RESUMEN
A regulatory mechanism for SLC family transporters, critical transporters for sodium and glucose reabsorptions in renal tubule, is incompletely understood. Here, we report an important regulation of SLC family transporter by SETD2, a chromatin remodeling gene whose alterations have been found in a subset of kidney cancers. Kidney-specific inactivation of Setd2 resulted in hypovolemia with excessive urine excretion in mouse and interestingly, RNA-sequencing analysis of Setd2-deficient murine kidney exhibited decreased expressions of SLC family transporters, critical transporters for sodium and glucose reabsorptions in renal tubule. Importantly, inactivation of Setd2 in murine kidney displayed attenuated dapagliflozin-induced diuresis and glucose excretion, further supporting that SETD2 might regulate SLCfamily transporter-mediated sodium and glucose reabsorptions in renal tubule. These data uncover an important regulation of SLC family transporter by SETD2, which may illuminate a crosstalk between metabolism and epigenome in renal tubule.
RESUMEN
BACKGROUND: Birt-Hogg-Dubé (BHD) syndrome is a rare genetic syndrome caused by pathogenic or likely pathogenic germline variants in the FLCN gene. Patients with BHD syndrome have an increased risk of fibrofolliculomas, pulmonary cysts, pneumothorax and renal cell carcinoma. There is debate regarding whether colonic polyps should be added to the criteria. Previous risk estimates have mostly been based on small clinical case series. METHODS: A comprehensive review was conducted to identify studies that had recruited families carrying pathogenic or likely pathogenic variants in FLCN. Pedigree data were requested from these studies and pooled. Segregation analysis was used to estimate the cumulative risk of each manifestation for carriers of FLCN pathogenic variants. RESULTS: Our final dataset contained 204 families that were informative for at least one manifestation of BHD (67 families informative for skin manifestations, 63 for lung, 88 for renal carcinoma and 29 for polyps). By age 70 years, male carriers of the FLCN variant have an estimated 19% (95% CI 12% to 31%) risk of renal tumours, 87% (95% CI 80% to 92%) of lung involvement and 87% (95% CI 78% to 93%) of skin lesions, while female carriers had an estimated 21% (95% CI 13% to 32%) risk of renal tumours, 82% (95% CI 73% to 88%) of lung involvement and 78% (95% CI 67% to 85%) of skin lesions. The cumulative risk of colonic polyps by age 70 years old was 21% (95% CI 8% to 45%) for male carriers and 32% (95% CI 16% to 53%) for female carriers. CONCLUSIONS: These updated penetrance estimates, based on a large number of families, are important for the genetic counselling and clinical management of BHD syndrome.
Asunto(s)
Síndrome de Birt-Hogg-Dubé , Carcinoma de Células Renales , Pólipos del Colon , Neoplasias Renales , Humanos , Masculino , Femenino , Anciano , Síndrome de Birt-Hogg-Dubé/genética , Síndrome de Birt-Hogg-Dubé/patología , Penetrancia , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Neoplasias Renales/epidemiología , Neoplasias Renales/genética , Carcinoma de Células Renales/epidemiología , Carcinoma de Células Renales/genéticaRESUMEN
Multiple lung cysts are one of the major features of Birt-Hogg-Dubé syndrome (BHD), but little is known about their nature and pathogenesis. We report a case of a woman diagnosed with BHD lung cysts who exhibited pulmonary interstitial glycogenosis (PIG), a mesenchymal abnormality hitherto undescribed in this disease, in specimens resected at 14 and 29 years of age. Histopathologically, oval to spindle clear cells were seen in the subepithelial interstitial tissue of septal structures and the walls of the cysts. They had abundant periodic acid-Schiff-positive cytoplasmic glycogen. Immunohistochemically, these cells were positive for a few markers of mesenchymal stem cell-like lineage, including vimentin, CD44, and CD10, and negative for markers of epithelial or specific mesenchymal differentiation; these results were consistent with the reported immunophenotype of PIG cells. These PIG cells were more abundant in her specimen at age 14 years than in the second specimen from adulthood. The present case suggests that BHD lung cysts belong to a group of pulmonary developmental disorders characterized by combined PIG and alveolar simplification/cystic change. Disorders with PIG may persist until adulthood and may be of clinical and pathological significance.
