Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 85
Filtrar
Más filtros

Tipo del documento
Intervalo de año de publicación
1.
Eur J Clin Invest ; 54(2): e14101, 2024 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-37795744

RESUMEN

BACKGROUND AND AIMS: We aimed to assess the associations of exposure to air pollutants and standard and advanced lipoprotein measures, in a nationwide sample representative of the adult population of Spain. METHODS: We included 4647 adults (>18 years), participants in the national, cross-sectional, population-based di@bet.es study, conducted in 2008-2010. Standard lipid measurements were analysed on an Architect C8000 Analyzer (Abbott Laboratories SA). Lipoprotein analysis was made by an advanced 1 H-NMR lipoprotein test (Liposcale®). Participants were assigned air pollution concentrations for particulate matter <10 µm (PM10 ), <2.5 µm (PM2.5 ) and nitrogen dioxide (NO2 ), corresponding to the health examination year, obtained by modelling combined with measurements taken at air quality stations (CHIMERE chemistry-transport model). RESULTS: In multivariate linear regression models, each IQR increase in PM10 , PM2.5 and NO2 was associated with 3.3%, 3.3% and 3% lower levels of HDL-c and 1.3%, 1.4% and 1.1% lower HDL particle (HDL-p) concentrations (p < .001 for all associations). In multivariate logistic regression, there was a significant association between PM10 , PM2.5 and NO2 concentrations and the odds of presenting low HDL-c (<40 mg/dL), low HDL-p (

Asunto(s)
Contaminantes Atmosféricos , Contaminación del Aire , Masculino , Adulto , Humanos , Dióxido de Nitrógeno/análisis , España/epidemiología , Estudios Transversales , Contaminación del Aire/efectos adversos , Contaminación del Aire/análisis , Contaminantes Atmosféricos/análisis , Material Particulado/análisis , Lípidos , Lipoproteínas/análisis , Exposición a Riesgos Ambientales/efectos adversos
2.
Environ Health ; 21(1): 76, 2022 08 17.
Artículo en Inglés | MEDLINE | ID: mdl-35978396

RESUMEN

BACKGROUND: Recent reports have suggested that air pollution may impact thyroid function, although the evidence is still scarce and inconclusive. In this study we evaluated the association of exposure to air pollutants to thyroid function parameters in a nationwide sample representative of the adult population of Spain. METHODS: The Di@bet.es study is a national, cross-sectional, population-based survey which was conducted in 2008-2010 using a random cluster sampling of the Spanish population. The present analyses included 3859 individuals, without a previous thyroid disease diagnosis, and with negative thyroid peroxidase antibodies (TPO Abs) and thyroid-stimulating hormone (TSH) levels of 0.1-20 mIU/L. Participants were assigned air pollution concentrations for particulate matter <2.5µm (PM2.5) and Nitrogen Dioxide (NO2), corresponding to the health examination year, obtained by means of modeling combined with measurements taken at air quality stations (CHIMERE chemistry-transport model). TSH, free thyroxine (FT4), free triiodothyronine (FT3) and TPO Abs concentrations were analyzed using an electrochemiluminescence immunoassay (Modular Analytics E170 Roche). RESULTS: In multivariate linear regression models, there was a highly significant negative correlation between PM2.5 concentrations and both FT4 (p<0.001), and FT3 levels (p<0.001). In multivariate logistic regression, there was a significant association between PM2.5 concentrations and the odds of presenting high TSH [OR 1.24 (1.01-1.52) p=0.043], lower FT4 [OR 1.25 (1.02-1.54) p=0.032] and low FT3 levels [1.48 (1.19-1.84) p=<0.001] per each IQR increase in PM2.5 (4.86 µg/m3). There was no association between NO2 concentrations and thyroid hormone levels. No significant heterogeneity was seen in the results between groups of men, pre-menopausal and post-menopausal women. CONCLUSIONS: Exposures to PM2.5 in the general population were associated with mild alterations in thyroid function.


Asunto(s)
Contaminantes Atmosféricos , Contaminación del Aire , Adulto , Contaminantes Atmosféricos/efectos adversos , Contaminantes Atmosféricos/análisis , Contaminación del Aire/análisis , Estudios Transversales , Femenino , Humanos , Masculino , Dióxido de Nitrógeno/análisis , Material Particulado/análisis , Glándula Tiroides/química , Hormonas Tiroideas , Tirotropina
3.
Int J Mol Sci ; 23(3)2022 Feb 08.
Artículo en Inglés | MEDLINE | ID: mdl-35163842

RESUMEN

This work intends to describe the physical properties of red blood cell (RBC) membranes in obese adults. The hypothesis driving this research is that obesity, in addition to increasing the amount of body fat, will also modify the lipid composition of membranes in cells other than adipocytes. Forty-nine control volunteers (16 male, 33 female, BMI 21.8 ± 5.6 and 21.5 ± 4.2 kg/m2, respectively) and 52 obese subjects (16 male and 36 female, BMI 38.2± 11.0 and 40.7 ± 8.7 kg/m2, respectively) were examined. The two physical techniques applied were atomic force microscopy (AFM) in the force spectroscopy mode, which allows the micromechanical measurement of penetration forces, and fluorescence anisotropy of trimethylammonium diphenylhexatriene (TMA-DPH), which provides information on lipid order at the membrane polar-nonpolar interface. These techniques, in combination with lipidomic studies, revealed a decreased rigidity in the interfacial region of the RBC membranes of obese as compared to control patients, related to parallel changes in lipid composition. Lipidomic data show an increase in the cholesterol/phospholipid mole ratio and a decrease in sphingomyelin contents in obese membranes. ω-3 fatty acids (e.g., docosahexaenoic acid) appear to be less prevalent in obese patient RBCs, and this is the case for both the global fatty acid distribution and for the individual major lipids in the membrane phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylserine (PS). Moreover, some ω-6 fatty acids (e.g., arachidonic acid) are increased in obese patient RBCs. The switch from ω-3 to ω-6 lipids in obese subjects could be a major factor explaining the higher interfacial fluidity in obese patient RBC membranes.


