Influence of Mitochondrial Genetics on the Mitochondrial Toxicity of Linezolid in Blood Cells and Skin Nerve Fibers.

The antibiotic linezolid is a ribosomal inhibitor with excellent efficacy. Although the administration period has been reduced to 28 days, side effects, usually of hematologic or neuropathic origin, are still reported due to secondary inhibition of mitochondrial protein synthesis. Susceptibility to linezolid toxicity remains unknown. Therefore, the objective of this study was to gain an understanding of clinical heterogeneity in response to identical linezolid exposures through exhaustive examination of the molecular basis of tissue-dependent mitotoxicity, consequent cell dysfunction, and the association of mitochondrial genetics with adverse effects of linezolid administered for the recommended period. Peripheral blood mononuclear cells (PBMC) and skin nerve fibers from 19 and 6 patients, respectively, were evaluated before and after a 28-day linezolid treatment in order to assess toxic effects on mitochondria and cells. Mitochondrial DNA haplotypes and single nucleotide polymorphisms (SNPs) in ribosomal sequences where linezolid binds to mitochondrial ribosomes were also analyzed to investigate their genetic contributions. We found that linezolid reduced mitochondrial protein levels, complex IV activity, and mitochondrial mass in PBMC and was associated with a trend toward an increase in the rate of apoptosis. In skin tissue, mitochondrial mass increased within nerve fibers, accompanied by subclinical axonal swelling. Mitochondrial haplogroup U, mutations in 12S rRNA, and the m.2706A→G, m.3197T→C, and m.3010G→A polymorphisms in 16S rRNA showed a trend toward an association with increased mitochondrial and clinical adverse effects. We conclude that even when linezolid is administered for a shorter time than formerly, adverse effects are reported by 63% of patients. Linezolid exerts tissue-dependent mitotoxicity that is responsible for downstream cellular consequences (blood cell death and nerve fiber swelling), leading to adverse hematologic and peripheral nervous side effects. Multicentric studies should confirm genetic susceptibility in larger cohorts.

Effect of an ambulatory diagnostic and treatment programme in patients with sleep apnoea.

The aim of this study to evaluate the efficacy of a home-based programme on clinical response, continuous positive airway pressure (CPAP) compliance and cost in a population of high pre-test probability of suffering obstructive sleep apnoea syndrome (OSAS). Patients were randomised into the following three groups. Group A: home respiratory polygraphy (RP) and home follow-up; group B: hospital polysomnography and hospital follow-up; and group C: home RP and hospital follow-up. Evaluation during 6 months included Epworth Sleepiness Scale (ESS), Functional Outcomes Sleep Questionnaire (FOSQ), and daily activity and symptom questionnaires. Compliance was assessed by memory cards (group A) and using an hourly counter (groups B and C). 66 patients were included (22 per branch), 83% were males, aged mean±sd 52±10 yrs, body mass index 34±7kg·m(-2), apnoea/hypopnoea index 43±20 h(-1), CPAP pressure 8±2 cmH(2)O, with no between-group differences. Clinical response showed an ESS of mean±sd 15±3 to 6±4, a FOSQ of 16±3 to 18±2, symptoms of 43±7 to 25±7, and activity of 37±11 to 25±8. At the end of the study, compliance was: group A 73%, group B 68% and group C 57%. The cost per patient was: group A €590±43, group B €894±11 and group C €644±93 (p<0.001). In conclusion, patients with a high initial probability of having OSAS can be diagnosed and treated in a home setting, with a high level of CPAP compliance and lower cost than using either a hospital-based approach or home RP/hospital follow-up.

Low aerobic capacity in McArdle disease: A role for mitochondrial network impairment?