Asunto(s)
Síndrome de Birt-Hogg-Dubé , Quistes , Enfermedad del Almacenamiento de Glucógeno , Enfermedades Pulmonares Intersticiales , Enfermedades Pulmonares , Neumotórax , Humanos , Femenino , Adulto , Adolescente , Síndrome de Birt-Hogg-Dubé/complicaciones , Síndrome de Birt-Hogg-Dubé/genética , Neumotórax/diagnóstico , Neumotórax/etiología , Neumotórax/patología , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Enfermedades Pulmonares/patología , Pulmón/patología , Enfermedades Pulmonares Intersticiales/patología , Quistes/complicaciones , Quistes/genética , Enfermedad del Almacenamiento de Glucógeno/complicaciones , Enfermedad del Almacenamiento de Glucógeno/patologíaRESUMEN
Serous endometrial intraepithelial carcinoma is the precursor of invasive uterine serous carcinoma. Here, we present two cases of serous endometrial intraepithelial carcinoma with omental micrometastasis and discuss their clinical significance. Two menopausal patients with abnormal endometrial biopsy findings underwent hysterectomy and comprehensive surgical staging (bilateral salpingo-oophorectomy, omentectomy, and pelvic and para-aortic lymphadenectomy). Although gross examination failed to detect tumors, the pathological diagnosis was serous endometrial intraepithelial carcinoma. Both patients had omental micrometastasis; they were diagnosed with International Federation of Gynecology and Obstetrics stage IVB disease and received postoperative chemotherapy. One patient died of the carcinoma 9 months after the hysterectomy, and the other had a recurrence of carcinoma 17 months after the end of the initial therapy. The present cases and literature review highlight the importance of meticulous inspection for micrometastasis in the abdominal cavity, including the omentum and peritoneum, for predicting prognosis.
Asunto(s)
Carcinoma in Situ , Cistadenocarcinoma Seroso , Neoplasias Endometriales , Cistadenocarcinoma Seroso/cirugía , Neoplasias Endometriales/diagnóstico , Neoplasias Endometriales/patología , Neoplasias Endometriales/terapia , Femenino , Humanos , Histerectomía , Micrometástasis de Neoplasia , Estadificación de Neoplasias , PronósticoRESUMEN
Birt-Hogg-Dubé (BHD) syndrome is associated with the development of hereditary renal cell carcinoma (RCC) and is caused by a germline mutation in the folliculin gene. Most cases of BHD syndrome-associated RCC (BHD-RCC) are less aggressive than sporadic clear cell RCC and multifocal. Therefore, it is critical to distinguish BHD-RCC from its sporadic counterparts to identify and monitor affected families and to preserve renal function for as long as possible. The World Health Organization/International Society of Urological Pathology consensus classification defined distinct entities for certain hereditary RCC; however, BHD-RCC was not included in this classification. Although the clinical features and molecular mechanisms of BHD-RCC have been investigated intensively over the last two decades, pathologists and urologists occasionally face difficulties in the diagnosis of BHD-RCC that require genetic testing. Affected patients usually have miscellaneous benign disorders that often precede renal carcinogenesis. In the present review, we summarize the current understanding of the histopathological features of BHD-RCC based on our epidemiological studies of Japanese families and a literature review. Pathological diagnostic clues and differential diagnosis of BHD-RCC from other hereditary RCC are also briefly discussed.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/diagnóstico , Síndrome de Birt-Hogg-Dubé/patología , Carcinoma de Células Renales/diagnóstico , Carcinoma de Células Renales/patología , Neoplasias Renales/diagnóstico , Neoplasias Renales/patología , Animales , Diagnóstico Diferencial , HumanosRESUMEN
Birt-Hogg-Dubé (BHD) syndrome is a hereditary kidney cancer syndrome, which predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas and pulmonary cysts. The responsible gene FLCN is a tumor suppressor for kidney cancer, which plays an important role in energy homeostasis through the regulation of mitochondrial oxidative metabolism. However, the process by which FLCN-deficiency leads to renal tumorigenesis is unclear. In order to clarify molecular pathogenesis of BHD-associated kidney cancer, we conducted whole-exome sequencing analysis using next-generation sequencing technology as well as metabolite analysis using liquid chromatography-mass spectrometry and gas chromatography-mass spectrometry. Whole-exome sequencing analysis of BHD-associated kidney cancer revealed that copy number variations of BHD-associated kidney cancer are considerably different from those already reported in sporadic cases. In somatic variant analysis, very few variants were commonly observed in BHD-associated kidney cancer; however, variants in chromatin remodeling genes were frequently observed in BHD-associated kidney cancer (17/29 tumors, 59%). Metabolite analysis of BHD-associated kidney cancer revealed metabolic reprogramming toward upregulated redox regulation which may neutralize reactive oxygen species potentially produced from mitochondria with increased respiratory capacity under FLCN-deficiency. BHD-associated kidney cancer displays unique molecular characteristics that are completely different from sporadic kidney cancer, providing mechanistic insight into tumorigenesis under FLCN-deficiency as well as a foundation for development of novel therapeutics for kidney cancer.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/patología , Ensamble y Desensamble de Cromatina/genética , Neoplasias Renales/genética , Neoplasias Renales/metabolismo , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Síndrome de Birt-Hogg-Dubé/genética , Variaciones en el Número de Copia de ADN , Mutación de Línea Germinal , Humanos , Neoplasias Renales/patología , Proteínas Proto-Oncogénicas/metabolismo , Proteínas Supresoras de Tumor/metabolismo , Secuenciación del ExomaRESUMEN
