RESUMEN
Non-canonical forms of nucleic acids represent challenging objects for both structure-determination and investigation of their potential role in living systems. In this work, we uncover a structure adopted by GA repetition locked in a parallel homoduplex by an i-motif. A series of DNA oligonucleotides comprising GAGA segment and C3 clip is analyzed by NMR and CD spectroscopies to understand the sequence-structure-stability relationships. We demonstrate how the relative position of the homopurine GAGA segment and the C3 clip as well as single-base mutations (guanine deamination and cytosine methylation) affect base pairing arrangement of purines, i-motif topology and overall stability. We focus on oligonucleotides C3GAGA and methylated GAGAC3 exhibiting the highest stability and structural uniformity which allowed determination of high-resolution structures further analyzed by unbiased molecular dynamics simulation. We describe sequence-specific supramolecular interactions on the junction between homoduplex and i-motif blocks that contribute to the overall stability of the structures. The results show that the distinct structural motifs can not only coexist in the tight neighborhood within the same molecule but even mutually support their formation. Our findings are expected to have general validity and could serve as guides in future structure and stability investigations of nucleic acids.
Asunto(s)
Repeticiones de Dinucleótido , Conformación de Ácido Nucleico , Purinas/química , Metilación de ADN , Espectroscopía de Resonancia Magnética , Oligonucleótidos/químicaRESUMEN
DNA conformation may deviate from the classical B-form in â¼13% of the human genome. Non-B DNA regulates many cellular processes; however, its effects on DNA polymerization speed and accuracy have not been investigated genome-wide. Such an inquiry is critical for understanding neurological diseases and cancer genome instability. Here, we present the first simultaneous examination of DNA polymerization kinetics and errors in the human genome sequenced with Single-Molecule Real-Time (SMRT) technology. We show that polymerization speed differs between non-B and B-DNA: It decelerates at G-quadruplexes and fluctuates periodically at disease-causing tandem repeats. Analyzing polymerization kinetics profiles, we predict and validate experimentally non-B DNA formation for a novel motif. We demonstrate that several non-B motifs affect sequencing errors (e.g., G-quadruplexes increase error rates), and that sequencing errors are positively associated with polymerase slowdown. Finally, we show that highly divergent G4 motifs have pronounced polymerization slowdown and high sequencing error rates, suggesting similar mechanisms for sequencing errors and germline mutations.
Asunto(s)
ADN/química , Genómica , Secuenciación de Nucleótidos de Alto Rendimiento , Conformación de Ácido Nucleico , Análisis de Secuencia de ADN , Replicación del ADN , G-Cuádruplex , Genómica/métodos , Genómica/normas , Secuenciación de Nucleótidos de Alto Rendimiento/métodos , Secuenciación de Nucleótidos de Alto Rendimiento/normas , Humanos , Cinética , Mutación , Motivos de Nucleótidos , Reproducibilidad de los Resultados , Análisis de Secuencia de ADN/métodosRESUMEN
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Asunto(s)
G-Cuádruplex , Secuencia de Bases , ADN/genética , Guanina , Regiones Promotoras GenéticasRESUMEN
The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.
Asunto(s)
ADN/química , Conformación de Ácido Nucleico , Motivos de Nucleótidos , Emparejamiento Base , Secuencia de Bases , Citosina/química , Citosina/metabolismo , ADN/metabolismo , Concentración de Iones de Hidrógeno , Cinética , TermodinámicaRESUMEN
i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.
Asunto(s)
ADN/química , Telómero/química , Adenina/análogos & derivados , Adenina/química , Citosina/química , Daño del ADN , Humanos , Pentoxil (Uracilo)/análogos & derivados , Pentoxil (Uracilo)/química , Uracilo/químicaRESUMEN
Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.
RESUMEN
Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.