Asunto(s)
Difenilhexatrieno/análogos & derivados , Membrana Eritrocítica/fisiología , Lipidómica/métodos , Obesidad/diagnóstico por imagen , Adolescente , Adulto , Fenómenos Biomecánicos , Estudios de Casos y Controles , Difenilhexatrieno/administración & dosificación , Membrana Eritrocítica/metabolismo , Femenino , Polarización de Fluorescencia , Humanos , Masculino , Microscopía de Fuerza Atómica , Persona de Mediana Edad , Obesidad/metabolismo , Obesidad/fisiopatología , Fosfatidilcolinas/metabolismo , Fosfatidiletanolaminas/metabolismo , Fosfatidilserinas/metabolismo , Adulto Joven
4.
Neuroendocrinology ; 111(10): 925-936, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-33040060

RESUMEN

BACKGROUND: Craniopharyngioma (CP) is a rare tumor in the elderly whose clinical features and prognosis are not well known in this population. AIM: To evaluate the clinicopathological features and therapeutic outcomes of CP diagnosed in the elderly. PATIENTS AND METHODS: This was a retrospective, multicenter, national study of CP patients diagnosed over the age of 65 years and surgically treated. RESULTS: From a total of 384 adult CP patients, we selected 53 (13.8%) patients (27 women [50.9%], mean age 72.3 ± 5.1 years [range 65-83 years]) diagnosed after the age of 65 years. The most common clinical symptoms were visual field defects (71.2%) followed by headache (45.3%). The maximum tumor diameter was 2.9 ± 1.1 cm. In most patients, the tumor was suprasellar (96.2%) and mixed (solid-cystic) (58.5%). The surgical approach most commonly used was transcranial surgery (52.8%), and more than half of the patients (54.7%) underwent subtotal resection (STR). Adamantinomatous CP and papillary CP were present in 51 and 45.1%, respectively, with mixed forms in the remaining. Surgery was accompanied by an improvement in visual field defects and in headaches; however, pituitary hormonal hypofunction increased, mainly at the expense of an increase in the prevalence of diabetes insipidus (DI) (from 3.9 to 69.2%). Near-total resection (NTR) was associated with a higher prevalence of DI compared with subtotal resection (87.5 vs. 53.6%, p = 0.008). Patients were followed for 46.7 ± 40.8 months. The mortality rate was 39.6% with a median survival time of 88 (95% CI: 57-118) months. DI at last visit was associated with a lower survival. CONCLUSION: CP diagnosed in the elderly shows a similar distribution by sex and histologic forms than that diagnosed at younger ages. At presentation, visual field alterations and headaches are the main clinical symptoms which improve substantially with surgery. However, surgery, mainly NTR, is accompanied by worsening of pituitary function, especially DI, which seems to be a predictor of mortality in this population.


Asunto(s)
Envejecimiento , Craneofaringioma , Neoplasias Hipofisarias , Anciano , Anciano de 80 o más Años , Craneofaringioma/diagnóstico , Craneofaringioma/mortalidad , Craneofaringioma/patología , Craneofaringioma/terapia , Femenino , Humanos , Masculino , Neoplasias Hipofisarias/diagnóstico , Neoplasias Hipofisarias/mortalidad , Neoplasias Hipofisarias/patología , Neoplasias Hipofisarias/terapia , Estudios Retrospectivos , España/epidemiología
5.
Clin Endocrinol (Oxf) ; 81(6): 883-90, 2014 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-24612232

RESUMEN

BACKGROUND: Pegvisomant is an effective treatment for acromegaly. OBJECTIVE: To investigate escape (loss of biochemical control in patients previously controlled) and lipodystrophy in acromegalic patients treated with pegvisomant and to evaluate possible associations with clinical features. PATIENTS AND METHODS: Multicentre retrospective study involving 19 Spanish centres. RESULTS: Ninety-seven patients were included (59% women, mean age at diagnosis 42 ± 13 years, 80% macroadenomas); mean follow-up on pegvisomant was 5 ± 2·5 years, and 89 (92%) achieved normal IGF-1. Escape was reported in 30/89 (34%) of responders, after a mean treatment duration of 25 ± 21 months. The mean initial dose of pegvisomant was 11 ± 5 mg/day, and mean dose at escape was 14 ± 7 mg/day. Most patients (26/30, 87%) achieved control with dose increase (57%), additional medical treatment (3%) or both (27%). Mean new dose that controlled IGF-1 after escape was 20 ± 7 mg/day. Treatments associated were somatostatin analogues (SSA in 47%), cabergoline (CAB in 47%) and both (6%). Lipodystrophy was observed in 15 patients (13 females), mild in six, moderate in six, severe in three and persistent in four. Among patients with lipodystrophy, three escaped and three were nonresponders to pegvisomant. Four patients discontinued the drug, and four had dose reductions because of lipodystrophy. It tended to be more frequent in females (P = 0·06) and in patients treated with triple association SSA+CAB+PEG (P = 0·018). No relationship between escape and clinical variables was found, except prior CAB (P = 0·04) and metformin treatment (0·02) and grade of lipodystrophy (P = 0·02). CONCLUSIONS: A significant proportion of patients treated with pegvisomant escaped (34%); however, the majority (87%) was easily controlled with either dose increase, further medical treatment or both. Lipodystrophy developed in 15%, mostly females, and influenced the response to treatment.


