabass (Lates calcarifer) and tiger grouper (Epinephelus fuscoguttatus) fingerlings under laboratory conditions. Five groups of healthy Asian seabass and tiger grouper were exposed to varying numbers of marine leeches (0, 1, 10, 30, or 70 per fish) for 7 d. Infested Asian seabass and tiger grouper both showed pathological changes even with only 1 leech, manifesting as clinical signs like haemorrhages. The cumulative mortality at 7 d post-exposure (dpe) was 11 or 33% for Asian seabass infested with 1 or 10 marine leeches, respectively. Fish with 30 or 70 marine leeches showed higher rates of mortality (56%). A similar trend was seen in tiger grouper, with mortality rates reaching 78% in fish with 30 or 70 marine leeches, and 56 or 33% in fish with 10 leeches or 1 leech, respectively. Factorial analysis of mortality after 7 dpe between both species showed significant differences (2-way ANOVA p = 0.001) when exposed to varying numbers of marine leeches. The haematocrit values differed significantly between Asian seabass or tiger grouper infested with either 0 or 1 marine leech and those infested with 10, 30, or 70 marine leeches (1-way ANOVA, p = 0.0001). This suggests that marine leech infestation has a measurable impact on both species. Consequently, fish farmers should promptly address leech infestation upon discovery in their cages.

Species-specific oxylipins and the effects of ontogeny and predation on their emission from freshwater snails.

Chemical cues play important roles in mediating ecological interactions. Oxylipins, oxygenated metabolites of fatty acids, are one signalling molecule type that influences the physiology and function of species, suggesting their broader significance in chemical communication within aquatic systems. Yet, our current understanding of their function is restricted taxonomically and contextually making it difficult to infer their ecological significance. Snails and leeches are ubiquitous in freshwater ecosystems worldwide, yet little is known about their oxylipin profiles and the factors that cause their profiles to change. As snails and leeches differ taxonomically and represent different trophic groups, we postulated oxylipin profile differences. For snails, we hypothesized that ontogeny (non-reproductive vs reproductive) and predation (non-infested vs leech-infested) would affect oxylipin profiles. Oxylipins were characterized from water conditioned with the snail Planorbella duryi and leech Helobdella lineata, and included three treatment types (snails, leeches, and leech-infested snails) with the snails consisting of three size classes: small (5-6 mm, non-reproductive) and medium and large (13-14 and 19-20 mm, reproductive). The two species differed in the composition of their oxylipin profiles both in diversity and amounts. Further, ontogeny and predation affected the diversity of oxylipins emitted by snails. Our experimental profiles of oxylipins show that chemical cues within freshwater systems vary depending upon the species emitting the signals, the developmental stage of the species, as well as from ecological interactions such as predation. We also identified some candidates, like 9-HETE and PGE2, that could be explored more directly for their physiological and ecological roles in freshwater systems.

Unoculubranchiobdella sp. (Hirudinea: Ozobranchidae) as a vector for Haemogregarina spp. in freshwater turtles from Brazil.

Species of Haemogregarina are blood parasites known to parasitise vertebrate hosts, including fishes (Haemogregarina sensu lato) and freshwater turtles (Haemogregarina sensu stricto). Their vectors, include gnathiid isopods and leeches, respectively. In turtles, Haemogregarina balli has the best-characterized life cycle in the genus. However, no studies in Brazil have suggested a possible vector for any species of Haemogregarina from freshwater turtles. Therefore, in the present study, we provide insights into a leech vector based on specimens found feeding on two species of freshwater turtles, Podocnemis unifilis and Podocnemis expansa, using morphological and molecular data. In 2017 and 2019, freshwater turtles were collected in Goiás State, Brazil. Hosts were inspected for ectoparasites and leeches were collected from two specimens of P. expansa and nine specimens of P. unifilis. Leeches were subsequently identified as members of the genus Unoculubranchiobdella. Leech histological slides revealed haemogregarine-like structures, similar to post-sporogonic merogony, found near the gills and within the posterior sucker. Molecular analysis of the haemeogregarines resulted in the identification of three species of Haemogregarina: Haemogregarina embaubali, Haemogregarina goianensis, and Haemogregarina brasiliana. Therefore, our findings, based on morphology and DNA data suggest leeches of the genus Unoculubranchiondella as vectors for at least three species of Haemogregarina from Brazilian turtles.

