The truncated AXIN1 isoform promotes hepatocellular carcinoma metastasis through SRSF9-mediated exon 9 skipping.

Axis inhibitor protein 1 (AXIN1) is a protein recognized for inhibiting tumor growth and is commonly involved in cancer development. In this study, we explored the potential molecular mechanisms that connect alternative splicing of AXIN1 to the metastasis of hepatocellular carcinoma (HCC). Transcriptome sequencing, RT‒PCR, qPCR and Western blotting were utilized to determine the expression levels of AXIN1 in human HCC tissues and HCC cells. The effects of the AXIN1 exon 9 alternative splice isoform and SRSF9 on the migration and invasion of HCC cells were assessed through wound healing and Transwell assays, respectively. The interaction between SRSF9 and AXIN1 was investigated using UV crosslink RNA immunoprecipitation, RNA pulldown, and RNA immunoprecipitation assays. Furthermore, the involvement of the AXIN1 isoform and SRSF9 in HCC metastasis was validated in a nude mouse model. AXIN1-L (exon 9 including) expression was downregulated, while AXIN1-S (exon 9 skipping) was upregulated in HCC. SRSF9 promotes the production of AXIN1-S by interacting with the sequence of exons 8 and 10 of AXIN1. AXIN1-S significantly promoted HCC cells migration and invasion by activating the Wnt pathway, while the opposite effects were observed for AXIN1-L. In vivo experiments demonstrated that AXIN1-L inhibited HCC metastasis, whereas SRSF9 promoted HCC metastasis in part by regulating the level of AXIN1-S. AXIN1, a tumor suppressor protein that targets the AXIN1/Wnt/ß-catenin signaling axis, may be a promising prognostic factor and a valuable therapeutic target for HCC.

A Six-Membered Ring Molecular Sieve Achieved by a Reconstruction Route.

Zeolite molecular sieves with at least eight-membered rings are widely applied in industrial applications, while zeolite crystals with six-membered rings are normally regarded as useless products due to the occupancy of the organic templates and/or inorganic cation in the micropores that could not be removed. Herein, we showed that a novel six-membered ring molecular sieve (ZJM-9) with fully open micropores could be achieved by a reconstruction route. The mixed gas breakthrough experiments such as CH3OH/H2O, CH4/H2O, CO2/H2O, and CO/H2O at 25 °C showed that this molecular sieve was efficient for selective dehydration. Particularly, a lower desorption temperature (95 °C) of ZJM-9 than that (250 °C) of the commercial 3A molecular sieve might offer an opportunity for saving more energy in dehydration processes.

Design of an Organic Template for Synthesizing ITR Zeolites under Ge-Free Conditions.

Germanosilicate zeolites with various structures have been extensively synthesized, but the syntheses of corresponding zeolite structures in the absence of germanium species remain a challenge. One such example is an ITR zeolite structure, which is a twin of the ITH zeolite structure. Through the modification of a classic organic template for synthesizing ITH zeolites and thus designing a new organic template with high compatibility to ITR zeolite assisted by theoretical simulation, we, for the first time, show the Ge-free synthesis of an ITR structure including pure silica, aluminosilicate, and borosilicate ITR zeolites. These materials have high crystallinity, corresponding to an ITR content of more than 95%. In the methanol-to-propylene (MTP) reaction, the obtained aluminosilicate ITR zeolite exhibits excellent propylene selectivity and a long lifetime compared with conventional aluminosilicate ZSM-5 zeolite. The strategy for the design of organic templates might offer a new opportunity for rational syntheses of novel zeolites and, thus, the development of highly efficient zeolite catalysts in the future.

Broadband source-driven resonant micro-optic gyroscope based on a multi-turn waveguide-type ring resonator.

The resonant micro-optic gyroscope (RMOG) is one of the most promising candidates for chip-scale optoelectronic gyroscopes. A broadband source-driven RMOG based on a multi-turn waveguide-type ring resonator (WRR) has been proposed and demonstrated. The theoretical sensitivity is enhanced with the multi-turn structure, while the parasitic backscattering can be resolved by the use of the broadband source, thus greatly improving the long-term bias stability of the RMOG. We also reduce the relative intensity noise (RIN)-induced error of the broadband source at the gyro output by optimizing the number of loop turns of the WRR, and improve the angle random walk (ARW) by 4.8 dB compared with the case of a single-turn WRR. Finally, a bias stability of 1°/h is obtained with a 5-turn WRR of 4.05 cm diameter, achieving the tactical-grade resolution. To the best of our knowledge this is the best result reported to date for an RMOG of similar size.