Asunto(s)
Adenina/química , ADN/química , Furanos/química , G-Cuádruplex , Acortamiento del Telómero , Telómero/ultraestructura , Dicroismo Circular , ADN/genética , Humanos , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular , Oligonucleótidos/química , Soluciones , Telómero/genéticaRESUMEN
Abasic (AP) lesions are the most frequent type of damages occurring in cellular DNA. Here we describe the conformational effects of AP sites substituted for 2'-deoxyadenosine in the first (ap7), second (ap13) or third (ap19) loop of the quadruplex formed in K(+) by the human telomere DNA 5'-d[AG3(TTAG3)3]. CD spectra and electrophoresis reveal that the presence of AP sites does not hinder the formation of intramolecular quadruplexes. NMR spectra show that the structural heterogeneity is substantially reduced in ap7 and ap19 as compared to that in the wild-type. These two (ap7 and ap19) sequences are shown to adopt the hybrid-1 and hybrid-2 quadruplex topology, respectively, with AP site located in a propeller-like loop. All three studied sequences transform easily into parallel quadruplex in dehydrating ethanol solution. Thus, the AP site in any loop region facilitates the formation of the propeller loop. Substitution of all adenines by AP sites stabilizes the parallel quadruplex even in the absence of ethanol. Whereas guanines are the major determinants of quadruplex stability, the presence or absence of loop adenines substantially influences quadruplex folding. The naturally occurring adenine-lacking sites in the human telomere DNA can change the quadruplex topology in vivo with potentially vital biological consequences.
Asunto(s)
Adenina/química , Daño del ADN , G-Cuádruplex , Telómero/química , Guanina/química , Humanos , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular , Potasio/químicaRESUMEN
In this study we have chosen a new approach and characterized three miRNAs (miR-23a, miR-34a and miR-320a) related to prostate cancer and head and neck cancer by spectral (circular dichroic and UV-absorption spectra) and electrochemical (voltammetry at graphite and mercury electrodes) methods. The spectral and voltammetric results, reflecting different nucleotide sequences of miRNAs, were complemented by the results of DNAs(U) having the same oligonucleotide sequences as miRNAs. The effect of the substitution of ribose for deoxyribose was shown and structural diversity was confirmed. The stability of RNA and DNA(U) was studied using CD and UV-absorption spectroscopy and melting points were calculated. MiRNA-320a with the highest content of guanine provided the highest melting point. With respect to the rapid progress of miRNA electrochemical sensors, our results will be useful for the research and development of sensitive, portable and time-efficient miRNA sensors, which will be able to diagnose cancer and other diseases.
Asunto(s)
Biomarcadores de Tumor/sangre , Dicroismo Circular/métodos , Electroquímica/métodos , Neoplasias de Cabeza y Cuello/sangre , MicroARNs/sangre , Espectroscopía de Fotoelectrones/métodos , Neoplasias de la Próstata/sangre , Estudios de Casos y Controles , Femenino , Humanos , MasculinoRESUMEN
Electrochemical methods, particularly when applied in connection with mercury-containing electrodes, are excellent tools for studying nucleic acids structure and monitoring structural transitions. We studied the effect of the length of the central (dG) n stretch (varying from 0 to 15 guanine residues) in 15-mer oligodeoxynucleotides (ODN, G0 to G15) on their electrochemical and interfacial behavior at mercury and carbon electrodes. The intensity of guanine oxidation signal at the carbon electrode (peak G(ox)) was observed to increase continuously with number of guanines between 0 and 15, with only a slight positive shift for ODNs with seven or more guanines in the central segment. Very different effects were observed when the peak G(HMDE) was measured at the mercury electrode. Intensity of the latter signal increased with number of guanines up to G5, and decreased sharply with further elongation of the (dG) n stretch. CD spectroscopy and electrophoresis experiments revealed formation of parallel intermolecular quadruplex structures for ODNs containing five or more G residues. Further measurements made by cyclic and alternating-current voltammetry revealed a strong influence of the ODN structure on their behavior at electrically charged surfaces.