Asunto(s)
Adenoma/tratamiento farmacológico , Adenoma Hipofisario Secretor de Hormona del Crecimiento/tratamiento farmacológico , Hormona de Crecimiento Humana/análogos & derivados , Lipodistrofia/inducido químicamente , Receptores de Somatotropina/antagonistas & inhibidores , Adenoma/metabolismo , Adulto , Antineoplásicos/uso terapéutico , Cabergolina , Quimioterapia Combinada , Ergolinas/uso terapéutico , Femenino , Adenoma Hipofisario Secretor de Hormona del Crecimiento/metabolismo , Hormona de Crecimiento Humana/uso terapéutico , Humanos , Inyecciones Subcutáneas , Factor I del Crecimiento Similar a la Insulina/metabolismo , Masculino , Persona de Mediana Edad , Octreótido/uso terapéutico , Estudios Retrospectivos , España , Insuficiencia del Tratamiento , Resultado del Tratamiento
6.
Nutr Metab Cardiovasc Dis ; 24(9): 947-55, 2014 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-24984822

RESUMEN

BACKGROUND AND AIM: Prevalence rates of "metabolically healthy obese" (MHO) subjects vary depending on the criteria used. This study examined the prevalence and characteristics of MHO subjects and metabolically abnormal normal-weight subjects and compared the findings with the NHANES 1999-2004 study. The aims of the present study were, first, to determine the prevalence rates of MHO and MNHNO subjects using the same criteria as those of the National Health and Nutrition Examination Survey (NHANES) (1999-2004) study, and second to compare the prevalence and correlates of obese subjects who are resistant to the development of adiposity-associated cardiometabolic abnormalities (CA) and normal-weight individuals who display cardiometabolic risk factor clustering between the Spanish and the US populations. METHODS AND RESULTS: Di@bet.es study is a national, cross-sectional population-based survey of 5728 adults conducted in 2009-2010. Clinical, metabolic, sociodemographic, and anthropometric data and information about lifestyle habits, such as physical activity, smoking habit, alcohol intake and food consumption, were collected. Subjects were classified according to their body mass index (BMI) (normal-weight, <25 kg/m(2); overweight, 25-29.9 kg/m(2); and obese, >30 kg/m(2)). CA included elevated blood pressure; elevated levels of triglycerides, fasting glucose, and high-sensitivity C-reactive protein (hs-CRP); and elevated homeostasis model assessment of insulin resistance (HOMA-IR) value and low high-density lipoprotein cholesterol (HDL-c) level. Two phenotypes were defined: metabolically healthy phenotype (0-1 CA) and metabolically abnormal phenotype (≥2 CA). The prevalence of metabolically abnormal normal-weight phenotype was slightly lower in the Spanish population (6.5% vs. 8.1%). The prevalence of metabolically healthy overweight and MHO subjects was 20.9% and 7.0%, respectively, while in NHANES study it was 17.9% and 9.7%, respectively. Cigarette smoking was associated with CA in each phenotype, while moderate physical activity and moderate alcohol intake were associated with being metabolically healthy. Olive oil intake was negatively associated with the prevalence of CA. CONCLUSIONS: Smoking, physical activity level, and alcohol intake contribute to the explanation of the prevalence of CA in the Spanish population, as in the US population. However in Spain, olive oil intake contributes significantly to the explanation of the variance in the prevalence of CA.


Asunto(s)
Enfermedades Cardiovasculares/epidemiología , Conducta Alimentaria , Estilo de Vida , Síndrome Metabólico/epidemiología , Obesidad/epidemiología , Adolescente , Adulto , Anciano , Glucemia , Índice de Masa Corporal , Peso Corporal , Proteína C-Reactiva/metabolismo , HDL-Colesterol/sangre , LDL-Colesterol/sangre , Estudios Transversales , Dieta , Femenino , Humanos , Insulina/sangre , Masculino , Persona de Mediana Edad , Actividad Motora , Encuestas Nutricionales , Estado Nutricional , Fenotipo , Prevalencia , Factores Socioeconómicos , España/epidemiología , Triglicéridos/sangre , Estados Unidos/epidemiología , Adulto Joven
7.
BMC Public Health ; 14: 1059, 2014 Oct 10.
Artículo en Inglés | MEDLINE | ID: mdl-25300610

RESUMEN

BACKGROUND: Type 2 diabetes mellitus is associated with a diverse range of pathologies. The aim of the study was to determine the incidence of diabetes-related complications, the prevalence of coexistent chronic conditions and to report multimorbidity in people with type 2 diabetes living in the Basque Country. METHODS: Administrative databases, in four cross sections (annually from 2007 to 2011) were consulted to analyse 149,015 individual records from patients aged ≥ 35 years with type 2 diabetes mellitus. The data observed were: age, sex, diabetes-related complications (annual rates of acute myocardial infarction, major amputations and avoidable hospitalisations), diabetes-related pathologies (prevalence of ischaemic heart disease, renal failure, stroke, heart failure, peripheral neuropathy, foot ulcers and diabetic retinopathy) and other unrelated pathologies (44 diseases). RESULTS: The annual incidence for each condition progressively decreased during the four-year period: acute myocardial infarction (0.47 to 0.40%), major amputations (0.10 to 0.08%), and avoidable hospitalisations (5.85 to 5.5%). The prevalence for diabetes-related chronic pathologies was: ischaemic heart disease (11.5%), renal failure (8.4%), stroke (7.0%), heart failure (4.3%), peripheral neuropathy (1.3%), foot ulcers (2.0%) and diabetic retinopathy (7.2%). The prevalence of multimorbidity was 90.4%. The highest prevalence for other chronic conditions was 73.7% for hypertension, 13.8% for dyspepsia and 12.7% for anxiety. CONCLUSIONS: In the type 2 diabetes mellitus population living in the Basque Country, incidence rates of diabetes complications are not as high as in other places. However, they present a high prevalence of diabetes related and unrelated diseases. Multimorbidity is very common in this group, and is a factor to be taken into account to ensure correct clinical management.