BACKGROUND: McArdle disease is caused by myophosphorylase deficiency and results in complete inability for muscle glycogen breakdown. A hallmark of this condition is muscle oxidation impairment (e.g., low peak oxygen uptake (VO2peak)), a phenomenon traditionally attributed to reduced glycolytic flux and Krebs cycle anaplerosis. Here we hypothesized an additional role for muscle mitochondrial network alterations associated with massive intracellular glycogen accumulation. METHODS: We analyzed in depth mitochondrial characteristics-content, biogenesis, ultrastructure-and network integrity in skeletal-muscle from McArdle/control mice and two patients. We also determined VO2peak in patients (both sexes, N = 145) and healthy controls (N = 133). RESULTS: Besides corroborating very poor VO2peak values in patients and impairment in muscle glycolytic flux, we found that, in McArdle muscle: (a) damaged fibers are likely those with a higher mitochondrial and glycogen content, which show major disruption of the three main cytoskeleton components-actin microfilaments, microtubules and intermediate filaments-thereby contributing to mitochondrial network disruption in skeletal muscle fibers; (b) there was an altered subcellular localization of mitochondrial fission/fusion proteins and of the sarcoplasmic reticulum protein calsequestrin-with subsequent alteration in mitochondrial dynamics/function; impairment in mitochondrial content/biogenesis; and (c) several OXPHOS-related complex proteins/activities were also affected. CONCLUSIONS: In McArdle disease, severe muscle oxidative capacity impairment could also be explained by a disruption of the mitochondrial network, at least in those fibers with a higher capacity for glycogen accumulation. Our findings might pave the way for future research addressing the potential involvement of mitochondrial network alterations in the pathophysiology of other glycogenoses.

Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE.

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the TYMP gene, which encodes thymidine phosphorylase (TP). TP dysfunction results in systemic thymidine (dThd) and deoxyuridine (dUrd) overload, which selectively impair mitochondrial DNA replication. Allogeneic hematopoietic transplantation has been used to treat MNGIE patients; however, this approach has serious adverse effects, including the toxicity of myeloablative conditioning, graft rejection and graft-versus-host disease. With the aim of testing the feasibility of gene therapy for MNGIE, we transduced TP-deficient B-lymphoblastoid cells from two MNGIE patients, with lentiviral vectors carrying a functional copy of the human TYMP DNA coding sequence. This restored TP activity in the cells, which reduced the excretion of dThd and dUrd and their concentrations when added in excess. Additionally, lentiviral-mediated hematopoietic gene therapy was used in partially myeloablated double Tymp/Upp1 knockout mice. In spite of the relatively low levels of molecular chimerism achieved, high levels of TP activity were observed in the peripheral blood of the transplanted mice, with a concomitant reduction of nucleoside concentrations. Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future.

NARP syndrome in a patient harbouring an insertion in the MT-ATP6 gene that results in a truncated protein.

BACKGROUND: Neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP) syndrome have been associated to m.8993T>G/C mutations in the subunit 6 of the ATP synthase (p.MT-ATP6). METHODS: We have performed a mutational screening of the mitochondrial DNA gene encoding for this protein in 62 patients with the disease, that do not carry any of the common mutations described to date. RESULTS: We report clinical and molecular data in one patient who harbours a de novo insertion in the MT-ATP6 gene that results in a truncated subunit. The mutation was heteroplasmic (85%) in muscle DNA and the BN-PAGE analysis showed a clear decrease in the amount of ATP synthase. CONCLUSION: Molecular analysis of NARP patients cannot be limited to the search of the m.8993T>G/C and either the ATP6 or the whole mtDNA should be sequenced.

Novel mutations in patients with McArdle disease by analysis of skeletal muscle mRNA.