Asunto(s)
ADN/química , Técnicas Electroquímicas/métodos , G-Cuádruplex , Conformación de Ácido NucleicoRESUMEN
DNA concentration has been recently suggested to be the reason why different arrangements are revealed for K(+)-stabilized human telomere quadruplexes by experimental methods requiring DNA concentrations differing by orders of magnitude. As Raman spectroscopy can be applied to DNA samples ranging from those accessible by absorption and CD spectroscopies up to extremely concentrated solutions, gels and even crystals; it has been used here to clarify polymorphism of a core human telomeric sequence G(3)(TTAG(3))(3) in the presence of K(+) and Na(+) ions throughout wide range of DNA concentrations. We demonstrate that the K(+)-structure of G(3)(TTAG(3))(3) at low DNA concentration is close to the antiparallel fold of Na(+)-stabilized quadruplex. On the increase of G(3)(TTAG(3))(3) concentration, a gradual transition from antiparallel to intramolecular parallel arrangement was observed, but only for thermodynamically equilibrated K(+)-stabilized samples. The transition is synergically supported by increased K(+) concentration. However, even for extremely high G(3)(TTAG(3))(3) and K(+) concentrations, an intramolecular antiparallel quadruplex is spontaneously formed from desalted non-quadruplex single-strand after addition of K(+) ions. Thermal destabilization or long dwell time are necessary to induce interquadruplex transition. On the contrary, Na(+)-stabilized G(3)(TTAG(3))(3) retains its antiparallel folding regardless of the extremely high DNA and/or Na(+) concentrations, thermal destabilization or annealing.
Asunto(s)
ADN/química , G-Cuádruplex , Telómero/química , Humanos , Potasio/química , Espectrometría Raman , TemperaturaRESUMEN
For mimicking macromolecular crowding of DNA quadruplexes, various crowding agents have been used, typically PEG, with quadruplexes of micromolar strand concentrations. Thermal and thermodynamic stabilities of these quadruplexes increased with the concentration of the agents, the rise depended on the crowder used. A different phenomenon was observed, and is presented in this article, when the crowder was the quadruplex itself. With DNA strand concentrations ranging from 3 µM to 9 mM, the thermostability did not change up to â¼2 mM, above which it increased, indicating that the unfolding quadruplex units were not monomolecular above â¼2 mM. The results are explained by self-association of the G-quadruplexes above this concentration. The ΔG(°) 37 values, evaluated only below 2 mM, did not become more negative, as with the non-DNA crowders, instead, slightly increased. Folding topology changed from antiparallel to hybrid above 2 mM, and then to parallel quadruplexes at high, 6-9 mM strand concentrations. In this range, the concentration of the DNA phosphate anions approached the concentration of the K(+) counterions used. Volume exclusion is assumed to promote the topological changes of quadruplexes toward the parallel, and the decreased screening of anions could affect their stability.
Asunto(s)
ADN/química , G-Cuádruplex , Telómero/química , Dicroismo Circular , Densitometría , Electroforesis en Gel de Poliacrilamida , Entropía , Humanos , Microscopía de Fuerza Atómica , Espectrofotometría UltravioletaRESUMEN
Circular dichroism (CD) is remarkably sensitive to the conformational states of nucleic acids; therefore, CD spectroscopy has been used to study most features of DNA and RNA structures. Quadruplexes are among the significant noncanonical nucleic acids architectures that have received special attentions recently. This article presents examples on the contribution of CD spectroscopy to our knowledge of quadruplex structures and their polymorphism. The examples were selected to demonstrate the potential of this simple method in the quadruplex field. As CD spectroscopy detects only the global feature of a macromolecule, it should preferably be used in combination with other techniques. On the other hand, CD spectroscopy, often as a pioneering approach, can reveal the formation of particular structural arrangements, to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters and also detect formation of higher order structures. This article aims to show that CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies.
Asunto(s)
Dicroismo Circular/métodos , ADN/química , G-Cuádruplex , Conformación de Ácido Nucleico , Guanina/química , Cinética , Oligonucleótidos/química , Termodinámica , Difracción de Rayos XRESUMEN
BACKGROUND: Canonical telomeres (telomerase-synthetised) are readily forming G-quadruplexes (G4) on the G-rich strand. However, there are examples of non-canonical telomeres among eukaryotes where telomeric tandem repeats are invaded by specific retrotransposons. Drosophila melanogaster represents an extreme example with telomeres composed solely by three retrotransposons-Het-A, TAHRE and TART (HTT). Even though non-canonical telomeres often show strand biased G-distribution, the evidence for the G4-forming potential is limited. RESULTS: Using circular dichroism spectroscopy and UV absorption melting assay we have verified in vitro G4-formation in the HTT elements of D. melanogaster. Namely 3 in Het-A, 8 in TART and 2 in TAHRE. All the G4s are asymmetrically distributed as in canonical telomeres. Bioinformatic analysis showed that asymmetric distribution of potential quadruplex sequences (PQS) is common in telomeric retrotransposons in other Drosophila species. Most of the PQS are located in the gag gene where PQS density correlates with higher DNA sequence conservation and codon selection favoring G4-forming potential. The importance of G4s in non-canonical telomeres is further supported by analysis of telomere-associated retrotransposons from various eukaryotic species including green algae, Diplomonadida, fungi, insects and vertebrates. Virtually all analyzed telomere-associated retrotransposons contained PQS, frequently with asymmetric strand distribution. Comparison with non-telomeric elements showed independent selection of PQS-rich elements from four distinct LINE clades. CONCLUSION: Our findings of strand-biased G4-forming motifs in telomere-associated retrotransposons from various eukaryotic species support the G4-formation as one of the prerequisites for the recruitment of specific retrotransposons to chromosome ends and call for further experimental studies.
RESUMEN
Aptamer-based biosensors offer promising perspectives for high performance, specific detection of proteins. The thrombin binding aptamer (TBA) is a G-quadruplex-forming DNA sequence, which is frequently elongated at one end to increase its analytical performances in a biosensor configuration. Herein, we investigate how the elongation of TBA at its 5'â end affects its structure and stability. Circular dichroism spectroscopy shows that TBA folds in an antiparallel G-quadruplex conformation with all studied cations (Ba(2+), Ca(2+), K(+), Mg(2+), Na(+), NH(4)(+), Sr(2+) and the [Ru(NH(3))(6)](2+/3+) redox marker) whereas other structures are adopted by the elongated aptamers in the presence of some of these cations. The stability of each structure is evaluated on the basis of UV spectroscopy melting curves. Thermal difference spectra confirm the quadruplex character of all conformations. The elongated sequences can adopt a parallel or an antiparallel structure, depending on the nature of the cation; this can potentially confer an ion-sensitive switch behavior. This switch property is demonstrated with the frequently employed redox complex [Ru(NH(3))(6)](3+), which induces the parallel conformation at very low concentrations (10 equiv per strand). The addition of large amounts of K(+) reverts the conformation to the antiparallel form, and opens interesting perspectives for electrochemical biosensing or redox-active responsive devices.
Asunto(s)
Aptámeros de Nucleótidos/química , Cationes/química , Oligonucleótidos/química , Potasio/química , Rutenio/química , Trombina/química , Secuencia de Bases , Técnicas Biosensibles , Dicroismo Circular , Análisis Diferencial Térmico , Electroquímica , G-Cuádruplex , Conformación de Ácido Nucleico , Oligonucleótidos/metabolismo , Espectroscopía de Fotoelectrones , Potasio/metabolismoRESUMEN
Nucleic acids bear the genetic information and participate in its expression and evolution during replication, repair, recombination, transcription, and translation. These phenomena are mostly based on recognition of nucleic acids by proteins. The major factor enabling the specific recognition is structure. Circular dichroism (CD) spectroscopy is very useful to study secondary structures of nucleic acids, in general, and DNA, in particular. CD sensitively reflects isomerizations among distinct conformational states. The isomerizations may operate as molecular switches regulating various physiological or pathological processes. Here, we review CD spectra of nucleic acids, beginning with early studies on natural DNA molecules through analyses of synthetic polynucleotides to study of selected genomic fragments.