FLCN is a tumor suppressor gene which controls energy homeostasis through regulation of a variety of metabolic pathways including mitochondrial oxidative metabolism and autophagy. Birt-Hogg-Dubé (BHD) syndrome which is driven by germline alteration of the FLCN gene, predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas, pulmonary cysts and less frequently, salivary gland tumors. Here, we report metabolic roles for FLCN in the salivary gland as well as their clinical relevance. Screening of salivary glands of BHD patients using ultrasonography demonstrated increased cyst formation in the salivary gland. Salivary gland tumors that developed in BHD patients exhibited an upregulated mTOR-S6R pathway as well as increased GPNMB expression, which are characteristics of FLCN-deficient cells. Salivary gland-targeted Flcn knockout mice developed cytoplasmic clear cell formation in ductal cells with increased mitochondrial biogenesis, upregulated mTOR-S6K pathway, upregulated TFE3-GPNMB axis and upregulated lipid metabolism. Proteomic and metabolite analysis using LC/MS and GC/MS revealed that Flcn inactivation in salivary gland triggers metabolic reprogramming towards the pentose phosphate pathway which consequently upregulates nucleotide synthesis and redox regulation, further supporting that Flcn controls metabolic homeostasis in salivary gland. These data uncover important roles for FLCN in salivary gland; metabolic reprogramming under FLCN deficiency might increase nucleotide production which may feed FLCN-deficient salivary gland cells to trigger tumor initiation and progression, providing mechanistic insight into salivary gland tumorigenesis as well as a foundation for development of novel therapeutics for salivary gland tumors.
Asunto(s)
Quistes/metabolismo , Quistes/patología , Nucleótidos/biosíntesis , Proteínas Proto-Oncogénicas/metabolismo , Glándulas Salivales/metabolismo , Glándulas Salivales/patología , Proteínas Supresoras de Tumor/metabolismo , Adulto , Animales , Factores de Transcripción Básicos con Cremalleras de Leucinas y Motivos Hélice-Asa-Hélice/metabolismo , Quistes/diagnóstico por imagen , Femenino , Ontología de Genes , Glucólisis , Humanos , Masculino , Ratones Noqueados , Persona de Mediana Edad , Biogénesis de Organelos , Vía de Pentosa Fosfato , Proteínas Proto-Oncogénicas/deficiencia , Glándulas Salivales/diagnóstico por imagen , Serina-Treonina Quinasas TOR/metabolismo , Proteínas Supresoras de Tumor/deficiencia , Regulación hacia ArribaRESUMEN
Germline H255Y and K508R missense mutations in the folliculin (FLCN) gene have been identified in patients with bilateral multifocal (BMF) kidney tumours and clinical manifestations of Birt-Hogg-Dubé (BHD) syndrome, or with BMF kidney tumours as the only manifestation; however, their impact on FLCN function remains to be determined. In order to determine if FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation leading to pathogenicity, we generated mouse models expressing these mutants using BAC recombineering technology and investigated their ability to rescue the multi-cystic phenotype of Flcn-deficient mouse kidneys. Flcn H255Y mutant transgene expression in kidney-targeted Flcn knockout mice did not rescue the multi-cystic kidney phenotype. However, expression of the Flcn K508R mutant transgene partially, but not completely, abrogated the phenotype. Notably, expression of the Flcn K508R mutant transgene in heterozygous Flcn knockout mice resulted in development of multi-cystic kidneys and cardiac hypertrophy in some mice. These results demonstrate that both FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation, but to different degrees. Based on the phenotypes of our preclinical models, the FLCN H255Y mutant protein has lost it tumour suppressive function leading to the clinical manifestations of BHD, whereas the FLCN K508R mutant protein may have a dominant negative effect on the function of wild-type FLCN in regulating kidney cell proliferation and, therefore, act as an oncoprotein. These findings may provide mechanistic insight into the role of FLCN in regulating kidney cell proliferation and facilitate the development of novel therapeutics for FLCN-deficient kidney cancer.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/genética , Enfermedades Renales Quísticas/genética , Neoplasias Renales/genética , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Animales , Síndrome de Birt-Hogg-Dubé/patología , Cardiomegalia/genética , Cardiomegalia/patología , Proliferación Celular/genética , Modelos Animales de Enfermedad , Regulación Neoplásica de la Expresión Génica , Mutación de Línea Germinal , Humanos , Riñón/patología , Enfermedades Renales Quísticas/patología , Neoplasias Renales/patología , Ratones , Ratones Noqueados , Mutación MissenseRESUMEN