Asunto(s)
Complicaciones de la Diabetes/epidemiología , Diabetes Mellitus Tipo 2/complicaciones , Adulto , Anciano , Anciano de 80 o más Años , Amputación Quirúrgica , Enfermedades Cardiovasculares/epidemiología , Enfermedades Cardiovasculares/etiología , Enfermedad Crónica , Comorbilidad , Diabetes Mellitus Tipo 2/epidemiología , Nefropatías Diabéticas/epidemiología , Neuropatías Diabéticas/epidemiología , Retinopatía Diabética/epidemiología , Etnicidad , Femenino , Hospitalización , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Prevalencia , España/epidemiología
8.
Front Endocrinol (Lausanne) ; 15: 1297614, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38586466

RESUMEN

Introduction: The disorders in the metabolism of calcium can present with manifestations that strongly suggest their diagnosis; however, most of the time, the symptoms with which they are expressed are nonspecific or present only as a laboratory finding, usually hypercalcemia. Because many of these disorders have a genetic etiology, in the present study, we sequenced a selection of 55 genes encoding the principal proteins involved in the regulation of calcium metabolism. Methods: A cohort of 79 patients with hypercalcemia were analyzed by next-generation sequencing. Results: The 30% of our cohort presented one pathogenic or likely pathogenic variant in genes associated with hypercalcemia. We confirmed the clinical diagnosis of 17 patients with hypocalciuric hypercalcemia (pathogenic or likely pathogenic variants in the CASR and AP2S1 genes), one patient with neonatal hyperparathyroidism (homozygous pathogenic variant in the CASR gene), and another patient with infantile hypercalcemia (two pathogenic variants in compound heterozygous state in the CYP24A1 gene). However, we also found variants in genes associated with primary hyperparathyroidism (GCM2), renal hypophosphatemia with or without rickets (SLC34A1, SLC34A3, SLC9A3R1, VDR, and CYP27B1), DiGeorge syndrome (TBX1 and NEBL), and hypophosphatasia (ALPL). Our genetic study revealed 11 novel variants. Conclusions: Our study demonstrates the importance of genetic analysis through massive sequencing to obtain a clinical diagnosis of certainty. The identification of patients with a genetic cause is important for the appropriate treatment and identification of family members at risk of the disease.


Asunto(s)
Hipercalcemia , Hiperparatiroidismo , Recién Nacido , Humanos , Hipercalcemia/genética , Hipercalcemia/diagnóstico , Calcio , Perfil Genético , Mutación , Hiperparatiroidismo/genética
9.
Eur J Endocrinol ; 190(6): 421-433, 2024 Jun 05.
Artículo en Inglés | MEDLINE | ID: mdl-38701338

RESUMEN

INTRODUCTION: Growth hormone (GH)-secreting pituitary tumors (GHomas) are the most common acromegaly cause. At diagnosis, most of them are macroadenomas, and up to 56% display cavernous sinus invasion. Biomarker assessment associated with tumor growth and invasion is important to optimize their management. OBJECTIVES: The study aims to identify clinical/hormonal/molecular biomarkers associated with tumor size and invasiveness in GHomas and to analyze the influence of pre-treatment with somatostatin analogs (SSAs) or dopamine agonists (DAs) in key molecular biomarker expression. METHODS: Clinical/analytical/radiological variables were evaluated in 192 patients from the REMAH study (ambispective multicenter post-surgery study of the Spanish Society of Endocrinology and Nutrition). The expression of somatostatin/ghrelin/dopamine system components and key pituitary/proliferation markers was evaluated in GHomas after the first surgery. Univariate/multivariate regression studies were performed to identify association between variables. RESULTS: Eighty percent of patients harbor macroadenomas (63.8% with extrasellar growth). Associations between larger and more invasive GHomas with younger age, visual abnormalities, higher IGF1 levels, extrasellar/suprasellar growth, and/or cavernous sinus invasion were found. Higher GH1 and lower PRL/POMC/CGA/AVPR1B/DRD2T/DRD2L expression levels (P < .05) were associated with tumor invasiveness. Least Absolute Shrinkage and Selection Operator's penalized regression identified combinations of clinical and molecular features with areas under the curve between 0.67 and 0.82. Pre-operative therapy with DA or SSAs did not alter the expression of any of the markers analyzed except for DRD1/AVPR1B (up-regulated with DA) and FSHB/CRHR1 (down-regulated with SSAs). CONCLUSIONS: A specific combination of clinical/analytical/molecular variables was found to be associated with tumor invasiveness and growth capacity in GHomas. Pre-treatment with first-line drugs for acromegaly did not significantly modify the expression of the most relevant biomarkers in our association model. These findings provide valuable insights for risk stratification and personalized management of GHomas.


Asunto(s)
Acromegalia , Adenoma , Adenoma Hipofisario Secretor de Hormona del Crecimiento , Invasividad Neoplásica , Humanos , Masculino , Femenino , Acromegalia/metabolismo , Persona de Mediana Edad , Adulto , Adenoma Hipofisario Secretor de Hormona del Crecimiento/patología , Adenoma Hipofisario Secretor de Hormona del Crecimiento/metabolismo , Adenoma/metabolismo , Adenoma/patología , Anciano , Agonistas de Dopamina/uso terapéutico , Biomarcadores de Tumor/metabolismo , Somatostatina/análogos & derivados , Somatostatina/uso terapéutico , Hormona de Crecimiento Humana/metabolismo
10.
N Engl J Med ; 362(16): 1463-76, 2010 Apr 22.
Artículo en Inglés | MEDLINE | ID: mdl-20228402

RESUMEN

BACKGROUND: The ability of short-acting insulin secretagogues to reduce the risk of diabetes or cardiovascular events in people with impaired glucose tolerance is unknown. METHODS: In a double-blind, randomized clinical trial, we assigned 9306 participants with impaired glucose tolerance and either cardiovascular disease or cardiovascular risk factors to receive nateglinide (up to 60 mg three times daily) or placebo, in a 2-by-2 factorial design with valsartan or placebo, in addition to participation in a lifestyle modification program. We followed the participants for a median of 5.0 years for incident diabetes (and a median of 6.5 years for vital status). We evaluated the effect of nateglinide on the occurrence of three coprimary outcomes: the development of diabetes; a core cardiovascular outcome that was a composite of death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for heart failure; and an extended cardiovascular outcome that was a composite of the individual components of the core composite cardiovascular outcome, hospitalization for unstable angina, or arterial revascularization. RESULTS: After adjustment for multiple testing, nateglinide, as compared with placebo, did not significantly reduce the cumulative incidence of diabetes (36% and 34%, respectively; hazard ratio, 1.07; 95% confidence interval [CI], 1.00 to 1.15; P=0.05), the core composite cardiovascular outcome (7.9% and 8.3%, respectively; hazard ratio, 0.94, 95% CI, 0.82 to 1.09; P=0.43), or the extended composite cardiovascular outcome (14.2% and 15.2%, respectively; hazard ratio, 0.93, 95% CI, 0.83 to 1.03; P=0.16). Nateglinide did, however, increase the risk of hypoglycemia. CONCLUSIONS: Among persons with impaired glucose tolerance and established cardiovascular disease or cardiovascular risk factors, assignment to nateglinide for 5 years did not reduce the incidence of diabetes or the coprimary composite cardiovascular outcomes. (ClinicalTrials.gov number, NCT00097786.)