OBJECTIVE: To identify pathogenic mutant alleles of the PYGM gene in "genetic manifesting heterozygous" patients with McArdle disease-that is, those in whom we could only find a sole mutant allele by genomic DNA analysis. METHODS: We studied four unrelated patients. PCR-RFLP, gene sequencing, and muscle cDNA analysis were performed to search for mutations in the PYGM gene. The effects of the mutations were evaluated by in silico analysis, and gene expression was assessed by real-time polymerase chain reaction (PCR). RESULTS: Patient 1 was a compound heterozygous for the p.G205S missense mutation and for a novel "in frame" mutation, p.Q176_M177insVQ, resulting from a retention of six nucleotides from the 3'-end sequence of intron 4. Patient 2 was heterozygous for the common nonsense mutation p.R50X, and for a 1094 bp, c.1969+214_2177+369del mutation, spanning from intron 16 to intron 17 sequences. Furthermore, mRNA expression level was dramatically reduced consistent with nonsense mediated decay. Patient 3 was heterozygous for the p.R50X substitution, and patient 4 was heterozygous for the relatively common private Spanish mutation p.W798R. These two patients harboured a heterozygous exonic synonymous variant, p.K215K. Quantification of gene transcripts in patient 3 revealed a drastic decrease in the relative expression of the gene, which strongly supports the possibility of nonsense mediated decay. CONCLUSIONS: Our results indicate that skeletal muscle cDNA studies in "genetic manifesting heterozygous" patients with McArdle disease are prone to identify their second mutant allele.

McArdle disease: another systemic low-inflammation disorder?

McArdle disease is caused by inherited deficit of human muscle glycogen phosphorylase with subsequent blockade in muscle glycogenolysis. Patients usually experience severe exercise intolerance and 'chronic' skeletal muscle damage. We determined circulating levels of 27 cytokines in a group of 31 adult McArdle patients (15 male 16 female; mean (+/-S.E.M.) age: 39+/-3 years) and 29 healthy sedentary controls (14 male, 15 female) before and after an acute exercise bout involving no muscle damage (cycling). Patients had an ongoing state of muscle breakdown even when following a sedentary lifestyle (serum creatine kinase activity at baseline of 2590+/-461 Ul(-1) vs. 97+/-5 Ul(-1) in controls). Under resting conditions, neutrophil count (+20%) and circulating levels of several cytokines were significantly higher (P

Mitochondrial DNA oxidation and manganese superoxide dismutase activity in peripheral blood mononuclear cells from type 2 diabetic patients.

AIM: To investigate the balance between parameters of oxidative stress and antioxidant defences in the mitochondria of peripheral blood mononuclear cells (PBMCs) of type 2 diabetic patients with late complications. METHODS: Ten type 2 diabetic patients with late diabetic complications and 10 age-matched healthy volunteers (controls) were prospectively recruited. Mitochondrial DNA (mtDNA) oxidative damage and mtDNA content were measured as indices of oxidative stress. Manganese superoxide dismutase (MnSOD) activity has been used as an index of mitochondrial antioxidant defence. Mitochondrial respiratory-chain function (cytochrome C oxidase activity) was also assessed. RESULTS: Mitochondrial DNA (mtDNA) oxidation was significantly higher in the PBMCs of diabetic patients than in control subjects (P<0.0001) and, although mtDNA content was lower in the diabetic group, this was not statistically significant. MnSOD activity was significantly increased in PBMCs of type 2 diabetic patients compared with healthy controls (1366+/-187 versus 686+/-167 U/g of protein; P=0.01), and was related to mtDNA oxidative damage. No differences in mitochondrial respiratory-chain function were found between diabetic patients and controls. CONCLUSION: PMBCs from type 2 diabetic patients with late diabetic complications exhibit high mtDNA oxidative damage. The degree of mtDNA oxidation was associated with an increase in MnSOD as an adaptive response to oxidative stress. The consequences of mtDNA oxidative damage on PBMC function and the progression of diabetic complications remain to be elucidated.

McArdle disease: molecular genetic update.

McArdle disease or Glycogenosis type V is an autosomal recessive metabolic disorder caused by a deficiency of the muscle isoform of glycogen phosphorylase (myophosphorylase, PYGM), the specific skeletal muscle enzyme that initiates glycogen breakdown. Since the first clinical description by Brian McArdle in 1951, several patients have been identified worldwide and significant advances have been made in the study of molecular genetics of the disease. Molecular heterogeneity has been demonstrated by the identification to date of more than 65 mutations in the PYGM gene.