AIMS: Xp11 rearrangement in renal cell carcinoma (RCC) typically involves gene fusion to the gene encoding transcription factor E3 (TFE3), a member of the microphthalmia-associated transcription factor family on chromosome Xp11.2. Dual-colour break-apart fluorescence in-situ hybridisation (FISH) is recommended to confirm histological diagnoses. Recently, RNA-binding motif protein 10 (RBM10), encoded by a gene on chromosome Xp11.3, was identified as a chimeric partner of TFE3; thus, RBM10-TFE3 fusion results from paracentric inversion. RBM10-TFE3 RCC may yield a false-negative result in FISH analysis of TFE3 expression. The aim of the present study was to investigate the clinicopathological features of RBM10-TFE3 RCC. METHODS AND RESULTS: Ten patients with RBM10-TFE3 RCC aged 31-71 years were investigated. Histological analysis, immunostaining, dual-colour break-apart FISH for TFE3, reverse transcription polymerase chain reaction and sequencing analysis were performed. No patient had a history of exposure to chemotherapy. Two of these patients died of RCC, and three were alive but developed metastases. Microscopically, the tumours were composed of a mixed architecture of tubulocystic and papillary patterns with scattered psammoma bodies. The tumours showed strong nuclear immunoreactivity for TFE3. FISH showed consistent closely spaced split signals in the RCCs of four patients, and polysomic signals with occasional closely spaced split signals in the RCCs of six patients. Of the latter six patients, five had renal failure, and four developed tumours in kidneys subjected to haemodialysis. CONCLUSIONS: The present study suggests that the carcinogenesis of RBM10-TFE3 RCC in some, but not all, patients may be associated with chronic kidney disease. The aggressive nature of RBM10-TFE3 RCC should be considered, as five patients experienced metastases.
Asunto(s)
Factores de Transcripción Básicos con Cremalleras de Leucinas y Motivos Hélice-Asa-Hélice/genética , Carcinoma de Células Renales/genética , Neoplasias Renales/genética , Proteínas de Unión al ARN/genética , Adulto , Anciano , Carcinoma de Células Renales/complicaciones , Carcinoma de Células Renales/patología , Inversión Cromosómica , Cromosomas Humanos X , Femenino , Humanos , Hibridación Fluorescente in Situ , Neoplasias Renales/complicaciones , Neoplasias Renales/patología , Masculino , Persona de Mediana Edad , Fusión de Oncogenes , Insuficiencia Renal Crónica/complicaciones , Insuficiencia Renal Crónica/genética , Translocación GenéticaRESUMEN
Birt-Hogg-Dubé (BHD) syndrome is a rare genetic disorder characterized by cutaneous fibrofolliculomas, pulmonary cysts and renal cell carcinomas. Affected individuals inherit germline mutations in the folliculin gene (FLCN). Approximately 150 pathogenic FLCN variants have been identified worldwide. Many Japanese probands of BHD syndrome were first identified by pulmonologists and/or radiologists during treatment of pneumothoraces. Lung specimens obtained through video-assisted thoracoscopic surgery (VATS) have characteristic features unique to BHD syndrome; however, pathologists often miss key findings and diagnose patients with "bullae/blebs". The pleural and subpleural cysts of BHD syndrome-associated lung diseases are often modified by tissue remodeling and can be difficult to distinguish from emphysematous bullae/blebs. Intraparenchymal unruptured cysts tend to retain distinctive features that are different from other cystic lung diseases. Here, we review the clinicopathological findings of BHD syndrome in a Japanese population based on data from 200 probands diagnosed by genetic testing and a total of 520 symptomatic family members identified through BHD-NET Japan (http://www.bhd-net.jp/). Detailed morphology of pulmonary cysts obtained from VATS and autopsied lung specimens are described, and pathological clues for differentiating miscellaneous cystic lung disorders are discussed.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/patología , Carcinoma de Células Renales/patología , Quistes/patología , Enfermedades Pulmonares/patología , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Síndrome de Birt-Hogg-Dubé/genética , Carcinoma de Células Renales/genética , Quistes/genética , Mutación de Línea Germinal , Humanos , Japón , Pulmón/patología , Enfermedades Pulmonares/genética , Piel/patologíaRESUMEN
AIMS: Denosumab, a human monoclonal antibody directed against the receptor activator of nuclear factor-κB ligand (RANKL), is a therapeutic agent for giant cell tumour of bone (GCTB). Although some studies have reported that denosumab shrinks tumours and induces bone formation, the actual effects of RANKL suppression on GCTB remain unclear. A mutation in the H3 histone family member 3A gene (H3F3A) was recently identified as a genetic signature for GCTB. The aim of this study was to investigate the histopathological features and H3F3A mutation status of GCTBs treated with denosumab. METHODS AND RESULTS: Nine biopsy-diagnosed patients with GCTB, who underwent curettage after neoadjuvant denosumab therapy, were reviewed. Immunohistochemistry for NFATc1 (an osteoclast marker), RUNX2 (an osteoblast marker) and histone H3.3 G34W (G34W, a GCTB marker) was performed; furthermore, H3F3A mutation status was examined with direct sequencing. Before therapy, GCTBs comprised NFATc1+ and RUNX2+ cells. All cases were G34W+ and contained H3F3A mutations. After therapy, the osteoclast-like giant cells disappeared. Areas of slender spindle cell proliferation and reticular woven bone that were NFATc1- and RUNX2+ replaced the lesions in various proportions. However, all post-therapy lesions still contained many G34W+ cells and harboured H3F3A mutations. Immunofluorescence double staining revealed that RUNX2+ mononuclear cells coexpressed G34W in pre-therapy and post-therapy lesions. Two patients experienced radiologically detected local recurrence within 2 years. CONCLUSIONS: Denosumab therapy effectively decreases the number of osteoclastic cells in GCTBs. However, the neoplastic cells with H3F3A mutation survive denosumab treatment and undergo dramatic histological changes in response to this agent.