Asunto(s)
Enfermedades Cardiovasculares/prevención & control , Ciclohexanos/uso terapéutico , Diabetes Mellitus Tipo 2/prevención & control , Intolerancia a la Glucosa/tratamiento farmacológico , Hipoglucemiantes/uso terapéutico , Fenilalanina/análogos & derivados , Bloqueadores del Receptor Tipo 1 de Angiotensina II/uso terapéutico , Glucemia/análisis , Glucemia/efectos de los fármacos , Peso Corporal/efectos de los fármacos , Enfermedades Cardiovasculares/epidemiología , Enfermedades Cardiovasculares/mortalidad , Ciclohexanos/efectos adversos , Diabetes Mellitus Tipo 2/epidemiología , Método Doble Ciego , Quimioterapia Combinada , Ejercicio Físico , Femenino , Estudios de Seguimiento , Intolerancia a la Glucosa/dietoterapia , Intolerancia a la Glucosa/terapia , Humanos , Hipoglucemiantes/efectos adversos , Incidencia , Estimación de Kaplan-Meier , Masculino , Persona de Mediana Edad , Nateglinida , Fenilalanina/efectos adversos , Fenilalanina/uso terapéutico , Modelos de Riesgos Proporcionales , Factores de Riesgo , Tetrazoles/uso terapéutico , Insuficiencia del Tratamiento , Valina/análogos & derivados , Valina/uso terapéutico , Valsartán
11.
N Engl J Med ; 362(16): 1477-90, 2010 Apr 22.
Artículo en Inglés | MEDLINE | ID: mdl-20228403

RESUMEN

BACKGROUND: It is not known whether drugs that block the renin-angiotensin system reduce the risk of diabetes and cardiovascular events in patients with impaired glucose tolerance. METHODS: In this double-blind, randomized clinical trial with a 2-by-2 factorial design, we assigned 9306 patients with impaired glucose tolerance and established cardiovascular disease or cardiovascular risk factors to receive valsartan (up to 160 mg daily) or placebo (and nateglinide or placebo) in addition to lifestyle modification. We then followed the patients for a median of 5.0 years for the development of diabetes (6.5 years for vital status). We studied the effects of valsartan on the occurrence of three coprimary outcomes: the development of diabetes; an extended composite outcome of death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, hospitalization for heart failure, arterial revascularization, or hospitalization for unstable angina; and a core composite outcome that excluded unstable angina and revascularization. RESULTS: The cumulative incidence of diabetes was 33.1% in the valsartan group, as compared with 36.8% in the placebo group (hazard ratio in the valsartan group, 0.86; 95% confidence interval [CI], 0.80 to 0.92; P<0.001). Valsartan, as compared with placebo, did not significantly reduce the incidence of either the extended cardiovascular outcome (14.5% vs. 14.8%; hazard ratio, 0.96; 95% CI, 0.86 to 1.07; P=0.43) or the core cardiovascular outcome (8.1% vs. 8.1%; hazard ratio, 0.99; 95% CI, 0.86 to 1.14; P=0.85). CONCLUSIONS: Among patients with impaired glucose tolerance and cardiovascular disease or risk factors, the use of valsartan for 5 years, along with lifestyle modification, led to a relative reduction of 14% in the incidence of diabetes but did not reduce the rate of cardiovascular events. (ClinicalTrials.gov number, NCT00097786.)


Asunto(s)
Bloqueadores del Receptor Tipo 1 de Angiotensina II/uso terapéutico , Enfermedades Cardiovasculares/prevención & control , Diabetes Mellitus Tipo 2/prevención & control , Intolerancia a la Glucosa/tratamiento farmacológico , Tetrazoles/uso terapéutico , Valina/análogos & derivados , Bloqueadores del Receptor Tipo 1 de Angiotensina II/efectos adversos , Glucemia/análisis , Glucemia/efectos de los fármacos , Presión Sanguínea/efectos de los fármacos , Peso Corporal/efectos de los fármacos , Enfermedades Cardiovasculares/epidemiología , Enfermedades Cardiovasculares/mortalidad , Ciclohexanos/uso terapéutico , Diabetes Mellitus Tipo 2/epidemiología , Método Doble Ciego , Quimioterapia Combinada , Ejercicio Físico , Femenino , Estudios de Seguimiento , Intolerancia a la Glucosa/dietoterapia , Intolerancia a la Glucosa/terapia , Humanos , Hipoglucemiantes/uso terapéutico , Incidencia , Masculino , Persona de Mediana Edad , Nateglinida , Fenilalanina/análogos & derivados , Fenilalanina/uso terapéutico , Modelos de Riesgos Proporcionales , Factores de Riesgo , Tetrazoles/efectos adversos , Valina/efectos adversos , Valina/uso terapéutico , Valsartán
12.
Eur J Clin Invest ; 43(1): 1-10, 2013 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-23134526

RESUMEN

BACKGROUND: Although high-sensitivity C-reactive protein (hs-CRP) is currently used as a risk marker of cardiovascular disease, it has been suggested that genetic, clinical, biochemical or environmental factors could modify hs-CRP levels. The aim of this study was to investigate sources of interindividual hs-CRP variability in the Spanish population. MATERIALS AND METHODS: A representative sample of the Spanish population within the di@bet.es study was used. Study variables included a clinical and demographic structured survey, a lifestyle survey, a physical examination, plasmatic hs-CRP and other biochemical parameters. RESULTS: Median and interquartile range of plasma hs-CRP values were 1·73 ± 2·75 mg/dL. Thirty per cent of the study population had hs-CRP levels above 3 mg/dL and 38% from 1 to 3 mg/dL. Body mass index was the strongest factor associated with moderate and high hs-CRP levels. Age, sex, waist-to-hip ratio, weight increase, plasma lipid levels, glucose metabolism (HOMA-IR and abnormal glucose regulation categories), pharmacological treatment (lipid-lowering agents, psychotropic drugs and levothyroxine), smoking, physical activity, different dietary patterns, quality of life and educational level were all significantly associated with hs-CRP levels. Interactions were observed between variables. These interactions modulated the effect of previously described factors on hs-CRP. CONCLUSIONS: Thirty per cent of the Spanish population have hs-CRP levels considered to represent a cardiovascular risk. Different clinical, anthropometric, biochemical and environmental variables modulate hs-CRP levels. In addition, multiple interactions between variables complicate the interpretation of hs-CRP values.