Navigation-grade three-axis resonant fiber-optic gyroscope employing a multiplexed source.

A three-axis gyroscope is a vital component of an inertial measurement unit that can measure the rotation rates in three directions simultaneously. A novel three-axis resonant fiber-optic gyroscope (RFOG) configuration with a multiplexed broadband light source is proposed and demonstrated. The output light from the two vacant ports of the main gyroscope is reused as drive sources for the other two axial gyroscopes, which effectively improve the power utilization of the source. The interference between different axial gyroscopes is effectively avoided by optimizing the lengths of three fiber-optic ring resonators (FRRs) rather than by inserting other optical elements in the multiplexed link. With the optimal lengths, the influence of the input spectrum on the multiplexed RFOG is suppressed and a theoretical temperature dependence of the bias error as low as 1.08 × 10-4 °/h/°C is obtained. Finally, a navigation-grade three-axis RFOG is demonstrated with a fiber coil length of ∼100 m for each FRR.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Investigating Media Coverage and Public Perceptions of the HPV Vaccine in China - A Content Analysis of Weibo Posts.

Human papillomavirus (HPV) is one of the most common sexually transmitted infections worldwide. The HPV vaccination has been widely advocated around the world since the vaccine is beneficial in avoiding diseases, including some sexually transmitted diseases, brought on by HPV infections. For most Chinese, the HPV vaccine is still a relatively new concept, having only been made available to the general public in 2016. Despite the vaccine's increased prominence, there is still a lack of investigation about how the public is influencing the conversation about HPV vaccines and the public's perception of this vaccine. With the theoretical construct of the Health Belief Model, this study conducts both quantitative and qualitative content analysis to investigate the existing media narratives around HPV vaccines in China and the changes in public opinion by looking at users' contributions on Weibo, one of China's most popular social networking sites. It was found that different groups of Weibo users had contributed to diverse narratives surrounding HPV vaccination. Though the public awareness of HPV vaccination had been improved along with increasingly active communication practices and enhanced public health services, public knowledge about HPV remains inadequate. Therefore, to facilitate the popularisation of HPV related knowledge, more effort should be invested in tailoring and disseminating messages that communicate responsive and comprehensive HPV related information.

Design of a Small Organic Template for the Synthesis of Self-Pillared Pentasil Zeolite Nanosheets.

Zeolite nanosheets with excellent mass transfer are attractive, but their successful syntheses are normally resulted from a huge number of experiments. Here, we show the design of a small organic template for the synthesis of self-pillared pentasil (SPP) zeolite nanosheets from theoretical calculations in interaction energies between organic templates and pentasil zeolite skeletons. As expected, the SPP zeolite nanosheets with the thickness at 10-20 nm have been synthesized successfully. Characterizations show that the SPP zeolite nanosheets with about 90% MFI and 10% MEL structures have good crystallinity, the house-of-card morphology, large surface area, and fully four-coordinated aluminum species. More importantly, methanol-to-propylene tests show that the SPP zeolite nanosheets exhibit much higher propylene selectivity and longer reaction lifetime than conventional ZSM-5 zeolite. These results offer a good opportunity to develop highly efficient zeolite catalysts in the future.

Resonant fiber optic gyroscope using a reciprocal modulation and double demodulation technique.

A resonant fiber optic gyroscope (RFOG) using a reciprocal modulation and double demodulation technique based on a single laser source is proposed and demonstrated. The effect of the residual amplitude modulation of the phase modulator is well suppressed thanks to the reciprocal modulation and demodulation. On this basis, the backscattering noise is also eliminated by the double demodulation process. The long-term bias stability of the RFOG is successfully improved to 0.2°/h for a test time of 45 hours.

Reduction of relative intensity noise in a broadband source-driven RFOG using a high-frequency modulation technique.