Asunto(s)
Antineoplásicos/uso terapéutico , Neoplasias Óseas , Denosumab/uso terapéutico , Tumor Óseo de Células Gigantes , Histonas/genética , Adolescente , Adulto , Conservadores de la Densidad Ósea/uso terapéutico , Neoplasias Óseas/tratamiento farmacológico , Neoplasias Óseas/genética , Neoplasias Óseas/patología , Análisis Mutacional de ADN , Femenino , Tumor Óseo de Células Gigantes/tratamiento farmacológico , Tumor Óseo de Células Gigantes/genética , Tumor Óseo de Células Gigantes/patología , Humanos , Inmunohistoquímica , Masculino , Persona de Mediana Edad , Osteoclastos/efectos de los fármacos , Estudios RetrospectivosRESUMEN
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.
RESUMEN
Folliculin (FLCN)-interacting proteins 1 and 2 (FNIP1, FNIP2) are homologous binding partners of FLCN, a tumor suppressor for kidney cancer. Recent studies have revealed potential functions for Flcn in kidney; however, kidney-specific functions for Fnip1 and Fnip2 are unknown. Here we demonstrate that Fnip1 and Fnip2 play critical roles in kidney tumor suppression in cooperation with Flcn. We observed no detectable phenotype in Fnip2 knockout mice, whereas Fnip1 deficiency produced phenotypes similar to those seen in Flcn-deficient mice in multiple organs, but not in kidneys. We found that absolute Fnip2 mRNA copy number was low relative to Fnip1 in organs that showed phenotypes under Fnip1 deficiency but was comparable to Fnip1 mRNA copy number in mouse kidney. Strikingly, kidney-targeted Fnip1/Fnip2 double inactivation produced enlarged polycystic kidneys, as was previously reported in Flcn-deficient kidneys. Kidney-specific Flcn inactivation did not further augment kidney size or cystic histology of Fnip1/Fnip2 double-deficient kidneys, suggesting pathways dysregulated in Flcn-deficient kidneys and Fnip1/Fnip2 double-deficient kidneys are convergent. Heterozygous Fnip1/homozygous Fnip2 double-knockout mice developed kidney cancer at 24 mo of age, analogous to the heterozygous Flcn knockout mouse model, further supporting the concept that Fnip1 and Fnip2 are essential for the tumor-suppressive function of Flcn and that kidney tumorigenesis in human Birt-Hogg-Dubé syndrome may be triggered by loss of interactions among Flcn, Fnip1, and Fnip2. Our findings uncover important roles for Fnip1 and Fnip2 in kidney tumor suppression and may provide molecular targets for the development of novel therapeutics for kidney cancer.
Asunto(s)
Proteínas Reguladoras de la Apoptosis/metabolismo , Proteínas Portadoras/metabolismo , Regulación Neoplásica de la Expresión Génica , Neoplasias Renales/metabolismo , Proteínas Proto-Oncogénicas/metabolismo , Proteínas Supresoras de Tumor/metabolismo , Alelos , Animales , Proteínas Reguladoras de la Apoptosis/genética , Síndrome de Birt-Hogg-Dubé/genética , Proteínas Portadoras/genética , Modelos Animales de Enfermedad , Femenino , Riñón/patología , Neoplasias Renales/genética , Neoplasias Renales/patología , Masculino , Ratones , Ratones Endogámicos C57BL , Ratones Noqueados , Fenotipo , Enfermedades Renales Poliquísticas/metabolismo , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genéticaRESUMEN
Hereditary leiomyomatosis and renal cell cancer is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis, and an aggressive type 2 papillary renal cell carcinoma. The disease is caused by a germline mutation in the fumarate hydratase gene. We report a familial hereditary leiomyomatosis and renal cell cancer in two siblings. A 34-year-old woman underwent nephrectomy for treatment of a renal cell carcinoma. The patient's sister had been diagnosed with renal cell carcinoma at 28 years-of-age and died of the disease. Neither sister had apparent skin tumors. Histopathology of the renal cell carcinomas of the siblings showed tubulocystic and papillary architectures with high nuclear grades. Immunostaining showed no fumarate hydratase expression in either tumor. Genomic DNA sequencing of the patient showed a germline mutation in the fumarate hydratase gene (c.675delT). Although there is no epidemiological information on Asian hereditary leiomyomatosis and renal cell cancer, physicians should be aware that typical cutaneous leiomyomatosis might not always be present in patients with hereditary leiomyomatosis and renal cell cancer.
