RESUMEN
[This corrects the article DOI: 10.1371/journal.pbio.3001988.].
RESUMEN
Beyond their role in horizontal gene transfer, conjugative plasmids commonly encode homologues of bacterial regulators. Known plasmid regulator homologues have highly targeted effects upon the transcription of specific bacterial traits. Here, we characterise a plasmid translational regulator, RsmQ, capable of taking global regulatory control in Pseudomonas fluorescens and causing a behavioural switch from motile to sessile lifestyle. RsmQ acts as a global regulator, controlling the host proteome through direct interaction with host mRNAs and interference with the host's translational regulatory network. This mRNA interference leads to large-scale proteomic changes in metabolic genes, key regulators, and genes involved in chemotaxis, thus controlling bacterial metabolism and motility. Moreover, comparative analyses found RsmQ to be encoded on a large number of divergent plasmids isolated from multiple bacterial host taxa, suggesting the widespread importance of RsmQ for manipulating bacterial behaviour across clinical, environmental, and agricultural niches. RsmQ is a widespread plasmid global translational regulator primarily evolved for host chromosomal control to manipulate bacterial behaviour and lifestyle.
Asunto(s)
Bacterias , Proteómica , Plásmidos/genética , Bacterias/genética , Conjugación Genética/genética , Transferencia de Gen Horizontal , Proteínas Bacterianas/genética , Proteínas Bacterianas/metabolismoRESUMEN
Plasmids are mobile genetic elements found in many clades of Archaea and Bacteria. They drive horizontal gene transfer, impacting ecological and evolutionary processes within microbial communities, and hold substantial importance in human health and biotechnology. To support plasmid research and provide scientists with data of an unprecedented diversity of plasmid sequences, we introduce the IMG/PR database, a new resource encompassing 699 973 plasmid sequences derived from genomes, metagenomes and metatranscriptomes. IMG/PR is the first database to provide data of plasmid that were systematically identified from diverse microbiome samples. IMG/PR plasmids are associated with rich metadata that includes geographical and ecosystem information, host taxonomy, similarity to other plasmids, functional annotation, presence of genes involved in conjugation and antibiotic resistance. The database offers diverse methods for exploring its extensive plasmid collection, enabling users to navigate plasmids through metadata-centric queries, plasmid comparisons and BLAST searches. The web interface for IMG/PR is accessible at https://img.jgi.doe.gov/pr. Plasmid metadata and sequences can be downloaded from https://genome.jgi.doe.gov/portal/IMG_PR.
Asunto(s)
Metagenoma , Microbiota , Humanos , Metadatos , Programas Informáticos , Bases de Datos Genéticas , Plásmidos/genéticaRESUMEN
Genes encoding resistance to stressors, such as antibiotics or environmental pollutants, are widespread across microbiomes, often encoded on mobile genetic elements. Yet, despite their prevalence, the impact of resistance genes and their mobility upon the dynamics of microbial communities remains largely unknown. Here we develop eco-evolutionary theory to explore how resistance genes alter the stability of diverse microbiomes in response to stressors. We show that adding resistance genes to a microbiome typically increases its overall stability, particularly for genes on mobile genetic elements with high transfer rates that efficiently spread resistance throughout the community. However, the impact of resistance genes upon the stability of individual taxa varies dramatically depending upon the identity of individual taxa, the mobility of the resistance gene, and the network of ecological interactions within the community. Nonmobile resistance genes can benefit susceptible taxa in cooperative communities yet damage those in competitive communities. Moreover, while the transfer of mobile resistance genes generally increases the stability of previously susceptible recipient taxa to perturbation, it can decrease the stability of the originally resistant donor taxon. We confirmed key theoretical predictions experimentally using competitive soil microcosm communities. Here the stability of a susceptible microbial community to perturbation was increased by adding mobile resistance genes encoded on conjugative plasmids but was decreased when these same genes were encoded on the chromosome. Together, these findings highlight the importance of the interplay between ecological interactions and horizontal gene transfer in driving the eco-evolutionary dynamics of diverse microbiomes.