Asunto(s)
Índice de Masa Corporal , Proteína C-Reactiva/análisis , Enfermedades Cardiovasculares/metabolismo , Diabetes Mellitus/epidemiología , Resistencia a la Insulina , Relación Cintura-Cadera , Adulto , Análisis de Varianza , Biomarcadores/sangre , Proteína C-Reactiva/metabolismo , Enfermedades Cardiovasculares/epidemiología , Diabetes Mellitus/diagnóstico , Femenino , Encuestas Epidemiológicas , Humanos , Modelos Logísticos , Masculino , Persona de Mediana Edad , Prevalencia , Análisis de Componente Principal , Factores de Riesgo , España/epidemiología , Relación Cintura-Cadera/estadística & datos numéricos
13.
Clin Sci (Lond) ; 124(4): 269-77, 2013 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-22970892

RESUMEN

The present study was undertaken to examine the prevalence of urinary ACR (albumin/creatinine ratio) >30 mg/g and the associated clinical and environmental factors in a representative sample of the population of Spain. Di@bet.es study is a national, cross-sectional population-based survey conducted in 2009-2010. Clinical, metabolic, socio-demographic, anthropometric data and information about lifestyle habit were collected. Those subjects without KDM (known diabetes mellitus) were given an OGTT (oral glucose tolerance test). Albumin and creatinine were measured in a urinary sample and ACR was calculated. The population prevalence of ACR >30 mg/g was 7.65% (adjusted for sex and age). The prevalence of ACR >30 mg/g increased with age (P<0.001). Subjects with carbohydrate metabolism disorders had a greater prevalence of ACR >30 mg/g but after being adjusted for age, sex and hypertension, was significant only in those subjects with UKDM (unknown diabetes mellitus) {OR (odd ratio), 2.07 [95% CI (confidence interval), 1.38-3.09]; P<0.001] and KDM [OR, 3.55 (95% CI, 2.63-4.80); P<0.001]. Prevalence of ACR >30 mg/g was associated with hypertension [OR, 1.48 (95% CI, 1.12-1.95); P=0.001], HOMA-IR (homoeostasis model assessment of insulin resistance) [OR, 1.47 (95% CI, 1.13-1.92); P≤0.01], metabolic syndrome [OR, 2.17 (95% CI, 1.72-2.72); P<0.001], smoking [OR, 1.40 (95% CI, 1.06-1.83); P≤0.05], physical activity [OR, 0.68 (95% CI, 0.54-0.88); P≤0.01] and consumption of fish [OR, 0.38 (95% CI, 0.18-0.78); P≤0.01]. This is the first study that reports the prevalence of ACR >30 mg/g in the Spanish population. The association between clinical variables and other potentially modifiable environmental variables contribute jointly, and sometimes interactively, to the explanation of prevalence of ACR >30 mg/g. Many of these risk factors are susceptible to intervention.


Asunto(s)
Albuminuria/etiología , Adolescente , Adulto , Distribución por Edad , Anciano , Anciano de 80 o más Años , Albuminuria/epidemiología , Albuminuria/orina , Análisis de Varianza , Biomarcadores/orina , Creatinina/orina , Estudios Transversales , Femenino , Encuestas Epidemiológicas , Humanos , Modelos Logísticos , Masculino , Persona de Mediana Edad , Prevalencia , Factores de Riesgo , Distribución por Sexo , España/epidemiología , Adulto Joven
14.
Pituitary ; 16(1): 115-21, 2013 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-22481632

RESUMEN

Since 1997 there is an online National Registry of acromegalic patients in Spain (REA). We aimed to study changes in acromegaly treatment and outcomes over the last four decades in Spain. In REA clinical and biochemical data are collected at diagnosis and updated every one to 2 years. We analyzed the first treatment received and the different treatments administered according to decade of diagnosis of acromegaly: prior to 1980, 1980-1989, 1990-1999 and 2000-2009. Surgical cure rates according to pretreatment with long-acting somatostatin receptor ligands (SRLs) were also analyzed. 1,658 patients were included of which 698 had accurate follow-up data. Treatment of acromegaly changed over time. Surgery was the main treatment option (83.8 %) and medical treatment was widely used (74.7 %) both maintained over decades, while radiation therapy declined (62.8, 61.6, 42.2 and 11.9 % over decades, p < 0.001). First treatment type also changed: surgery was the first line option up until the last decade in which medical treatment was preferred (p < 0.001). Radiotherapy was barely used as first treatment. Treatment combinations changed over time (p < 0.001). The most common treatment combination (surgery plus medical therapy), was received by 24.4, 16.4, 25.3 and 56.5 % of patients over decades. Medical treatment alone was performed in 7.3, 6, 7.2 and 14.7 % over decades. Type of medical treatment also changed, SRLs becoming the first medical treatment modality in the last decades, whereas dopamine agonist use declined (p < 0.001). Surgical cure rates improved over decades (21, 21, 36 and 38 %, p = 0.002) and were not influenced by SRL pre-surgical use. Acromegaly treatment has changed in Spain in the last four decades. Surgery has been the main treatment option for decades; however, medical therapy has replaced surgery as first line in the last decade and radiotherapy rates have clearly declined. SRLs are the most used medical treatment.