Not that many leech species after all: Myzobdella lugubris and Myzobdella patzcuarensis (Annelida: Hirudinida) are the same species.

The genus Myzobdella groups five species of leeches parasites of fishes mainly of freshwater but with tolerance to brackish waters. Native distribution of these species includes the New World from North to South America. Myzobdella lugubris Leidy, 1851, the type species of the genus, was briefly described based on specimens from the USA, but subsequently their morphology, known distribution and host range were expanded; however, less is known about the other four species of the genus. As part of a survey focusing on characterizing the diversity of leeches from Mexico, specimens of Myzobdella patzcuarensis (Caballero, 1940), from the type locality of the species were included for the first time in a phylogenetic study. In addition, specimens assigned to Myzobdella from the southeast of Mexico as well as from Nicaragua, were also included. In the resulting phylogenetic tree, our newly generated sequences were found nested in the same clade that M. lugubris; with unresolved relationships and relatively low genetic divergence, suggesting conspecificity. In addition, the internal morphology of the specimens of Myzobdella from Mexico is consistent with the description of M. lugubris. Our morphological examination reveals high degrees of variability in the external pigmentation of the specimens. Based on our results we formally synonymize M. patzcuarensis under M. lugubris.

A high-altitude population of Hyperboreomyzon polaris (Hirudinea: Glossiphoniidae) in Altai Mountains, South Siberia, Russia.

Hyperboreomyzon polaris Bolotov, Eliseeva, Klass & Kondakov, 2022 (Hirudinea: Glossiphoniidae) is an enigmatic freshwater leech that was recently described based on three specimens from two remote regions of the Eurasian Arctic, that is, the Kolguev Island and Putorana Plateau, Russia. Later on, misidentified historical samples of this species were discovered in the Hirudinea collection of Zoological Institute of the Russian Academy of Sciences (St. Petersburg, Russia). These samples were collected by Pavel G. Ignatov, a prominent Russian geographer and traveler, from a remote high-altitude area of the Altai Mountains (South Siberia) in 1901. To collect new samples from this population, we organized a field expedition to the same area (Lake Dzhulukul) in 2023. Molecular genetic data (COI and 18S rRNA) obtained from newly collected specimens revealed that they belong to H. polaris. Hence, this leech could be considered an Arctic-alpine species, the disjunctive range of which covers Arctic areas of Eurasia and Central Asian (South Siberian) mountains. We describe and illustrate living individuals of H. polaris for the first time, update its morphological diagnosis, present a life cycle reconstruction based on the frequency of four size classes in available samples. It is shown that this species prefers small lentic water bodies such as small lakes and lakelets. The crop content of a well-fed specimen from Altai contains DNA of the northern pintail Anas acuta Linnaeus (Aves: Anatidae), indicating that H. polaris feeds on blood of waterfowl. Our results indicate that Hyperboreomyzon may be considered a species adapted to cold high-latitude areas and mountain refugia.

Division of developmental phases of freshwater leech Whitmania pigra and key genes related to neurogenesis revealed by whole genome and transcriptome analysis.

The freshwater leech Whitmania pigra (W. pigra) Whitman (Annelida phylum) is a model organism for neurodevelopmental studies. However, molecular biology research on its embryonic development is still scarce. Here, we described a series of developmental stages of the W. pigra embryos and defined five broad stages of embryogenesis: cleavage stages, blastocyst stage, gastrula stage, organogenesis and refinement, juvenile. We obtained a total of 239.64 Gb transcriptome data of eight representative developmental phases of embryos (from blastocyst stage to maturity), which was then assembled into 21,482 unigenes according to our reference genome sequenced by single-molecule real-time (SMRT) long-read sequencing. We found 3114 genes differentially expressed during the eight phases with phase-specific expression pattern. Using a comprehensive transcriptome dataset, we demonstrated that 57, 49 and 77 DEGs were respectively related to morphogenesis, signal pathways and neurogenesis. 49 DEGs related to signal pathways included 30 wnt genes, 14 notch genes, and 5 hedgehog genes. In particular, we found a cluster consisting of 7 genes related to signal pathways as well as synapses, which were essential for regulating embryonic development. Eight genes cooperatively participated in regulating neurogenesis. Our results reveal the whole picture of W. pigra development mechanism from the perspective of transcriptome and provide new clues for organogenesis and neurodevelopmental studies of Annelida species.