Asunto(s)
Fumarato Hidratasa/genética , Leiomiomatosis/patología , Síndromes Neoplásicos Hereditarios/patología , Neoplasias Cutáneas/patología , Neoplasias Uterinas/patología , Adulto , Femenino , Mutación de Línea Germinal , Humanos , Leiomiomatosis/genética , Leiomiomatosis/cirugía , Síndromes Neoplásicos Hereditarios/genética , Síndromes Neoplásicos Hereditarios/cirugía , Nefrectomía , Análisis de Secuencia de ADN , Hermanos , Neoplasias Cutáneas/genética , Neoplasias Cutáneas/cirugía , Neoplasias Uterinas/genética , Neoplasias Uterinas/cirugíaRESUMEN
Hereditary renal cell carcinomas (RCCs) are life-threatening disorders not only for the patients but also for their relatives. Birt-Hogg-Dubé syndrome (BHD) is an autosomal dominant disorder caused by germline mutations in the folliculin gene (FLCN). The protein product, FLCN, functions as a tumor suppressor, and the affected patients have high risks of developing multiple RCCs. The carcinogenic mechanisms stemming from FLCN dysfunction have been investigated using rodent models and human RCC tissues. However, very limited information has been available about in vitro signaling of human renal cells with genetically mutant FLCN. Herein, we established a new cell line, BHD-F59RSVT, from a BHD patient's chromophobe RCC by transfecting SV40 large T antigen. We investigated FLCN mutations, chromosome profiles, and cytopathologic characteristics of the cell line. BHD-F59RSVT reflected the patient's FLCN germline mutation, a 3-nt deletion in exon 13 (c.1528_1530delGAG). Neither somatic mutation nor loss of heterozygosity of FLCN was detectable. Chromosome 17p11.2 of the FLCN proximal region demonstrated a trimodal pattern. Genome-wide chromosomal analysis revealed a loss of chromosome 16 and mosaic segmental gains in chromosome 7. BHD-F59RSVT cells were positive when immunostained for cytokeratin 7, supporting their origin from distal convoluted tubules. Western blotting analysis demonstrated severely suppressed FLCN expression at the protein level. The collective findings indicate that the established cell line will be suitable for functional analysis of the typical phenotype of BHD-associated RCC with suppressed FLCN expression.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/genética , Carcinoma de Células Renales/genética , Mutación de Línea Germinal , Neoplasias Renales/genética , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Síndrome de Birt-Hogg-Dubé/complicaciones , Carcinoma de Células Renales/complicaciones , Carcinoma de Células Renales/patología , Línea Celular Transformada , Línea Celular Tumoral , Variaciones en el Número de Copia de ADN , Análisis Mutacional de ADN/métodos , Salud de la Familia , Femenino , Humanos , Neoplasias Renales/complicaciones , Neoplasias Renales/patología , Pérdida de Heterocigocidad , Masculino , Persona de Mediana Edad , Linaje , Proteínas Proto-Oncogénicas/metabolismo , Cariotipificación Espectral/métodos , Células Tumorales Cultivadas , Proteínas Supresoras de Tumor/metabolismoRESUMEN
Birt-Hogg-Dubé syndrome is an inherited disorder caused by germline mutations of the folliculin gene (FLCN). The affected patients are prone to developing renal cell carcinomas (RCCs). Most mutant FLCN-associated RCCs (mFLCN-RCCs) are histologically chromophobe RCCs and hybrid oncocytic/chromophobe tumors. It is incompletely understood whether mFLCN-RCCs have different chromosomal abnormalities compared with their sporadic histological counterparts. Herein, we describe somatic mutations of FLCN and DNA-copy number abnormalities using a high-density, whole-genome, single-nucleotide polymorphism array. The histological types included chromophobe RCC (n = 12), hybrid oncocytic/chromophobe tumor (n = 5), and clear-cell RCC (n = 2). Of 19 tumors, 8 had pathological somatic mutations of FLCN. Among 11 mFLCN-RCCs investigated by single-nucleotide polymorphism array, 8 showed balanced genomic profiles, 2 had gains in chromosome 3q, and 1 had gains in chromosomes 1q and 7. All had copious numbers of loss of heterozygosity in a wide range of chromosomes. The common loss-of-heterozygosity regions were chromosomes 3p24, 8q11, 16q11, Xp22-21, Xp11, Xq11, Xq13, and Xq23. Most of the loss of heterozygosity was because of uniparental disomy. Common uniparental disomy patterns in chromophobe RCCs and hybrid oncocytic/chromophobe tumors indicated that these types were relatively similar in cytogenetic events. Two clear-cell RCCs also shared several uniparental disomy regions with chromophobe RCCs and hybrid oncocytic/chromophobe tumors. mFLCN-RCCs may have common therapeutic targets among different histological types.