Asunto(s)
Acromegalia/radioterapia , Acromegalia/cirugía , Acromegalia/tratamiento farmacológico , Adulto , Femenino , Hormona de Crecimiento Humana/uso terapéutico , Humanos , Masculino , Persona de Mediana Edad , Prohibitinas , Sistema de Registros , Programas Informáticos , España
15.
Front Endocrinol (Lausanne) ; 14: 1074757, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37342265

RESUMEN

Background: Patients with Cushing's disease (CD) in remission maintain an increased cardiovascular risk. Impaired characteristics of gut microbiome (dysbiosis) have been associated with several cardiometabolic risk factors. Methods: Twenty-eight female non-diabetic patients with CD in remission with a mean ± SD) age of 51 ± 9 years, mean ( ± SD) BMI, 26 ± 4, median (IQR) duration of remission, 11(4) years and 24 gender-, age, BMI-matched controls were included. The V4 region of the bacterial 16S rDNA was PCR amplified and sequenced to analyse microbial alpha diversity (Chao 1 index, observed number of species, Shannon index) and beta diversity analysis through the Principal Coordinates Analysis (PCoA) of weighted and unweighted UniFrac distances. Inter-group difference in microbiome composition was analysed using MaAsLin2. Results: The Chao 1 index was lower in CD as compared with controls (Kruskal-Wallis test, q = 0.002), indicating lower microbial richness in the former. Beta diversity analysis showed that faecal samples from CS patients clustered together and separated from the controls (Adonis test, p<0.05). Collinsella, a genus form of the Actinobacteria phylum was present in CD patients only, whereas Sutterella, a genus from Proteobacteria phylum, was scarcely detectable/undetectable in CD patients as well as Lachnospira, a genus of the Lachnospiraceae family of the Firmicutes phylum. In CS, the Chao 1 index was associated with fibrinogen levels and inversely correlated with both triglyceride concentrations and the HOMA-IR index (p<0.05). Conclusions: Patients with CS in remission have gut microbial dysbiosis which may be one of the mechanisms whereby cardiometabolic dysfunctions persist after "cure".


Asunto(s)
Enfermedades Cardiovasculares , Microbioma Gastrointestinal , Hipersecreción de la Hormona Adrenocorticotrópica Pituitaria (HACT) , Humanos , Femenino , Adulto , Persona de Mediana Edad , Microbioma Gastrointestinal/genética , Disbiosis/microbiología , Heces/microbiología , Clostridiales , Enfermedades Cardiovasculares/etiología
16.
Diabetes Care ; 46(1): 206-208, 2023 01 01.
Artículo en Inglés | MEDLINE | ID: mdl-36448932

RESUMEN

OBJECTIVE: To assess the efficacy of the insulin pen cap Insulclock on improving glycemic control, treatment adherence, and user satisfaction in people with type 1 diabetes. RESEARCH DESIGN AND METHODS: This multicenter, open-label, randomized controlled trial comprised a 4-week run-in phase and a 6-week double-arm phase in which participants were randomly assigned into an active or masked mode. RESULTS: Fifty-five participants were evaluable (active group, n = 26, masked group, n = 29). The increase in time in range was higher in the active versus masked group (5.2% vs. -0.8%; P = 0.016). The active group showed a higher reduction in mean glucose, glucose management indicator, time above range, and high blood glucose index. On-time insulin doses increased in the active group and decreased in the masked group. CONCLUSIONS: Insulclock system use was associated with improved glycemic control, glycemic variability, hyperglycemia risk, and treatment adherence in people with uncontrolled type 1 diabetes.


Asunto(s)
Diabetes Mellitus Tipo 1 , Humanos , Diabetes Mellitus Tipo 1/tratamiento farmacológico , Hipoglucemiantes/uso terapéutico , Insulina/uso terapéutico , Inyecciones , Glucosa/uso terapéutico , Glucemia
17.
J Clin Endocrinol Metab ; 108(11): e1341-e1346, 2023 10 18.
Artículo en Inglés | MEDLINE | ID: mdl-37207452

RESUMEN

CONTEXT: Autoimmune diabetes can develop at any age, but unlike early-onset diabetes, adult onset is less well documented. We aimed to compare, over a wide age range, the most reliable predictive biomarkers for this pathology: pancreatic-autoantibodies and HLA-DRB1 genotype. METHODS: A retrospective study of 802 patients with diabetes (aged 11 months to 66 years) was conducted. Pancreatic autoantibodies at diagnosis: insulin autoantibodies (IAA), glutamate decarboxylase autoantibodies (GADA), islet tyrosine phosphatase 2 autoantibodies (IA2A), and zinc transporter-8 autoantibodies (ZnT8A) and HLA-DRB1 genotype were analyzed. RESULTS: Compared with early-onset patients, adults had a lower frequency of multiple autoantibodies, with GADA being the most common. At early onset, IAA was the most frequent in those younger than 6 years and correlated inversely with age; GADA and ZnT8A correlated directly and IA2A remained stable.The absence of HLA-DRB1 risk genotype was associated with higher age at diabetes onset (27.5 years; interquartile range [IQR], 14.3-35.7), whereas the high-risk HLA-DR3/DR4 was significantly more common at lower age (11.9 years; IQR, 7.1-21.6). ZnT8A was associated with DR4/non-DR3 (odds ratio [OR], 1.91; 95% CI, 1.15-3.17), GADA with DR3/non-DR4 (OR, 2.97; 95% CI, 1.55-5.71), and IA2A with DR4/non-DR3 and DR3/DR4 (OR, 3.89; 95% CI, 2.28-6.64, and OR, 3.08; 95% CI, 1.83-5.18, respectively). No association of IAA with HLA-DRB1 was found. CONCLUSION: Autoimmunity and HLA-DRB1 genotype are age-dependent biomarkers. Adult-onset autoimmune diabetes is associated with lower genetic risk and lower immune response to pancreatic islet cells compared with early-onset diabetes.