A broadband source-driven resonant fiber-optic gyroscope (RFOG) can reduce coherence-related noise, thus achieving a better sensitivity with a much simpler configuration than the traditional system with a coherent source. Its detection sensitivity, however, is still limited by the excess relative intensity noise (RIN) of the broadband source. In this paper, the RIN error mechanism in this broadband source-driven RFOG is revealed and countermeasures are presented. We demonstrate that the use of a high-finesse fiber-optic ring resonator and a high-frequency modulation-demodulation technique can reduce the RIN-induced error. It is indicated that the optimal modulation parameters can provide a RIN-induced error reduction of 6.1 dB, allowing the broadband source-driven RFOG to operate near the shot-noise-limited theoretical sensitivity. With the optimal high-frequency modulation-demodulation technique, an angle random walk of 0.0013°/√h is achieved with a 200-m-long fiber-optic ring resonator of 7.6 cm diameter. This is the best result reported to date, to the best of our knowledge, for fiber-optic gyroscopes of this size.

Performance of a resonant fiber-optic gyroscope based on a broadband source.

A resonant fiber-optic gyroscope (RFOG) based on a broadband source can avoid the fundamental drawback of coherence detection processing while possessing the greater sensitivity afforded by the finesse of the fiber-optic ring resonator. In this paper, the basic operation principle is presented and demonstrated in detail, and various noise sources, as well as the temperature effect encountered in this broadband source-driven RFOG, are studied and analyzed. Then a combined modulation technique is proposed to suppress the residual backscattering noise. To further reduce the effect of temperature transience, an asymmetric fiber ring resonator is designed. In the experiment, a bias stability of 0.01°/h is successfully demonstrated with a 100 m-long fiber ring resonator of 8 cm diameter in a laboratory environment without temperature control.

Cerium oxide nanoparticle conjugation to microRNA-146a mechanism of correction for impaired diabetic wound healing.

Diabetic wounds represent a significant healthcare burden and are characterized by impaired wound healing due to increased oxidative stress and persistent inflammation. We have shown that CNP-miR146a synthesized by the conjugation of cerium oxide nanoparticles (CNP) to microRNA (miR)-146a improves diabetic wound healing. CNP are divalent metal oxides that act as free radical scavenger, while miR146a inhibits the pro-inflammatory NFκB pathway, so CNP-miR146a has a synergistic role in modulating both oxidative stress and inflammation. In this study, we define the mechanism(s) by which CNP-miR146a improves diabetic wound healing by examining immunohistochemical and gene expression analysis of markers of inflammation, oxidative stress, fibrosis, and angiogenesis. We have found that intradermal injection of CNP-miR146a increases wound collagen, enhances angiogenesis, and lowers inflammation and oxidative stress, ultimately promoting faster closure of diabetic wounds.

Lung function improves after delayed treatment with CNP-miR146a following acute lung injury.

Acute respiratory distress syndrome (ARDS) is a highly morbid pulmonary disease characterized by hypoxic respiratory failure. Its pathogenesis is characterized by unrestrained oxidative stress and inflammation, with long-term sequelae of pulmonary fibrosis and diminished lung function. Unfortunately, prior therapeutic ARDS trials have failed and therapy is limited to supportive measures. Free radical scavenging cerium oxide nanoparticles (CNP) conjugated to the anti-inflammatory microRNA-146a (miR146a), termed CNP-miR146a, have been shown to prevent acute lung injury in a pre-clinical model. In this study, we evaluated the potential of delayed treatment with CNP-miR146a at three or seven days after injury to rescue the lung from acute injury. We found that intratracheal CNP-miR146a administered three days after injury lowers pulmonary leukocyte infiltration, reduce inflammation and oxidative stress, lower pro-fibrotic gene expression and collagen deposition in the lung, and ultimately improve pulmonary function.

Discovery of Small Molecule Activators of Chemokine Receptor CXCR4 That Improve Diabetic Wound Healing.