Asunto(s)
Transferencia de Gen Horizontal , Microbiota , Transferencia de Gen Horizontal/genética , Microbiota/genética , Antibacterianos/uso terapéutico , Plásmidos/genéticaRESUMEN
Plasmids play an important role in bacterial genome evolution by transferring genes between lineages. Fitness costs associated with plasmid carriage are expected to be a barrier to gene exchange, but the causes of plasmid fitness costs are poorly understood. Single compensatory mutations are often sufficient to completely ameliorate plasmid fitness costs, suggesting that such costs are caused by specific genetic conflicts rather than generic properties of plasmids, such as their size, metabolic burden, or gene expression level. By combining the results of experimental evolution with genetics and transcriptomics, we show here that fitness costs of 2 divergent large plasmids in Pseudomonas fluorescens are caused by inducing maladaptive expression of a chromosomal tailocin toxin operon. Mutations in single genes unrelated to the toxin operon, and located on either the chromosome or the plasmid, ameliorated the disruption associated with plasmid carriage. We identify one of these compensatory loci, the chromosomal gene PFLU4242, as the key mediator of the fitness costs of both plasmids, with the other compensatory loci either reducing expression of this gene or mitigating its deleterious effects by up-regulating a putative plasmid-borne ParAB operon. The chromosomal mobile genetic element Tn6291, which uses plasmids for transmission, remained up-regulated even in compensated strains, suggesting that mobile genetic elements communicate through pathways independent of general physiological disruption. Plasmid fitness costs caused by specific genetic conflicts are unlikely to act as a long-term barrier to horizontal gene transfer (HGT) due to their propensity for amelioration by single compensatory mutations, helping to explain why plasmids are so common in bacterial genomes.
Asunto(s)
Aptitud Genética , Mutación/genética , Plásmidos/genética , Cromosomas Bacterianos/genética , Conjugación Genética , Evolución Molecular , Regulación Bacteriana de la Expresión Génica , Modelos Biológicos , Pseudomonas fluorescens/genética , Transcripción Genética , Regulación hacia Arriba/genéticaRESUMEN
Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP)2phen]Cl2 and [Ru(dppz)2phen](PF6)2 have also been obtained. It is well-known that compound [Ru(dppz)(phen)2]Cl2 binds to DNA by intercalation. Therefore, we used [Ru(dppz)2phen]Cl2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC50 in the micro- or even nanomolar range (0.06-7 µM). Confocal microscopy studies showed that [Ru(DIP)2phen]Cl2 and [Ru(DIP)2TAP]Cl2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn)2phen](PF6)2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn)2phen](PF6)2 stands out for its very good IC50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.
Asunto(s)
Complejos de Coordinación , Fotoquimioterapia , Rutenio , Complejos de Coordinación/química , Rutenio/farmacología , Rutenio/química , Oxígeno Singlete/metabolismo , ADN , LigandosRESUMEN
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
Asunto(s)
G-Cuádruplex , Rutenio , Dicroismo Circular , ADN/química , Humanos , Rutenio/química , Telómero/metabolismoRESUMEN
Dissemination of antimicrobial resistance (AMR) genes by horizontal gene transfer (HGT) mediated through plasmids is a major global concern. Genomic epidemiology studies have shown varying success of different AMR plasmids during outbreaks, but the underlying reasons for these differences are unclear. Here, we investigated two Shigella plasmids (pKSR100 and pAPR100) that circulated in the same transmission network but had starkly contrasting epidemiological outcomes to identify plasmid features that may have contributed to the differences. We used plasmid comparative genomics to reveal divergence between the two plasmids in genes encoding AMR, SOS response alleviation and conjugation. Experimental analyses revealed that these genomic differences corresponded with reduced conjugation efficiencies for the epidemiologically successful pKSR100, but more extensive AMR, reduced fitness costs, and a reduced SOS response in the presence of antimicrobials, compared with the less successful pAPR100. The discrepant phenotypes between the two plasmids are consistent with the hypothesis that plasmid-associated phenotypes contribute to determining the epidemiological outcome of AMR HGT and suggest that phenotypes relevant in responding to antimicrobial pressure and fitness impact may be more important than those around conjugation in this setting. Plasmid phenotypes could thus be valuable tools in conjunction with genomic epidemiology for predicting AMR dissemination.