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/genética , Carcinoma de Células Renales/genética , Variaciones en el Número de Copia de ADN/genética , Predisposición Genética a la Enfermedad , Genoma Humano , Neoplasias Renales/genética , Disomía Uniparental/genética , Adulto , Anciano , Síndrome de Birt-Hogg-Dubé/complicaciones , Carcinoma de Células Renales/etiología , Cromosomas Humanos , Femenino , Pruebas Genéticas/métodos , Humanos , Neoplasias Renales/patología , Masculino , Persona de Mediana Edad , Proteínas Proto-Oncogénicas/genética , Proteínas Proto-Oncogénicas/metabolismo , Proteínas Supresoras de Tumor/genética , Proteínas Supresoras de Tumor/metabolismoRESUMEN
The entity of hereditary leiomyomatosis renal cell carcinoma (HLRCC)-associated RCC has been proposed and integrated into the recent International Society of Urologic Pathology (ISUP) of renal tumors. This tumor is characterized by presence of cutaneous and/or uterine leiomyomas and RCC and autosomal dominant hereditary form. Grossly, HLRCC arising in the kidney show the solid tumor with frequent partial cystic area. Microscopically, the tumor typically shows papillary RCC, type 2, with eosinophilic large nucleoli reminiscent of cytomegaloviral inclusion and perinuclear clearing/haloes. Immunohistochemically, tumor cells show the overexpression for 2SC and reduced expression of FH. Germline mutation of fumarate hydratase (FH) gene, the HLRCC responsible gene mapped to chromosome 1q43, has been identified in patients with HLRCC. As the renal cancer in patients with HLRCC generally behave aggressively even in a small size, complete surgical resection and retroperitoneal lymph node resection should be performed promptly when the tumor is discovered. The surveillance of renal tumor in FH gene germline mutation-positive patients should be started from the early age using ultrasound sonography or magnetic resonance imaging.
Asunto(s)
Carcinoma de Células Renales/patología , Neoplasias Renales/patología , Leiomiomatosis/patología , Síndromes Neoplásicos Hereditarios/patología , Neoplasias Cutáneas/patología , Neoplasias Uterinas/patología , Biomarcadores de Tumor/análisis , Biomarcadores de Tumor/genética , Biopsia , Carcinoma de Células Renales/química , Carcinoma de Células Renales/genética , Carcinoma de Células Renales/cirugía , Análisis Mutacional de ADN , Diagnóstico Diferencial , Femenino , Predisposición Genética a la Enfermedad , Humanos , Inmunohistoquímica , Neoplasias Renales/química , Neoplasias Renales/genética , Neoplasias Renales/cirugía , Leiomiomatosis/química , Leiomiomatosis/genética , Leiomiomatosis/cirugía , Masculino , Mutación , Síndromes Neoplásicos Hereditarios/genética , Síndromes Neoplásicos Hereditarios/cirugía , Fenotipo , Valor Predictivo de las Pruebas , Neoplasias Cutáneas/química , Neoplasias Cutáneas/genética , Neoplasias Cutáneas/cirugía , Resultado del Tratamiento , Neoplasias Uterinas/química , Neoplasias Uterinas/genética , Neoplasias Uterinas/cirugíaRESUMEN
Birt-Hogg-Dubé syndrome (BHD) is a rare genetic disorder characterized by fibrofolliculomas, pulmonary cysts and renal cell carcinomas (RCCs). The affected individuals inherit germline mutations in the folliculin gene (FLCN). We investigated the mutation spectrum and clinicopathologic findings of 312 patients from 120 different families (119 Japanese and 1 Taiwanese). A total of 31 different FLCN sequence variants were identified. The majority were c.1285dupC (n = 34), c.1533_1536delGATG (n = 25), and c.1347_1353dupCCACCCT (n = 19). Almost all patients presented with pulmonary cysts. The incidence of RCCs in FLCN mutation carriers over the age of 40 was 34.8% (40/115). Fifty-five RCC lesions were surgically resected; most were either chromophobe RCC (n = 24; 43.6%) or hybrid oncocytic/chromophobe tumors (19; 34.5%). Seventy-six of 156 FLCN mutation carriers (120 probands and 36 sibs, 48.7%) had skin papules; however, cutaneous manifestations were so subtle that only one patient voluntarily consulted dermatologists. Japanese Asian BHD families have three FLCN mutational hotspots. Recurrent episodes of pneumothoraces are the major symptoms suggestive of a BHD diagnosis in our cohort. Characteristic features of lung and kidney lesions may be more informative than fibrofolliculomas as diagnostic criteria for BHD in the Japanese Asian population.