Diabetes produces a chronic inflammatory state that contributes to the development of vascular disease and impaired wound healing. Despite the known individual and societal impacts of diabetic ulcers, there are limited therapies effective at improving healing. Stromal cell-derived factor 1α (SDF-1α) is a CXC chemokine that functions via activation of the CXC chemokine receptor type 4 (CXCR4) receptor to recruit hematopoietic cells to locations of tissue injury and promote tissue repair. The expression of SDF-1α is reduced in diabetic wounds, suggesting a potential contribution to wound healing impairment and presenting the CXCR4 receptor as a target for therapeutic investigations. We developed a high-throughput ß-arrestin recruitment assay and conducted structure-activity relationship (SAR) studies to screen compounds for utility as CXCR4 agonists. We identified CXCR4 agonist UCUF-728 from our studies and further validated its activity in vitro in diabetic fibroblasts. UCUF-728 reduced overexpression of miRNA-15b and miRNA-29a, negative regulators of angiogenesis and type I collagen production, respectively, in diabetic fibroblasts. In vivo, UCUF-728 reduced the wound closure time by 36% and increased the evidence of angiogenesis in diabetic mice. Together, this work demonstrates the clinical potential of small molecule CXCR4 agonists as novel therapies for pathologic wound healing in diabetes.

Single-Cell Transcriptome Analysis Reveals Intratumoral Heterogeneity in ccRCC, which Results in Different Clinical Outcomes.

Clear-cell renal cell carcinoma (ccRCC) is the most common histological type of RCC. To investigate the intratumoral heterogeneity of ccRCC, we analyzed single-cell RNA-sequencing data and identified 15 major cell types, along with 39 subgroups of cells derived from tumor or non-malignant tissues, and confirmed their presence by immunofluorescence staining in tissue chips. In this study, we verified that T cell exhaustion was the key factor responsible for the immunosuppressive property of ccRCC tissues, which was significantly related to poor prognosis. We also found that abnormal metabolic patterns occurred not only in cancer cells, but also in tumor-infiltrating stromal cells. Based on the fraction of each cell cluster detected by CIBERSORTx, 533 patients from The Cancer Genome Atlas (TCGA) KIRC dataset were divided into three groups. One group, which showed a lesser proportion of activated CD8+ cells and greater proportion of exhausted CD8+ cells, was associated with a poor prognosis. Hence, the blockade of immunosuppressive checkpoints, not only PD-1, but also LAG3, TIM-3, and other inhibitory checkpoints, could serve as a potential target for ccRCC immunotherapy. Our work will further the understanding of the heterogeneity among ccRCC tissues and provide novel strategies for treating ccRCC.

Cerium oxide nanoparticle delivery of microRNA-146a for local treatment of acute lung injury.

Acute respiratory distress syndrome (ARDS) is a devastating pulmonary disease with significant in-hospital mortality and is the leading cause of death in COVID-19 patients. Excessive leukocyte recruitment, unregulated inflammation, and resultant fibrosis contribute to poor ARDS outcomes. Nanoparticle technology with cerium oxide nanoparticles (CNP) offers a mechanism by which unstable therapeutics such as the anti-inflammatory microRNA-146a can be locally delivered to the injured lung without systemic uptake. In this study, we evaluated the potential of the radical scavenging CNP conjugated to microRNA-146a (termed CNP-miR146a) in preventing acute lung injury (ALI) following exposure to bleomycin. We have found that intratracheal delivery of CNP-miR146a increases pulmonary levels of miR146a without systemic increases, and prevents ALI by altering leukocyte recruitment, reducing inflammation and oxidative stress, and decreasing collagen deposition, ultimately improving pulmonary biomechanics.

LncRNA MALAT1 Modulates TGF-ß1-Induced EMT in Keratinocyte.

One of the major complications in diabetes is impaired wound healing. Unfortunately, effective therapies are currently lacking. Epithelial to mesenchymal transition (EMT) is a critical process involved in cutaneous wound healing. In response to injury, EMT is required to activate and mobilize stationary keratinocytes in the skin toward the wound bed, which allows for re-epithelialization. This process is stalled in diabetic wounds. In this study, we investigate the role of long non-coding RNA (lncRNA), MALAT1, in transforming growth factor beta 1(TGF-ß1)-induced EMT of human keratinocyte (HaCaT) cells. Initially, we detected MALAT1 and TGF-ß1 expression in non-diabetic and diabetic wounds and found that these expression are significantly up-regulated in diabetic wounds. Then, HaCaT cells were cultured and exposed to TGF-ß1. The EMT of HaCaT cells were confirmed by the increased expression of CDH2, KRT10, and ACTA2, in addition to the down-regulation of CDH1. Knockdown of MALAT1 was achieved by transfecting a small interfering RNA (SiRNA). MALAT1 silencing attenuates TGFß1-induced EMT. Mechanistically, MALAT1 is involved in TGF-ß1 mediated EMT through significantly induced ZEB1 expression, a critical transcription factor for EMT. In summary, lncRNA MALAT1 is involved in TGFß1-induced EMT of human HaCaT cells and provides new understanding for the pathogenesis of diabetic wounds.