Asunto(s)
Farmacorresistencia Bacteriana , Shigella , Antibacterianos/farmacología , Antibacterianos/uso terapéutico , Farmacorresistencia Bacteriana/genética , Transferencia de Gen Horizontal , Fenotipo , Plásmidos , Shigella/genéticaRESUMEN
By transferring ecologically important traits between species, plasmids drive genomic divergence and evolutionary innovation in their bacterial hosts. Bacterial communities are often diverse and contain multiple coexisting plasmids, but the dynamics of plasmids in multi-species communities are poorly understood. Here, we show, using experimental multi-species communities containing two plasmids, that bacterial diversity limits the horizontal transmission of plasmids due to the 'dilution effect'; this is an epidemiological phenomenon whereby living alongside less proficient host species reduces the expected infection risk for a focal host species. In addition, plasmid horizontal transmission was also affected by plasmid diversity, such that the rate of plasmid conjugation was reduced from co-infected host cells carrying both plasmids. In diverse microbial communities, plasmid spread may be limited by the dilution effect and plasmid-plasmid interactions, reducing the rate of horizontal transmission.
Asunto(s)
Bacterias , Transferencia de Gen Horizontal , Bacterias/genética , Conjugación Genética , Plásmidos/genéticaRESUMEN
The acquisition of plasmids is often accompanied by fitness costs such that compensatory evolution is required to allow plasmid survival, but it is unclear whether compensatory evolution can be extensive or rapid enough to maintain plasmids when they are very costly. The mercury-resistance plasmid pQBR55 drastically reduced the growth of its host, Pseudomonas fluorescens SBW25, immediately after acquisition, causing a small colony phenotype. However, within 48 h of growth on agar plates we observed restoration of the ancestral large colony morphology, suggesting that compensatory mutations had occurred. Relative fitness of these evolved strains, in lab media and in soil microcosms, varied between replicates, indicating different mutational mechanisms. Using genome sequencing we identified that restoration was associated with chromosomal mutations in either a hypothetical DNA-binding protein PFLU4242, RNA polymerase or the GacA/S two-component system. Targeted deletions in PFLU4242, gacA or gacS recapitulated the ameliorated phenotype upon plasmid acquisition, indicating three distinct mutational pathways to compensation. Our data shows that plasmid compensatory evolution is fast enough to allow survival of a plasmid despite it imposing very high fitness costs upon its host, and indeed may regularly occur during the process of isolating and selecting individual plasmid-containing clones.