Asunto(s)
Autoanticuerpos , Diabetes Mellitus Tipo 1 , Diabetes Mellitus Tipo 2 , Cadenas HLA-DRB1 , Adolescente , Adulto , Niño , Humanos , Adulto Joven , Autoanticuerpos/genética , Autoanticuerpos/inmunología , Biomarcadores/metabolismo , Diabetes Mellitus Tipo 1/genética , Diabetes Mellitus Tipo 1/inmunología , Diabetes Mellitus Tipo 2/genética , Diabetes Mellitus Tipo 2/inmunología , Genotipo , Glutamato Descarboxilasa , Antígeno HLA-DR4/genética , Cadenas HLA-DRB1/genética , Hormonas Pancreáticas , Estudios Retrospectivos , Lactante , Preescolar , Persona de Mediana Edad , Anciano
18.
J Clin Endocrinol Metab ; 108(9): 2193-2202, 2023 08 18.
Artículo en Inglés | MEDLINE | ID: mdl-36916151

RESUMEN

CONTEXT: There are no data on mortality of acromegaly diagnosed in older individuals. OBJECTIVE: This work aimed to compare clinical characteristics, growth hormone-related comorbidities, therapeutic approaches, and mortality rate of patients diagnosed before or after 2010 and to assess overall mortality rate compared with the general Spanish population. METHODS: A retrospective evaluation was conducted among Spanish tertiary care centers of 118 patients diagnosed with acromegaly at age 65 or older. Kaplan-Meier curves were constructed to trace survival, and Cox proportional hazard models were used to assess the risk factors associated with mortality. We also compared mortality with that of the Spanish population by using age- and sex-adjusted standardized mortality ratios (SMRs). RESULTS: No differences were found in first-line treatment or biochemical control, between both periods except for faster biochemical control after 2010. Twenty-nine (24.6%) patients died, without differences between groups, and had a median of follow-up 8.6 years (103, [72.3] months). Overall SMR was 1.02 (95% CI, 0.57-1.54), (0.60; 95% CI, 0.35-1.06) for men and (1.80; 95% CI, 1.07-2.94) for women. The most common cause of death was cardiovascular disease (CVD). CONCLUSION: The mortality in patients with acromegaly diagnosed in older individuals was no different between both periods, and there was no overall SMR difference compared with the general Spanish population. However, the SMR was higher in women. As CVD is the leading cause of mortality, it seems advisable to initiate an intense CVD protective treatment as soon as acromegaly is diagnosed, particularly in women, in addition to tight acromegaly control to prevent excess mortality.


Asunto(s)
Acromegalia , Enfermedades Cardiovasculares , Hormona de Crecimiento Humana , Masculino , Humanos , Femenino , Anciano , Acromegalia/diagnóstico , Acromegalia/epidemiología , Acromegalia/tratamiento farmacológico , Estudios Retrospectivos , España/epidemiología , Hormona de Crecimiento Humana/uso terapéutico , Enfermedades Cardiovasculares/diagnóstico , Enfermedades Cardiovasculares/tratamiento farmacológico
19.
Clin Endocrinol (Oxf) ; 76(5): 719-24, 2012 May.
Artículo en Inglés | MEDLINE | ID: mdl-22026581

RESUMEN

CONTEXT: Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. OBJECTIVE: The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. RESULTS: A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. CONCLUSIONS: Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.


Asunto(s)
Inhibidor p27 de las Quinasas Dependientes de la Ciclina/genética , Péptidos y Proteínas de Señalización Intracelular/genética , Neoplasia Endocrina Múltiple Tipo 1/genética , Mutación , Proteínas Proto-Oncogénicas/genética , Secuencia de Aminoácidos , Secuencia de Bases , Estudios de Cohortes , Análisis Mutacional de ADN , Mutación del Sistema de Lectura , Pruebas Genéticas , Humanos , Neoplasia Endocrina Múltiple Tipo 1/diagnóstico , Mutación Missense , España , Síndrome
20.
Front Endocrinol (Lausanne) ; 13: 984877, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36187107

RESUMEN

Context: Some reports suggest that acromegaly in elderly patients has a more benign clinical behavior and could have a better response to first-generation long-acting somatostatin receptor ligands (SRL). However, there is no specific therapeutic protocol for this special subgroup of patients. Objective: This study aimed at identifying predictors of response to SRL in elderly patients. Design: Multicentric retrospective nationwide study of patients diagnosed with acromegaly at or over the age of 65 years. Results: One-hundred and eighteen patients (34 men, 84 women, mean age at diagnosis 71.7 ± 5.4 years old) were included. Basal insulin-like growth factor type 1 (IGF-1) above the upper limit of normal (ULN) and growth hormone (GH) levels (mean ± SD) were 2.7 ± 1.4 and 11.0 ± 11.9 ng/ml, respectively. The mean maximal tumor diameter was 12.3 ± 6.4 mm, and up to 68.6% were macroadenoma. Seventy-two out of 118 patients (61.0%) underwent surgery as primary treatment. One-third of patients required first-line medical treatment due to a rejection of surgical treatment or non-suitability because of high surgical risk. After first-line surgery, 45/72 (63.9%) were in disease remission, and 16/34 (46.7%) of those treated with SRL had controlled disease. Patients with basal GH at diagnosis ≤6 ng/ml had lower IGF-1 levels and had smaller tumors, and more patients in this group reached control with SRL (72.7% vs. 33.3%; p < 0.04) [OR: 21.3, IC: 95% (2.4-91.1)], while male patients had a worse response [OR: 0.09, IC 95% (0.01-0.75)]. The predictive model curve obtained for SRL response showed an AUC of 0.82 CI (0.71-0.94). Conclusions: The most frequent phenotype in newly diagnosed acromegaly in the elderly includes small adenomas and moderately high IGF-1 levels. GH at diagnosis ≤6 ng/ml and female gender, but not age per se, were associated with a greater chance of response to SRL.


Asunto(s)
Acromegalia , Hormona de Crecimiento Humana , Acromegalia/diagnóstico , Acromegalia/epidemiología , Acromegalia/terapia , Femenino , Hormona de Crecimiento Humana/metabolismo , Hormona de Crecimiento Humana/uso terapéutico , Humanos , Factor I del Crecimiento Similar a la Insulina/metabolismo , Masculino , Péptidos Cíclicos/uso terapéutico , Receptores de Somatostatina/uso terapéutico , Estudios Retrospectivos , Somatostatina/uso terapéutico , España/epidemiología
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA