Height, body mass index, physical activity, and risk of colorectal cancer in relation to expression of insulin receptor: The Japan Public Health Center-based Prospective Study.

To ascertain the involvement of insulin receptors (IRs) in colorectal carcinogenesis, we investigated the association of height, body mass index (BMI), and physical activity with colorectal cancer (CRC) and two subtypes of CRC according to the expression level of IR. We utilized data from a large-scale, population-based prospective cohort study of 18,158 middle-aged and elderly subjects in Akita and Okinawa, Japan. In the statistical analysis, we used the Cox proportional hazards model and estimated hazard ratios (HRs) and 95% confidence intervals (CIs) for the risk of CRC and its subtypes as defined by immunohistochemistry of IRß, a transmembrane subunit of IR. In the IRß-defined subtypes, height showed no apparent association with the risk of IRß-positive CRC. In contrast, a multivariable HR of IRß-positive CRC was 1.77 (95% CI = 1.04-3.03) with a BMI of ≥30.0 kg/m2 (i.e., obesity), compared to a BMI of <25.0 kg/m2. Further, an increase in physical activity was significantly associated with decreased risk of IRß-positive CRC (multivariable HR per 5 METs-hour/day = 0.93, 95% CI = 0.88-0.99). Meanwhile, we found no significant association between any exposure and IRß-negative CRC. Likewise, heterogeneity between the two subtypes of CRC was not statistically significant. These findings imply that obesity and physical activity exert promoting and suppressing effects on the development of CRC expressing IRs, respectively.

[A Case of Successful Treatment of Small Cell Carcinoma of the Bladder with Pembrolizumab].

Small cell carcinoma of the bladder (SCCB) is a rare cancer that accounts for approximately 1% of primary malignant bladder tumors. It is highly malignant and has a poor prognosis. Similar to small cell lung cancer, platinum-based chemotherapy is recommended as the first-line therapy, and amrubicin (AMR) is recommended as the second-line therapy, but there is no established therapy after the second line. We report a case of SCCB that was refractory to multiple chemotherapies but responded to pembrolizumab. A 77-year-old male, diagnosed with clinical stage T3N0M0 small cell carcinoma and invasive urothelial carcinoma by transurethral resection of bladder tumor (TURBT), underwent robot-assisted radical cystectomy after three cycles of neoadjuvant cisplatin-irinotecan chemotherapy, and pathological examination revealed only small cell carcinoma in his cystectomy specimen. After three courses of adjuvant carboplatin-etoposide chemotherapy, the patient developed liver and bone metastases. Furthermore, after two courses of amrubicin, we started pembrolizumab due to the progression of metastases. Metastases decreased after starting pembrolizumab and continued to decrease after discontinuation because of immunerelated adverse events (irAEs). Therefore, pembrolizumab may be an option for the treatment of refractory SCCB.

A case of lung carcinoma with a unique biphasic feature: Implications for histogenesis of "fake mucoepidermoid carcinoma" developing in the peripheral lung.

We present a case of lung carcinoma with a unique biphasic feature. The patient was a 67-year-old male smoker with idiopathic pulmonary fibrosis (IPF). A subpleural tumor in the left lower lobe, embedded in fibrotic tissue, was resected. Histologically, the tumor consisted of major and minor components of mucoepidermoid carcinoma (MEC) and surrounding conventional lepidic adenocarcinoma, respectively. Both components had the same TP53 somatic mutation (p.V157F) but not Mastermind-like 2 (MAML2) gene rearrangement. The two components may have developed from an identical origin. The tumor could be trans-differentiating from lepidic adenocarcinoma to MEC, possibly promoted by IPF-induced tissue damage. The final diagnosis was "adenosquamous carcinoma with mucoepidermoid-like features (that may originate from lepidic adenocarcinoma)." This case has implications for the potential histogenesis of peripheral lung MEC. Over time, the MEC would expand and outgrow the lepidic adenocarcinoma, making it impossible to distinguish between fake and true MEC. The present case suggests that peripheral MEC could differ from proximal MEC in its histogenesis and molecular genetics. Thus, careful examination is necessary to diagnose peripheral lung MEC, particularly in patients with interstitial lung diseases.

[A Case of Desmoid Fibromatosis of the Small Intestinal Mesentery Institutions].

The patient was a 27-year-old man. He was referred to our hospital because he was aware of a mass in his abdomen. An abdominal ultrasound showed a 70-mm mass lesion. Enhanced computed tomography showed a 70-mm mass with well- defined margins and heterogeneous internal enhancement near the proximal jejunum. The patient was diagnosed with a suspected primary submucosal tumor of the duodenum or small intestine, and surgery was planned to diagnose and treat the tumor. The tumor was located in the upper jejunal mesentery, and tumor resection and partial small bowel resection were performed. Histopathological examination revealed proliferation of spindle-shaped cells without karyomitosis, and mixed collagen fibers in the tissue. Immunohistochemistry showed ß-catenin(+), SMA(+), AE1/AE3(-), KIT(-), CD34(-), and S-100(-). Based on these findings, we diagnosed primary desmoid fibromatosis of the small intestinal mesentery. In this report, we describe a case of primary desmoid fibromatosis of the small intestinal mesentery with a review of the literature.

Neuroendocrine tumor theranostics.

Theranostics is a term coined by combining the words "therapeutics" and "diagnostics," referring to single chemical entities developed to deliver therapy and diagnosis simultaneously. Neuroendocrine tumors are rare cancers that occur in various organs of the body, and they express neuroendocrine factors such as chromogranin A and somatostatin receptor. Somatostatin analogs bind to somatostatin receptor, and when combined with diagnostic radionuclides, such as gamma-emitters, are utilized for diagnosis of neuroendocrine tumor. Somatostatin receptor scintigraphy when combined with therapeutic radionuclides, such as beta-emitters, are effective in treating neuroendocrine tumor as peptide receptor radionuclide therapy. Somatostatin receptor scintigraphy and peptide receptor radionuclide therapy are some of the most frequently used and successful theranostics for neuroendocrine tumor. In Japan, radiopharmaceuticals are regulated under a complex law system, creating a significant drug lag, which is a major public concern. It took nearly 10 years to obtain the approval for somatostatin receptor scintigraphy and peptide receptor radionuclide therapy use by the Japanese government. In 2021, 111 Lu-DOTATATE (Lutathera), a drug for peptide receptor radionuclide therapy, was covered by insurance in Japan. In this review, we summarize the history of the development of neuroendocrine tumor theranostics and theranostics in general, as therapeutic treatment for cancer in the future. Furthermore, we briefly address the Japanese point of view regarding the development of new radiopharmaceuticals.

Deficiency of the kidney tubular angiotensin II type1 receptor-associated protein ATRAP exacerbates streptozotocin-induced diabetic glomerular injury via reducing protective macrophage polarization.

Although activation of the renin-angiotensin system and of its glomerular components is implicated in the pathogenesis of diabetic nephropathy, the functional roles of the tubular renin-angiotensin system with AT1 receptor signaling in diabetic nephropathy are unclear. Tissue hyperactivity of the renin-angiotensin system is inhibited by the angiotensin II type 1 receptor-associated protein ATRAP, which negatively regulates receptor signaling. The highest expression of endogenous ATRAP occurs in the kidney, where it is mainly expressed by tubules but rarely in glomeruli. Here, we found that hyperactivation of angiotensin II type 1 receptor signaling in kidney tubules exacerbated diabetic glomerular injury in a mouse model of streptozotocin-induced diabetic nephropathy. These phenomena were accompanied by decreased expression of CD206, a marker of alternatively activated and tissue-reparative M2 macrophages, in the kidney tubulointerstitium. Additionally, adoptive transfer of M2- polarized macrophages into diabetic ATRAP-knockout mice ameliorated the glomerular injury. As a possible mechanism, the glomerular mRNA levels of tumor necrosis factor-α and oxidative stress components were increased in diabetic knockout mice compared to non-diabetic knockout mice, but these increases were ameliorated by adoptive transfer. Furthermore, proximal tubule-specific ATRAP downregulation reduced tubulointerstitial expression of CD206, the marker of M2 macrophages in diabetic mice. Thus, our findings indicate that tubular ATRAP-mediated functional modulation of angiotensin II type 1 receptor signaling modulates the accumulation of tubulointerstitial M2 macrophages, thus affecting glomerular manifestations of diabetic nephropathy via tubule-glomerular crosstalk.

Prevalence and risk factors of preoperative venous thromboembolism in patients with malignant musculoskeletal tumors: an analysis based on D-dimer screening and imaging.

BACKGROUND: Venous thromboembolism (VTE) is a major complication in patients with malignant tumors and orthopedic disorders. Although it is known that patients undergoing surgery for malignant musculoskeletal tumor are at an increased risk of thromboembolic events, only few studies have investigated this risk in detail. Therefore, the aim of this study was to determine the prevalence and risk factors for preoperative VTE in malignant musculoskeletal tumors patients. METHODS: We retrospectively reviewed the medical records of 270 patients who underwent surgical procedures, including biopsy for malignant musculoskeletal tumor, have undergone measurements of preoperative D-dimer levels, and were subsequently screened for VTE by lower extremity venous ultrasonography and/or contrast-enhanced computed tomography scans. Statistical analyses were performed to examine the prevalence and risk factors for VTE. Receiver operating characteristic (ROC) analysis was performed to verify the D-dimer cutoff value for the diagnosis of VTE. RESULTS: Overall, 199 patients (103 with primary soft tissue sarcomas, 38 with primary bone sarcomas, 46 with metastatic tumors, and 12 with hematologic malignancies) were included. D-dimer levels were high in 79 patients; VTE was detected in 19 patients (9.5%). Multivariate analysis indicated that age ≥ 60 years (P = 0.021) and tumor location in the lower limbs (P = 0.048) were independent risk factors for VTE. ROC analysis showed that the D-dimer cutoff value for the diagnosis of VTE was 1.53 µg/mL; the sensitivity and specificity were 89.5% and 79.4%, respectively. CONCLUSIONS: Our study indicated that age and tumor location in the lower limbs were independent risk factors for preoperative VTE in malignant musculoskeletal tumors patients. D-dimer levels were not associated with VTE in the multivariate analysis, likely because they are affected by a wide variety of conditions, such as malignancy and aging. D-dimer is useful for exclusion diagnosis because of its high sensitivity, but patients with high age and tumor location in the lower limbs are a high-risk group and should be considered for imaging evaluation such as ultrasonography regardless of D-dimer levels. TRIAL REGISTRATION: Our study was approved by the institutional review board. The registration number is B200600056 . The registration date was July 13, 2020.

Relationship between stromal regulatory T cells and the response to neoadjuvant chemotherapy for locally advanced rectal cancer.

BACKGROUND: In addition to the direct power of anticancer drugs, the effectiveness of anticancer therapy depends on the host immune function. The present study investigated whether or not the reduction rate and histological response of preoperative chemotherapy were related to the immune microenvironment surrounding a primary tumor of the rectum. METHODS: Sixty-five patients received preoperative chemotherapy followed by resection from 2012 to 2014; all of these patients were retrospectively analyzed. CD3, CD8, and FoxP3 were immunohistochemically examined as markers for T lymphocytes, cytotoxic T lymphocytes, and regulatory T lymphocytes (Treg), respectively. The correlation between the tumor-infiltrating lymphocyte composition and the tumor reduction rate and histological response to neoadjuvant chemotherapy was investigated. RESULTS: The average tumor reduction rate was 41.5% ± 18.8%. According to RECIST, 47 patients (72.3%) achieved a partial response (PR), and 1 patient (1.5%) achieved a complete response (CR). Eight patients (12.3%) showed a grade 2 histological response, and 2 (3.1%) showed a grade 3 response. A multivariate analysis demonstrated that a low Treg infiltration in stromal cell areas was significantly associated with the achievement of a PR or CR [odds ratio (OR) 7.69; 95% confidence interval (CI) 1.96-33.33; p < 0.01] and a histological grade 2 or 3 response (OR 11.11; 95% CI 1.37-98.04; p = 0.02). CONCLUSION: A low Treg infiltration in the stromal cell areas may be a marker of a good response to neoadjuvant chemotherapy in patients with locally advanced rectal cancer.