Asunto(s)
Proteínas Bacterianas/genética , Mutación , Plásmidos/fisiología , Pseudomonas fluorescens/genética , Proteínas Bacterianas/metabolismo , Evolución Biológica , Transferencia de Gen Horizontal , Aptitud Genética , Genoma Bacteriano/genética , Fenotipo , Plásmidos/genéticaRESUMEN
Horizontal gene transfer is a fundamental process in bacterial evolution that can accelerate adaptation via the sharing of genes between lineages. Conjugative plasmids are the principal genetic elements mediating the horizontal transfer of genes, both within and between bacterial species. In some species, plasmids are unstable and likely to be lost through purifying selection, but when alternative hosts are available, interspecific plasmid transfer could counteract this and maintain access to plasmid-borne genes. To investigate the evolutionary importance of alternative hosts to plasmid population dynamics in an ecologically relevant environment, we established simple soil microcosm communities comprising two species of common soil bacteria, Pseudomonas fluorescens and Pseudomonas putida, and a mercury resistance (Hg(R)) plasmid, pQBR57, both with and without positive selection [i.e., addition of Hg(II)]. In single-species populations, plasmid stability varied between species: although pQBR57 survived both with and without positive selection in P. fluorescens, it was lost or replaced by nontransferable Hg(R) captured to the chromosome in P. putida A simple mathematical model suggests these differences were likely due to pQBR57's lower intraspecific conjugation rate in P. putida By contrast, in two-species communities, both models and experiments show that interspecific conjugation from P. fluorescens allowed pQBR57 to persist in P. putida via source-sink transfer dynamics. Moreover, the replacement of pQBR57 by nontransferable chromosomal Hg(R) in P. putida was slowed in coculture. Interspecific transfer allows plasmid survival in host species unable to sustain the plasmid in monoculture, promoting community-wide access to the plasmid-borne accessory gene pool and thus potentiating future evolvability.
Asunto(s)
Plásmidos/genética , Pseudomonas fluorescens/genética , Pseudomonas putida/genética , Microbiología del Suelo , Antibacterianos/farmacología , Mercurio/farmacología , Pseudomonas fluorescens/efectos de los fármacos , Pseudomonas putida/efectos de los fármacosRESUMEN
By using X-ray crystallography, we show that the complexes Λ/Δ-[Ru(TAP)2 (11-CN-dppz)]2+ (TAP=1,4,5,8-tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G-quadruplex in an enantiospecific manner that parallels the specificity of these complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5' end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2 (11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex-forming sequence, and use both structural models to provide insight into the motif-specific luminescence response of the isostructural phen analogue enantiomers.
RESUMEN
Plasmids accelerate bacterial adaptation by sharing ecologically important traits between lineages. However, explaining plasmid stability in bacterial populations is challenging owing to their associated costs. Previous theoretical and experimental studies suggest that pulsed positive selection may explain plasmid stability by favouring gene mobility and promoting compensatory evolution to ameliorate plasmid cost. Here we test how the frequency of pulsed positive selection affected the dynamics of a mercury-resistance plasmid, pQBR103, in experimental populations of Pseudomonas fluorescens SBW25. Plasmid dynamics varied according to the frequency of Hg2+ positive selection: in the absence of Hg2+ plasmids declined to low frequency, whereas pulses of Hg2+ selection allowed plasmids to sweep to high prevalence. Compensatory evolution to ameliorate the cost of plasmid carriage was widespread across the entire range of Hg2+ selection regimes, including both constant and pulsed Hg2+ selection. Consistent with theoretical predictions, gene mobility via conjugation appeared to play a greater role in promoting plasmid stability under low-frequency pulses of Hg2+ selection. However, upon removal of Hg2+ selection, plasmids which had evolved under low-frequency pulse selective regimes declined over time. Our findings suggest that temporally variable selection environments, such as those created during antibiotic treatments, may help to explain the stability of mobile plasmid-encoded resistance.
Asunto(s)
Plásmidos/genética , Pseudomonas fluorescens/genética , Selección Genética , Adaptación Fisiológica , Análisis de Varianza , Conjugación Genética , Elementos Transponibles de ADN , Ambiente , Transferencia de Gen Horizontal , Mercurio/toxicidad , Operón , Fenotipo , Plásmidos/efectos de los fármacos , Pseudomonas fluorescens/efectos de los fármacosRESUMEN
Bacteria-plasmid associations can be mutualistic or antagonistic depending on the strength of positive selection for plasmid-encoded genes, with contrasting outcomes for plasmid stability. In mutualistic environments, plasmids are swept to high frequency by positive selection, increasing the likelihood of compensatory evolution to ameliorate the plasmid cost, which promotes long-term stability. In antagonistic environments, plasmids are purged by negative selection, reducing the probability of compensatory evolution and driving their extinction. Here we show, using experimental evolution of Pseudomonas fluorescens and the mercury-resistance plasmid, pQBR103, that migration promotes plasmid stability in spatially heterogeneous selection environments. Specifically, migration from mutualistic environments, by increasing both the frequency of the plasmid and the supply of compensatory mutations, stabilized plasmids in antagonistic environments where, without migration, they approached extinction. These data suggest that spatially heterogeneous positive selection, which is common in natural environments, coupled with migration helps to explain the stability of plasmids and the ecologically important genes that they encode.
Asunto(s)
Transferencia de Gen Horizontal , Plásmidos/genética , Pseudomonas fluorescens/genética , Simbiosis , Ambiente , Mercurio , Selección GenéticaRESUMEN
Determining phenotype from genetic data is a fundamental challenge. Identification of emerging antigenic variants among circulating influenza viruses is critical to the vaccine virus selection process, with vaccine effectiveness maximized when constituents are antigenically similar to circulating viruses. Hemagglutination inhibition (HI) assay data are commonly used to assess influenza antigenicity. Here, sequence and 3-D structural information of hemagglutinin (HA) glycoproteins were analyzed together with corresponding HI assay data for former seasonal influenza A(H1N1) virus isolates (1997-2009) and reference viruses. The models developed identify and quantify the impact of eighteen amino acid substitutions on the antigenicity of HA, two of which were responsible for major transitions in antigenic phenotype. We used reverse genetics to demonstrate the causal effect on antigenicity for a subset of these substitutions. Information on the impact of substitutions allowed us to predict antigenic phenotypes of emerging viruses directly from HA gene sequence data and accuracy was doubled by including all substitutions causing antigenic changes over a model incorporating only the substitutions with the largest impact. The ability to quantify the phenotypic impact of specific amino acid substitutions should help refine emerging techniques that predict the evolution of virus populations from one year to the next, leading to stronger theoretical foundations for selection of candidate vaccine viruses. These techniques have great potential to be extended to other antigenically variable pathogens.
Asunto(s)
Glicoproteínas Hemaglutininas del Virus de la Influenza/genética , Subtipo H1N1 del Virus de la Influenza A/inmunología , Gripe Humana/virología , Infecciones por Orthomyxoviridae/inmunología , Filogenia , Sustitución de Aminoácidos , Animales , Variación Antigénica/genética , Variación Antigénica/inmunología , Antígenos Virales/genética , Antígenos Virales/inmunología , Humanos , Vacunas contra la Influenza/genética , Vacunas contra la Influenza/inmunología , RatonesRESUMEN
The new complexes [Ru(TAP)2 (11-CN-dppz)]2+ , [Ru(TAP)2 (11-Br-dppz)]2+ and [Ru(TAP)2 (11,12-diCN-dppz)]2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photo-oxidising complex [Ru(TAP)2 (dppz)]2+ promote π-stacking interactions and ordered binding to DNA, as shown by X-ray crystallography. The structure of Λ-[Ru(TAP)2 (11-CN-dppz)]2+ with the DNA duplex d(TCGGCGCCGA)2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11-Br and 11,12-dinitrile derivatives, highlighting the stabilization of syn guanine by this enantiomer when the terminal base pair is GC. In contrast the AT base pair has the normal Watson-Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz-purine interaction. The asymmetry of the cavity highlights the importance of the purine-dppz-purine stacking interaction.
Asunto(s)
Complejos de Coordinación/química , ADN/química , Nitrilos/química , Rutenio/química , Emparejamiento Base , Cristalografía por Rayos X , Guanina/química , Sustancias Intercalantes/química , Ligandos , Modelos Químicos , Estructura Molecular , Purinas/química , Estereoisomerismo , Relación Estructura-Actividad , Rayos XRESUMEN
[Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its 'light-switch' properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures are available, most include the Λ enantiomer and there is very little structural information about binding of the Δ enantiomer. Here, we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data.