Asunto(s)
Dicroismo Circular , ADN/química , G-Cuádruplex , Secuencia de Bases , ADN/genética , Humanos , Repeticiones de TrinucleótidosRESUMEN
G-quadruplexes (G4s), a type of non-B DNA, play important roles in a wide range of molecular processes, including replication, transcription, and translation. Genome integrity relies on efficient and accurate DNA synthesis, and is compromised by various stressors, to which non-B DNA structures such as G4s can be particularly vulnerable. However, the impact of G4 structures on DNA polymerase fidelity is largely unknown. Using an in vitro forward mutation assay, we investigated the fidelity of human DNA polymerases delta (δ4, four-subunit), eta (η), and kappa (κ) during synthesis of G4 motifs representing those in the human genome. The motifs differ in sequence, topology, and stability, features that may affect DNA polymerase errors. Polymerase error rate hierarchy (δ4 < κ < η) is largely maintained during G4 synthesis. Importantly, we observed unique polymerase error signatures during synthesis of VEGF G4 motifs, stable G4s which form parallel topologies. These statistically significant errors occurred within, immediately flanking, and encompassing the G4 motif. For pol δ4, the errors were deletions, insertions and complex errors within the G4 or encompassing the G4 motif and surrounding sequence. For pol η, the errors occurred in 3' sequences flanking the G4 motif. For pol κ, the errors were frameshift mutations within G-tracts of the G4. Because these error signatures were not observed during synthesis of an antiparallel G4 and, to a lesser extent, a hybrid G4, we suggest that G4 topology and/or stability could influence polymerase fidelity. Using in silico analyses, we show that most polymerase errors are predicted to have minimal effects on predicted G4 stability. Our results provide a unique view of G4s not previously elucidated, showing that G4 motif heterogeneity differentially influences polymerase fidelity within the motif and flanking sequences. Thus, our study advances the understanding of how DNA polymerase errors contribute to G4 mutagenesis.
Asunto(s)
G-Cuádruplex , ADN/genética , Replicación del ADN , ADN Polimerasa Dirigida por ADN/genética , ADN Polimerasa Dirigida por ADN/metabolismo , Humanos , Factor A de Crecimiento Endotelial Vascular/genéticaRESUMEN
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.
Asunto(s)
Dicroismo Circular , ADN/química , ADN de Forma A/química , ADN de Forma Z/química , G-Cuádruplex , Conformación de Ácido Nucleico , Desnaturalización de Ácido NucleicoRESUMEN
Guanine quadruplexes (G4s) serve as regulators of replication, recombination and gene expression. G4 motifs have been recently identified in LTR retrotransposons, but their role in the retrotransposon life-cycle is yet to be understood. Therefore, we inserted G4s into the 3'UTR of Ty1his3-AI retrotransposon and measured the frequency of retrotransposition in yeast strains BY4741, Y00509 (without Pif1 helicase) and with G4-stabilization by N-methyl mesoporphyrin IX (NMM) treatment. We evaluated the impact of G4s on mRNA levels by RT-qPCR and products of reverse transcription by Southern blot analysis. We found that the presence of G4 inhibited Ty1his3-AI retrotransposition. The effect was stronger when G4s were on a transcription template strand which leads to reverse transcription interruption. Both NMM and Pif1p deficiency reduced the retrotransposition irrespective of the presence of a G4 motif in the Ty1his3-AI element. Quantity of mRNA and products of reverse transcription did not fully explain the impact of G4s on Ty1his3-AI retrotransposition indicating that G4s probably affect some other steps of the retrotransposon life-cycle (e.g., translation, VLP formation, integration). Our results suggest that G4 DNA conformation can tune the activity of mobile genetic elements that in turn contribute to shaping the eukaryotic genomes.
RESUMEN
Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.