The three-dimensional conformation and activity of mitochondria in syncytial male germ line-cysts of medicinal leeches.

We studied the spatial conformation and activity of mitochondria in the developing syncytial male germline cysts during spermatogenesis of the medicinal leeches using light, fluorescent, transmission electron microscopy, and serial block-face scanning electron microscopy. In cysts with spermatogonia and spermatocytes, mitochondria form networks and are in a dynamic hyperfusion state, while in cysts with spermatids, a single huge mitochondrion is observed. As spermiogenesis progresses, this huge mitochondrion is finally located in the future midpiece. The highest activity, in terms of membrane potential, of the mitochondria in H. medicinalis germline cysts was observed in cysts with spermatocytes; the lowest was in cysts with late elongated spermatids.

Phylogenetic relationships and species delimitation in Haemopis (Annelida: Hirudinea: Haemopidae).

The Holarctic leech genus Haemopis currently includes 11 species, all of which are macrophagous, as opposed to their more infamous bloodfeeding counterparts among hirudiniform leeches. In spite of their ecological importance as fish food and predators of freshwater invertebrates, there is a paucity of data regarding morphology and genetic variation that might guide future identification efforts for members of the genus. The lack of detailed descriptions of distinguishing morphological features, coupled with the absence of a robust phylogenetic hypothesis for the genus, have conspired to prevent meaningful inferences on the natural history of the group. In an attempt to remedy this, we present new genetic (using COI, 12S rDNA, 28S rDNA and 18S rDNA) data for the majority of the known species diversity within the genus in order to both infer a phylogenetic hypothesis and to introduce authoritative DNA barcodes for the newly collected species. The potential of these barcodes is increased through rigorous morphological investigations of the specimens, with comparisons to the original literature. Our resulting phylogenetic hypothesis is agnostic as to the geographic origin of the genus, with equal probability afforded to both a Nearctic and Palearctic origin. Beyond this, we show that there is a strong tendency towards a barcoding gap within the genus, but that a distinct gap is lacking due to the relatively high genetic variation found within H. marmorata. Taken together, our results shed light on species delimitation within, and evolutionary history of, this often-neglected group of leeches.

Repetitive nociceptive stimulation elicits complex behavioral changes in Hirudo: evidence of arousal and motivational adaptations.

Appropriate responses to real or potential damaging stimuli to the body (nociception) are critical to an animal's short- and long-term survival. The initial goal of this study was to examine habituation of withdrawal reflexes (whole-body and local shortening) to repeated mechanical nociceptive stimuli (needle pokes) in the medicinal leech, Hirudo verbana, and assess whether injury altered habituation to these nociceptive stimuli. While repeated needle pokes did reduce shortening in H. verbana, a second set of behavior changes was observed. Specifically, animals began to evade subsequent stimuli by either hiding their posterior sucker underneath adjacent body segments or engaging in locomotion (crawling). Animals differed in terms of how quickly they adopted evasion behaviors during repeated stimulation, exhibiting a multi-modal distribution for early, intermediate and late evaders. Prior injury had a profound effect on this transition, decreasing the time frame in which animals began to carry out evasion and increasing the magnitude of these evasion behaviors (more locomotory evasion). The data indicate the presence in Hirudo of a complex and adaptive defensive arousal process to avoid noxious stimuli that is influenced by differences in internal states, prior experience with injury of the stimulated areas, and possibly learning-based processes.

Biocontrol of snail-borne parasites with the glossiphoniid leech, Helobdella austinensis.

Parasites in which freshwater snails are intermediate hosts pose a serious threat to human health worldwide. We show here that freshwater snails can potentially be controlled by leech predation; in principle, this approach could significantly reduce snail-borne parasitic diseases (SBPDs). Specifically, glossiphoniid leeches, Helobdella austinensis and congener species, consume freshwater snails indiscriminately, while other common leeches do not. A single adult H. austenensis, for example, can consume up to its weight in snails, e.g. Physella acuta, per day. Our predator-prey models suggest that snail populations could be eliminated in relatively short time periods (approximately six months) using a leech biocontrol approach. This could have considerable impact on global SBPDs by breaking the intermediate host life cycle.