Clinical and pathological analysis of giant cell tumor of bone with denosumab treatment and local recurrence.

BACKGROUND: Giant cell tumor of bone (GCTB) is a primary bone tumor which comprises giant cells and two types of stromal cells. Recent studies have suggested therapeutic risks of denosumab. No previous studies have reported changes in serum TRACP-5b and SUVmax of 18F-FDG-PET/CT in recurred GCTB after denosumab treatment. Therefore, we assessed the relationship between clinical and pathological features of GCTB which recurred after denosumab treatment. METHODS: We retrospectively reviewed the medical records of 26 patients with GCTB who underwent curettage between 2010 and 2018. Fourteen patients treated with denosumab were defined as the denosumab group. We evaluated TRACP-5b and SUVmax values in the denosumab group. H&E staining and immunohistochemistry for H3.3 G34W were performed for pathological assessment. Twelve patients treated without denosumab were defined as the non-denosumab group and compared with denosumab group. RESULTS: The local recurrence rate in the denosumab group was 57.4%. The mean TRACP-5b and SUVmax values were significantly decreased after denosumab therapy (P < 0.001, 1077 ± 161 to 74 ± 9 mU/dL and 8.88 ± 0.40 to 3.79 ± 0.56, respectively). Both parameters significantly increased with local recurrence. H&E staining after denosumab treatment revealed the disappearance of giant cells and histological changes in stromal cells. Specimens of local recurrence subjected to H&E staining and immunohistochemistry for H3.3 G34W demonstrated almost identical features to those in the first biopsy. CONCLUSION: Although denosumab can prevent GCTB from osteolysis, local recurrence cannot be reduced by denosumab treatment. The clinical and pathological results were almost the same as those before denosumab treatment, suggesting that the changes of GCTB by denosumab are reversible.

Endocrine mucin-producing sweat gland carcinoma of the cheek.

Endocrine mucin-producing sweat gland carcinoma (EMPSGC) is a low-grade adnexal malignant neoplasm. We report a 90-year-old man who had a hard, dome-shaped tumor approximately 9 mm in diameter on the left cheek. Dermoscopy showed an overall, non-uniformly light-pink tumor with crust. The diagnosis of EMPSGC is made histologically from excisional biopsy. No signs of recurrent disease were evident at 42 months postoperatively.

RBM10-TFE3 renal cell carcinoma characterised by paracentric inversion with consistent closely split signals in break-apart fluorescence in-situ hybridisation: study of 10 cases and a literature review.