Can patients with McArdle's disease run?

Patients with McArdle's disease commonly adopt a sedentary lifestyle. This sedentary behaviour, however, usually worsens the limited exercise capacity of these patients. Although eccentric muscle work can be associated with rhabdomyolysis, supervised eccentric training with gradually increasing loads has important advantages compared with conventional concentric work, particularly for patients with a poor cardiorespiratory system. We report the beneficial effects (particularly, increased VO(2peak) (from 14.6 to 30.8 ml/kg/min) and increased gross muscle efficiency (from 13.8% to 17.2%)) induced by a supervised aerobic training programme of 7 months duration including 3-4 running sessions (< or =60 min/session) per week in a 38-year-old patient. These preliminary data suggest the potential therapeutic value of this type of exercise in these patients.

Evidence for the presence of 5S rRNA in mammalian mitochondria.

Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified.

[Private mutations in the myophosphorylase gene: the first case in a patient of Latin American descent]. / Mutaciones privadas en el gen de la miofosforilasa: primer caso en un paciente de origen latinoamericano.

INTRODUCTION: McArdle's disease (glycogenoses type V) is a common metabolic myopathy caused by deficient myophosphorylase activity. The disease is due to mutations in the myophosphorylase (PYGM) gene and is present in a large number of countries. CASE REPORT: A 13-year-old male who suffered an episode of muscle pain and offered increased levels of creatinkinase in plasma, myoglobinuria and mild weakness of the proximal muscles, after short but vigorous exercise. The patient was born in Ecuador and was adopted by a Spanish family. The myophosphorylase gene was analysed completely and the patient was found to be a carrier of a missense mutation, a homozygous change where a G is replaced by an A in exon 11, changing a valine for a methionine in codon 456 (V456M). The mutation described above affects an amino acid that is conserved in the enzyme and which was not present in the control population that was studied. CONCLUSIONS: These findings show the presence of McArdle's disease in several ethnic groups and confirm that the ethnic origin of the patient is important when it comes to deciding what mutations should be analysed first in molecular diagnosis studies.

Exercise capacity in a 78 year old patient with McArdle's disease: it is never too late to start exercising.

The case is reported of a 78 year old man with McArdle's disease and a history of treated coronary heart disease. Despite the pre-exercise administration of sucrose allowing the patient to exercise with normal physiological responses, and without typical McArdle's symptoms or biochemical evidence of muscle damage, his exercise capacity was very low (V(O2)peak = 10.7 ml/min/kg), probably attributable to his lifetime of sedentary living. The data suggest that, with pre-exercise sucrose administration, such patients may be candidates for systematic reconditioning, which may improve functional capacity and quality of life.

Mobilisation of mesenchymal cells into blood in response to skeletal muscle injury.

Mesenchymal cells recruited to damaged tissues must circulate through the bloodstream. The absolute numbers of circulating mesenchymal stem cells (cMSCs) in two different models of acute and chronic skeletal muscle injury were determined. cMSCs were present in significantly higher numbers in both models than in healthy controls. These results support the hypothesis that MSCs are mobilised into the bloodstream after skeletal muscle tissue damage. These two models (acute and chronic) would be of value in the search for molecular mediators of mobilisation of MSCs into the circulation.

Genetic and physiologic analysis of the role of uncoupling protein 3 in human energy homeostasis.