Placobdella nabeulensis sp. nov. (Hirudinea: Glossiphoniidae), a new glossiphoniiform leech from Palearctic North Africa.

BACKGROUND: Herein, we describe a new species of turtle blood-feeding leech, Placobdella nabeulensis sp. nov. from Palearctic North Africa (Tunisia and Algeria). The new species is described based on detailed morphological analyses using light and scanning electron microscopes. RESULTS: Apart from the detailed morphology of the atrium, morphological features alone do not sufficiently separate the species from congeners due to the absence of distinct diagnostic characters. Therefore, we turned to molecular data to better distinguish this new species from other members of the genus and establish a basis for its genetic separation. Four DNA fragments were successfully amplified, including mitochondrial COI and 12S rDNA, as well as nuclear 28S rDNA and histone H3. We then provided the molecular descriptor of the taxon, based on redundant diagnostic nucleotide combinations in DNA sequence alignment within the Folmer region. Results of the phylogenetic analysis and species delimitation methods (ABGD, ASAP, and bPTP) based on the COI locus support the species rank of the Tunisian-Algerian Placobdella. CONCLUSIONS: The new species is most closely related to the European species Placobdella costata (Fr. Müller, 1846) and the present study indicates that Placobdella nabeulensis sp. nov. has likely been confused with the European counterpart in several previous studies. This article is registered at www.zoobank.org under urn:lsid:zoobank.org:pub:4A4B9C1D-2556-430F-8E4B-0CE99F2012F5.

Characterization of the natural peptidome of four leeches by integrated proteogenomics and pseudotargeted peptidomics.

Animal-derived drugs are an indispensable part of folk medicine worldwide. However, their chemical constituents are poorly approached, which leads to the low level of the quality standard system of animal-derived drugs and further causes a chaotic market. Natural peptides are ubiquitous throughout the organism, especially in animal-derived drugs. Thus, in this study, we used multi-source leeches, including Hirudo nipponica (HN), Whitmania pigra (WP), Whitmania acranulata (WA), and Poecilobdella manillensis (PM), as a model. A strategy integrating proteogenomics and novel pseudotargeted peptidomics was developed to characterize the natural peptide phenotype and screen for signature peptides of four leech species. First, natural peptides were sequenced against an in-house annotated protein database of closely related species constructed from RNA-seq data from the Sequence Read Archive (SRA) website, which is an open-sourced public archive resource. Second, a novel pseudotargeted peptidomics integrating peptide ion pair extraction and retention time transfer was established to achieve high coverage and quantitative accuracy of the natural peptides and to screen for signature peptides for species authentication. In all, 2323 natural peptides were identified from four leech species whose databases were poorly annotated. The strategy was shown to significantly improve peptide identification. In addition, 36 of 167 differential peptides screened by pseudotargeted proteomics were identified, and about one-third of them came from the leucine-rich repeat domain (LRR) proteins, which are widely distributed in organisms. Furthermore, six signature peptides were screened with good specificity and stability, and four of them were validated by synthetic standards. Finally, a dynamic multiple reaction monitoring (dMRM) method based on these signature peptides was established and revealed that one-half of the commercial samples and all of the Tongxinluo capsules were derived from WP. All in all, the strategy developed in this study was effective for natural peptide characterization and signature peptide screening, which could also be applied to other animal-derived drugs, especially for modelless species that are less studied in protein database annotation.

A New Species of Branchellion (Hirudinea: Piscicolidae) Parasitizing the Gills of Short-Tail Stingrays (Batoidea: Dasyatidae) from the West Pacific.

A new fish leech, Branchellion brevicaudatae sp. n., is described based on specimens parasitizing the gills of the short-tail stingray, Bathytoshia brevicaudata (Hutton, 1875), collected from Japanese waters. The new species can be distinguished from other congeners by having: i) pulsating vesicles emerging from posterior base of branchiae, one pair per somite; ii) dorsal white spots, not arranged in longitudinal row; and iii) blackish body. A phylogenetic tree based on partial sequences of the mitochondrial cytochrome c oxidase subunit I gene from the new species and other piscicolid worms showed that the new species is sister to Branchellion torpedinis Savigny, 1822. This is the first record of Branchellion Savigny, 1822 from Japanese waters.