AIMS: Xp11 rearrangement in renal cell carcinoma (RCC) typically involves gene fusion to the gene encoding transcription factor E3 (TFE3), a member of the microphthalmia-associated transcription factor family on chromosome Xp11.2. Dual-colour break-apart fluorescence in-situ hybridisation (FISH) is recommended to confirm histological diagnoses. Recently, RNA-binding motif protein 10 (RBM10), encoded by a gene on chromosome Xp11.3, was identified as a chimeric partner of TFE3; thus, RBM10-TFE3 fusion results from paracentric inversion. RBM10-TFE3 RCC may yield a false-negative result in FISH analysis of TFE3 expression. The aim of the present study was to investigate the clinicopathological features of RBM10-TFE3 RCC. METHODS AND RESULTS: Ten patients with RBM10-TFE3 RCC aged 31-71 years were investigated. Histological analysis, immunostaining, dual-colour break-apart FISH for TFE3, reverse transcription polymerase chain reaction and sequencing analysis were performed. No patient had a history of exposure to chemotherapy. Two of these patients died of RCC, and three were alive but developed metastases. Microscopically, the tumours were composed of a mixed architecture of tubulocystic and papillary patterns with scattered psammoma bodies. The tumours showed strong nuclear immunoreactivity for TFE3. FISH showed consistent closely spaced split signals in the RCCs of four patients, and polysomic signals with occasional closely spaced split signals in the RCCs of six patients. Of the latter six patients, five had renal failure, and four developed tumours in kidneys subjected to haemodialysis. CONCLUSIONS: The present study suggests that the carcinogenesis of RBM10-TFE3 RCC in some, but not all, patients may be associated with chronic kidney disease. The aggressive nature of RBM10-TFE3 RCC should be considered, as five patients experienced metastases.

Myoepithelioma-like tumor of the vulvar region showing infiltrative growth and harboring only a few estrogen receptor-positive cells: A case report.

Recently, a new entity "myoepithelioma-like tumor of the vulvar region (MELTVR)" was proposed as a rare mesenchymal neoplasm arising in vulvar regions of adult women. While MELTVRs morphologically resemble soft tissue myoepitheliomas and extraskeletal myxoid chondrosarcomas, they have a unique immunohistochemical profile (positive for epithelial membrane antigen and estrogen receptor, negative for S100 protein and glial fibrillary acidic protein, and loss of INI1/SMARCB1 expression), and lack EWSR1 and NR4A3 gene rearrangement, as seen by fluorescence in situ hybridization. MELTVRs are usually well-demarcated tumors, with no reports of extensive infiltrative growth. In the current report, we present an unusual case of MELTVR showing infiltrative growth and harboring only a few estrogen receptor-positive cells, which might indicate a variation in this rare tumor.

A case report of cutaneous melanocytoma with CRTC1-TRIM11 fusion: Is CMCT distinct from clear cell sarcoma of soft tissue?

Pathological diagnosis of dermal melanocytic tumors is often problematic owing to histological resemblance. Recently, cutaneous melanocytoma with CRTC1-TRIM11 (CMCT) was added to this category. However, only six cases have been reported so far. We herein present a case of a 77-year-old Japanese man with CMCT. The patient presented a nodule in the right thigh and underwent surgical resection. Histological examination indicated a well-demarcated 6 × 5 mm-sized tumor nodule in the dermis and subcutis. The tumor was amelanotic, consisting of uniform nests and fascicles of spindled, or epithelioid cells. The melanocytic nature was evident by immunohistochemistry. The CRTC1-TRIM11 fusion was detected by TRIM11 immunostaining, chromogenic in situ hybridization, and RT-PCR/direct sequencing. He has been free from the tumor for 1 year after additional resection. The main differential diagnosis of CMCT includes primary and metastatic dermal malignant melanomas (MM) and dermal/subcutaneous clear cell sarcoma (CCS). Additionally, histological overlap with paraganglioma-like dermal melanocytic tumor was considered. Although some investigators argue that CMCT is a variant of CCS, we think it should be separated from CCS, and subcutaneous/dermal CCS should be confined to tumors with EWSR1-ATF1/ CREB1 fusion. However, longer follow-up and more case studies are needed for revealing the true prognosis of CMCT.

Giant cell tumours of bone treated with denosumab: histological, immunohistochemical and H3F3A mutation analyses.