Asunto(s)
ADN/química , Luz , Modelos Moleculares , Rutenio/química , Sitios de Unión , ADN/metabolismo , Conformación Molecular , Motivos de Nucleótidos , Compuestos Organometálicos/química , Rutenio/metabolismoRESUMEN
Bacteria engage in a complex network of ecological interactions, which includes mobile genetic elements (MGEs) such as phages and plasmids. These elements play a key role in microbial communities as vectors of horizontal gene transfer but can also be important sources of selection for their bacterial hosts. In natural communities, bacteria are likely to encounter multiple MGEs simultaneously and conflicting selection among MGEs could alter the bacterial evolutionary response to each MGE. Here, we test the effect of interactions with multiple MGEs on bacterial molecular evolution in the tripartite interaction between the bacterium, Pseudomonas fluorescens, the lytic bacteriophage, SBW25φ2, and conjugative plasmid, pQBR103, using genome sequencing of experimentally evolved bacteria. We show that individually, both plasmids and phages impose selection leading to bacterial evolutionary responses that are distinct from bacterial populations evolving without MGEs, but that together, plasmids and phages impose conflicting selection on bacteria, constraining the evolutionary responses observed in pairwise interactions. Our findings highlight the likely difficulties of predicting evolutionary responses to multiple selective pressures from the observed evolutionary responses to each selective pressure alone. Understanding evolution in complex microbial communities comprising many species and MGEs will require that we go beyond studies of pairwise interactions.
Asunto(s)
Bacteriófagos/genética , Evolución Molecular , Plásmidos/genética , Pseudomonas fluorescens/genética , Pseudomonas fluorescens/virología , Selección Genética , Transferencia de Gen HorizontalRESUMEN
Conjugative plasmids are widespread and play an important role in bacterial evolution by accelerating adaptation through horizontal gene transfer. However, explaining the long-term stability of plasmids remains challenging because segregational loss and the costs of plasmid carriage should drive the loss of plasmids though purifying selection. Theoretical and experimental studies suggest two key evolutionary routes to plasmid stability: First, the evolution of high conjugation rates would allow plasmids to survive through horizontal transmission as infectious agents, and second, compensatory evolution to ameliorate the cost of plasmid carriage can weaken purifying selection against plasmids. How these two evolutionary strategies for plasmid stability interact is unclear. Here, we summarise the literature on the evolution of plasmid stability and then use individual based modelling to investigate the evolutionary interplay between the evolution of plasmid conjugation rate and cost amelioration. We find that, individually, both strategies promote plasmid stability, and that they act together to increase the likelihood of plasmid survival. However, due to the inherent costs of increasing conjugation rate, particularly where conjugation is unlikely to be successful, our model predicts that amelioration is the more likely long-term solution to evolving stable bacteria-plasmid associations. Our model therefore suggests that bacteria-plasmid relationships should evolve towards lower plasmid costs that may forestall the evolution of highly conjugative, 'infectious' plasmids.
Asunto(s)
Bacterias/genética , Conjugación Genética , Regulación Bacteriana de la Expresión Génica , Transferencia de Gen Horizontal , Modelos Estadísticos , Plásmidos/química , Bacterias/metabolismo , Evolución Biológica , Cromosomas Bacterianos/química , Cromosomas Bacterianos/metabolismo , Aptitud Genética , Sitios Genéticos , Mutagénesis Insercional , Plásmidos/metabolismo , Selección GenéticaRESUMEN
X-ray crystal structures of three Λ-[Ru(L)2 dppz]2+ complexes (dppz=dipyridophenazine; L=1,10-phenanthroline (phen), 2,2'-bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5'-CG-3' step. The compounds bind through canted intercalation, with the binding angle determined by the guanine NH2 group, in contrast to symmetrical intercalation previously observed at 5'-TA-3' sites. This result suggests that canted intercalation is preferred at 5'-CG-3' sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5'-CG-3' step could give rise to a longer luminescence lifetime than canted intercalation.