Surface-Enhanced Raman Scattering of Phenols and Catechols by a Molecular Analogue of Titanium Dioxide.

Surface-enhanced Raman spectroscopy (SERS) of semiconducting TiO2 was used for studying binding modes and surface reactions of molecules bound at the interface but is generally limited by low signal intensity and lack of authentic structural information. Here, we report a representative titanium-oxide cluster (TOC), i.e., Ti17O24(OiC3H7)20 (Ti17), combines the benefits from both precise structures and intense SERS signals by providing a titania surface. According to the single-crystal X-ray diffraction analysis, phenols and catechols are vertically attached via σ-bonds to the certain sites of Ti17. Ti17 brings about much more intense Raman signals than the reference TiO2 NPs, leading to 10-5-10-6 M analyte detection (enhancement factors are 103-105). The contributions of focusing effect, CHEM effect and resonance mechanism, all of which are found responsible for the higher SERS activity of Ti17 than the reference TiO2 NPs, in the SERS by Ti17 are quantitatively analyzed. This study suggests SERS by TOCs may be promising for detection purposes and structural studies of environmentally and catalytically relevant molecules with fewer assumptions regarding molecular structures or binding mechanisms.

Binding Modes of Salicylic Acids to Titanium Oxide Molecular Surfaces.

A set of titanium oxide clusters (TOCs) comprised of 4 to 16 Ti atoms are synthesized with substituted salicylates (SSAs). The interfacial coordination environment of these SSA/Ti oxide hybrids are surveyed and found to be limited to four binding modes, with the bridging chelate mode being the most common one. The SSA-functionalized TOCs show strong visible light absorption properties. The contribution of the SSAs in the frontier orbitals of the TOCs are analyzed by using TD-DFT calculations based on the molecular geometries determined by X-ray diffraction. For TOCs of relatively high O/Ti ratio, the SSAs narrow the band gap of the TOCs by contributing solely to the HOMOs. Both binding modes and locations of the SSAs are important for the roles of SSAs in changing the HOMOs and thereby the absorption onsets.

Bilateral and multiple sub-internal limiting membrane hemorrhages in a familial retinal arteriolar tortuosity patient by Valsalva-like mechanism: an observational case report.

BACKGROUND: Bilateral and multiple Valsalva-related sub-internal limiting membrane (ILM) hemorrhages in a familial retinal arteriolar tortuosity (FRAT) patient is rare, and we treated this patient by both observation and Neodymium yttrium aluminum garnet (Nd: YAG) laser membranotomy methods. CASE PRESENTATION: A 13-year-old female student presented with sudden visual loss and central scotoma in both eyes after running 800 m at the school gym. The examination revealed six sub-ILM hemorrhages with the biggest hemorrhage measuring approximately 1.5-disc diameters (DD) in the right eye and two sub-ILM hemorrhages with the biggest one measuring 5.5 DD in the left eye. The patient was diagnosed as having Valsalva retinopathy associated with FRAT. Nd: YAG laser membranotomy was performed at the biggest hemorrhages and the rest hemorrhages were treated with observation in both eyes. The visual acuity recovered to 20/16 in the right eye and 20/20 in the left eye. Epiretinal membrane (ERM) formation was observed in the left eye. CONCLUSIONS: Nd: YAG laser could be considered for treating premacular hemorrhage in FRAT patient especially when a quick vision recovery was needed. This is the first reported case of a FRAT patient suffering from bilateral and multiple Valsalva-related sub-ILM hemorrhages which were treated by both observation and Nd: YAG laser treatment.