Asunto(s)
Síndrome de Birt-Hogg-Dubé/genética , Carcinoma de Células Renales/genética , Epidemiología Molecular , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Adulto , Anciano , Anciano de 80 o más Años , Síndrome de Birt-Hogg-Dubé/epidemiología , Síndrome de Birt-Hogg-Dubé/fisiopatología , Carcinoma de Células Renales/epidemiología , Carcinoma de Células Renales/fisiopatología , Quistes/fisiopatología , Femenino , Mutación de Línea Germinal , Humanos , Japón/epidemiología , Pulmón/fisiopatología , Masculino , Persona de Mediana Edad , Mutación , Piel/fisiopatologíaRESUMEN
Birt-Hogg-Dubé syndrome is an autosomal dominantly inherited disease that predisposes patients to develop fibrofolliculoma, lung cysts and bilateral multifocal renal tumors, histologically hybrid oncocytic/chromophobe tumors, chromophobe renal cell carcinoma, oncocytoma, papillary renal cell carcinoma and clear cell renal cell carcinoma. The predominant forms of Birt-Hogg-Dubé syndrome-associated renal tumors, hybrid oncocytic/chromophobe tumors and chromophobe renal cell carcinoma are typically less aggressive, and a therapeutic principle for these tumors is a surgical removal with nephron-sparing. The timing of surgery is the most critical element for postoperative renal function, which is one of the important prognostic factors for Birt-Hogg-Dubé syndrome patients. The folliculin gene (FLCN) that is responsible for Birt-Hogg-Dubé syndrome was isolated as a novel tumor suppressor for kidney cancer. Recent studies using murine models for FLCN, a protein encoded by the FLCN gene, and its two binding partners, folliculin-interacting protein 1 (FNIP1) and folliculin-interacting protein 2 (FNIP2), have uncovered important roles for FLCN, FNIP1 and FNIP2 in cell metabolism, which include AMP-activated protein kinase-mediated energy sensing, Ppargc1a-driven mitochondrial oxidative phosphorylation and mTORC1-dependent cell proliferation. Birt-Hogg-Dubé syndrome is a hereditary hamartoma syndrome, which is triggered by metabolic alterations under a functional loss of FLCN/FNIP1/FNIP2 complex, a critical regulator of kidney cell proliferation rate; a mechanistic insight into the FLCN/FNIP1/FNIP2 pathway could provide us a basis for developing new therapeutics for kidney cancer.
Asunto(s)
Síndrome de Birt-Hogg-Dubé , Neoplasias Renales , Proteínas Proto-Oncogénicas/genética , Proteínas Supresoras de Tumor/genética , Animales , Síndrome de Birt-Hogg-Dubé/genética , Síndrome de Birt-Hogg-Dubé/patología , Síndrome de Birt-Hogg-Dubé/terapia , Proteínas Portadoras/metabolismo , Técnicas de Inactivación de Genes , Humanos , Neoplasias Renales/genética , Neoplasias Renales/patología , Neoplasias Renales/terapia , Diana Mecanicista del Complejo 1 de la Rapamicina , Ratones , Complejos Multiproteicos/metabolismo , Mutación , Neoplasias Experimentales/genética , Neoplasias Experimentales/patología , Neoplasias Experimentales/terapia , Nefrectomía , Proteínas Proto-Oncogénicas/metabolismo , Ratas , Sirolimus/administración & dosificación , Sirolimus/uso terapéutico , Serina-Treonina Quinasas TOR/metabolismo , Proteínas Supresoras de Tumor/metabolismoRESUMEN
A 70-year-old man with left abdominal pain was referred to our hospital, and was diagnosed with type 1 advanced gastric cancer with lymph node metastasis. Neoadjuvant chemotherapy(NAC)with docetaxel and S-1 combination was administered. After 2 courses of chemotherapy, total gastrectomy with D2 lymph node dissection, splenectomy, and cholecystectomy were performed. Pathologically, viable cancer cells were not evident in the primary lesion and lymph nodes. The pathological response of NAC was judged to be Grade 3. On immunohistochemical analysis of the biopsy specimens obtained before treatment, the cancer cells were positive for class III b-tubulin and negative for TS, DPD, and ERCC1. The anti-tumor effect of S-1 may have led to the pCR.