By virtue of its potential effects on rates of energy expenditure, uncoupling protein 3 (UCP3) is an obesity candidate gene. We identified nine sequence variants in UCP3, including Val9Met, Val102Ile, Arg282Cys, and a splice site mutation in the intron between exons 6 and 7. The splice mutation results in an inability to synthesize mRNA for the long isoform (UCP3L) of UCP3. Linkage (sib pair), association, and transmission disequilibrium testing studies on 942 African-Americans did not suggest a significant effect of UCP3 on body composition in this group. In vastus lateralis skeletal muscle of individuals homozygous for the splice mutation, no UCP3L mRNA was detectable; the short isoform (UCP3S) was present in an increased amount. In this muscle, we detected no alterations of in vitro mitochondrial coupling activity, mitochondrial respiratory enzyme activity, or systemic oxygen consumption or respiratory quotient at rest or during exercise. These genetic and physiologic data suggest the following possibilities: UCP3S has uncoupling capabilities equivalent to UCP3L; other UCPs may compensate for a deficiency of bioactive UCP3L; UCP3L does not function primarily as a mitochondrial uncoupling protein.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Variable presentation of the clinical phenotype of McArdle's disease in a kindred harbouring a novel compound genotype in the muscle glycogen phosphorylase gene.

We report a Spanish family with muscle glycogen phosphorylase (PYGM) deficiency (McArdle's disease) harbouring a novel compound genotype (A659D/L586P). Four individuals who had the same genotype for PYGM, showed a wide variability in the presentation of the clinical phenotype, including one patient with a restrictive respiratory pattern, which is unusual in McArdle's disease. Moreover, these patients were studied for the insertion/deletion (I/D) trait in the angiotensin converting enzyme (ACE) which has been suggested to be a strong modulator of severity in McArdle's disease. Our results indicate no association of the I/D ACE trait in this family, suggesting that other factors would be more relevant in determining the severity of the clinical presentation.

[Description of a new procedure for fiberoptic bronchoscopy during noninvasive ventilation through a nasal mask in patients with acute respiratory failure]. / Descripción de un nuevo procedimiento para la realización de fibrobroncoscopia durante ventilación no invasiva mediante mascarilla nasal en pacientes con insuficiencia respiratoria aguda.

A new method is described for performing oral fiberoptic bronchoscopy during noninvasive ventilation through the nose. The technique was successfully applied in 2 patients suffering from acute respiratory failure. The bronchoscope was inserted through a glove finger fitted into a mouth guard. The system works as a valve and does not affect performance of the bronchoscopy procedure or the pressures administered during noninvasive ventilation. We conclude that the procedure has potential advantages over bronchoscopy through the nose and face masks or helmets, particularly for the management of secretions or in special clinical circumstances (hemoptysis or presence of foreign bodies). This method can be used to substitute for or complement other bronchoscopy techniques performed with other interfaces.

Myophosphorylase deficiency (glycogenosis type V; McArdle disease).

McArdle disease, one of the most common metabolic causes of exercise intolerance and recurrent myoglobinuria, is due to biochemical defects of the muscle isoform of glycogen phosphorylase. The gene for myophosphorylase (PGYM) is on chromosome 11, and 33 distinct mutations have been identified in patients from all over the world. In Caucasians, a nonsense mutation in exon 1 (R49X) is common enough to warrant screening of genomic DNA from blood before considering muscle biopsy. Other mutations are prevalent in different ethnic groups or are "private". Mutations are spread throughout the gene and there is no clear genotype:phenotype correlation. High-protein diet and aerobic exercise are beneficial, and gene therapy appears promising.

Mutations in mtDNA: are we scraping the bottom of the barrel?

The small, maternally inherited mtDNA has turned out to be a Pandora's box of pathogenic mutations: 12 years into the era of "mitochondrial medicine," about 100 pathogenic point mutations and innumerable rearrangements have been associated with a bewildering variety of multisystemic as well as tissue-specific human diseases. After reviewing the principles of mitochondrial genetics, we compare and contrast the clinical and pathological features of disorders due to mutations in genes affecting mitochondrial protein synthesis with those of mutations in protein-coding genes. In contrast to the striking progress in our understanding of etiology, pathogenesis is only partially explained by the rules of mitochondrial genetics and remains largely terra incognita. We review recent progress in prenatal diagnosis and epidemiology. Therapy is still woefully inadequate, but a number of promising approaches are being developed.