AIMS: Denosumab, a human monoclonal antibody directed against the receptor activator of nuclear factor-κB ligand (RANKL), is a therapeutic agent for giant cell tumour of bone (GCTB). Although some studies have reported that denosumab shrinks tumours and induces bone formation, the actual effects of RANKL suppression on GCTB remain unclear. A mutation in the H3 histone family member 3A gene (H3F3A) was recently identified as a genetic signature for GCTB. The aim of this study was to investigate the histopathological features and H3F3A mutation status of GCTBs treated with denosumab. METHODS AND RESULTS: Nine biopsy-diagnosed patients with GCTB, who underwent curettage after neoadjuvant denosumab therapy, were reviewed. Immunohistochemistry for NFATc1 (an osteoclast marker), RUNX2 (an osteoblast marker) and histone H3.3 G34W (G34W, a GCTB marker) was performed; furthermore, H3F3A mutation status was examined with direct sequencing. Before therapy, GCTBs comprised NFATc1+ and RUNX2+ cells. All cases were G34W+ and contained H3F3A mutations. After therapy, the osteoclast-like giant cells disappeared. Areas of slender spindle cell proliferation and reticular woven bone that were NFATc1- and RUNX2+ replaced the lesions in various proportions. However, all post-therapy lesions still contained many G34W+ cells and harboured H3F3A mutations. Immunofluorescence double staining revealed that RUNX2+ mononuclear cells coexpressed G34W in pre-therapy and post-therapy lesions. Two patients experienced radiologically detected local recurrence within 2 years. CONCLUSIONS: Denosumab therapy effectively decreases the number of osteoclastic cells in GCTBs. However, the neoplastic cells with H3F3A mutation survive denosumab treatment and undergo dramatic histological changes in response to this agent.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

PD-1 and PD-L1 are more highly expressed in high-grade bladder cancer than in low-grade cases: PD-L1 might function as a mediator of stage progression in bladder cancer.

BACKGROUND: Bladder cancers have been characterized as a tumor group in which the immunological response is relatively well preserved. Programmed death ligand 1 (PD-L1, B7-H1, CD274) has been shown to be expressed in several malignancies, including bladder cancer. However, the clinicopathological impact of this biomarker has not yet been established. In the present study, a quantitative real-time polymerase chain reaction (qPCR) was performed using paired normal and cancerous bladder cancer tissue to investigate PD-1/PD-L1 gene expression. METHODS: We examined the mRNA expression of PD-1/PD-L1 by a qPCR using 58 pairs of normal and cancerous human bladder tissue specimens. We also examined the correlation with the expressions of the STAT1 and NFAT genes, which are thought to be upstream and downstream of the PD-L1 pathway, respectively. RESULTS: There were no significant differences between normal and cancerous tissue in the expression of the PD-1 and PD-L1 genes (p = 0.724 and p = 0.102, respectively). However, PD-1 and PD-L1 were both more highly expressed in high-grade bladder cancer than in low-grade bladder cancer (p < 0.050 and p < 0.010). PD-L1 was positively correlated with the expressions of both the STAT1 (r = 0.681, p < 0.001) and the NFATc1 genes (r = 0.444. p < 0.001). CONCLUSIONS: PD-1 and PD-L1 might be a new biomarker that correlates with the pathological grade of bladder cancer. PD-L1 might function as a mediator of stage progression in bladder cancer and STAT1-NFAT pathway might associate this function.

Intracranial epidermoid cyst with proliferative folliculosebaceous epithelium: Report of a rare case and discussion on pathogenesis.

Intracranial epidermoid cysts are rarely known to increase in size over a brief period. While malignant transformations of epidermoid cyst have been previously described, no reports to date have described rapid proliferation accompanied by mature hair follicles and sebaceous glands without malignant transformations. The present case involved a 71-year-old man who visited a local physician with disturbance of equilibrium. A mass lesion was detected at the left cerebellopontine angle and was subsequently removed. Histopathological diagnosis of this lesion was as an epidermoid cyst. Seventeen years after this initial surgery, worsened left hypoacusis, disorientation, eating disorder and gait disturbance appeared, and the patient visited the physician again. Local recurrence of the lesion was observed, and the patient was referred to our hospital for its removal. Intraoperative findings revealed a pearly white tumor, histopathologically diagnosed as an epidermoid cyst. Three years later, local recurrence was observed, and the cyst was again removed. Intraoperative findings revealed a partially pearly white tumor similar to the tumor observed during the second surgery, but the majority of the tumor was non-shiny, ochre-colored and suckable. Histopathological diagnosis was an epidermoid cyst with an epidermis-like structure. Postoperative activities of daily living were independent thereafter, but from March of the following year, he began to experience increasing difficulty in walking and subsequently visited our hospital again. Tumor recurrence was observed and was removed again in November of the same year. Intraoperative findings revealed a tumor that was primarily ochre-colored, non-shiny, brittle and suckable. The histopathological diagnosis was folliculosebaceous epithelial proliferative lesion accompanied by an epidermis-like epithelium and a differentiation into hair follicles and sebaceous gland,s and the tumor was determined to be an epidermoid cyst with proliferative folliculosebaceous epithelium.

Reactive Osteochondromatous Lesion of the Femoral Neck in a Highly Active Preadolescent Patient: Is This the Pathogenesis of a Cam Deformity?

Here, we present a rare case of a preadolescent boy with a prominent bony bump on the femoral neck. The main histological feature was concordant with a reactive osteochondromatous lesion possibly induced by repetitive microtrauma, probably because of overtraining as a soccer goalkeeper. The nature of this pathological change is consistent with the growth of a cam deformity. Especially in the preadolescent age group, we should note that repetitive use of the same joint kinematics may induce a prominent cam deformity.

Hereditary leiomyomatosis and renal cell cancer without cutaneous manifestations in two Japanese siblings.

Hereditary leiomyomatosis and renal cell cancer is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis, and an aggressive type 2 papillary renal cell carcinoma. The disease is caused by a germline mutation in the fumarate hydratase gene. We report a familial hereditary leiomyomatosis and renal cell cancer in two siblings. A 34-year-old woman underwent nephrectomy for treatment of a renal cell carcinoma. The patient's sister had been diagnosed with renal cell carcinoma at 28 years-of-age and died of the disease. Neither sister had apparent skin tumors. Histopathology of the renal cell carcinomas of the siblings showed tubulocystic and papillary architectures with high nuclear grades. Immunostaining showed no fumarate hydratase expression in either tumor. Genomic DNA sequencing of the patient showed a germline mutation in the fumarate hydratase gene (c.675delT). Although there is no epidemiological information on Asian hereditary leiomyomatosis and renal cell cancer, physicians should be aware that typical cutaneous leiomyomatosis might not always be present in patients with hereditary leiomyomatosis and renal cell cancer.

Review of hereditary leiomyomatosis renal cell carcinoma with focus on clinical and pathobiological aspects of renal tumors.

The entity of hereditary leiomyomatosis renal cell carcinoma (HLRCC)-associated RCC has been proposed and integrated into the recent International Society of Urologic Pathology (ISUP) of renal tumors. This tumor is characterized by presence of cutaneous and/or uterine leiomyomas and RCC and autosomal dominant hereditary form. Grossly, HLRCC arising in the kidney show the solid tumor with frequent partial cystic area. Microscopically, the tumor typically shows papillary RCC, type 2, with eosinophilic large nucleoli reminiscent of cytomegaloviral inclusion and perinuclear clearing/haloes. Immunohistochemically, tumor cells show the overexpression for 2SC and reduced expression of FH. Germline mutation of fumarate hydratase (FH) gene, the HLRCC responsible gene mapped to chromosome 1q43, has been identified in patients with HLRCC. As the renal cancer in patients with HLRCC generally behave aggressively even in a small size, complete surgical resection and retroperitoneal lymph node resection should be performed promptly when the tumor is discovered. The surveillance of renal tumor in FH gene germline mutation-positive patients should be started from the early age using ultrasound sonography or magnetic resonance imaging.